ID: 952874881

View in Genome Browser
Species Human (GRCh38)
Location 3:37936253-37936275
Sequence CCCTGGGGACATTTATCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952874881 Original CRISPR CCCTGGGGACATTTATCTCA TGG Intronic
900547121 1:3235417-3235439 CCCTGGGGACATCAATCTTCCGG + Intronic
900786016 1:4651120-4651142 CTCTGAGGCCATTTATCTAATGG - Intergenic
901689023 1:10960581-10960603 CCCTGGGCACACTTAACCCAGGG + Intronic
902120840 1:14164258-14164280 CCCTGGGCACATCCATCTGAGGG + Intergenic
903736052 1:25530487-25530509 CCCTGGGAACATTTTTCACAAGG + Intergenic
904846363 1:33421169-33421191 CTCTGGGGACTGTGATCTCATGG + Intronic
907323642 1:53621194-53621216 CCCATGGGACACTTAGCTCAGGG + Intronic
908153032 1:61324196-61324218 CCCTGGGGACACTGCTCTCAGGG - Intronic
910507594 1:87967870-87967892 CGCTTGTGACATTTATCTCTAGG + Intergenic
911405517 1:97433138-97433160 CACTGGGGGGATTTCTCTCAAGG + Intronic
912763644 1:112389798-112389820 TCCTGGGGACAATTTGCTCAGGG - Intergenic
920860370 1:209700566-209700588 GCCTGGAGACATTTTCCTCATGG + Intronic
921000529 1:211038976-211038998 CCCTGGAGACATTTTCCCCATGG - Intronic
921021731 1:211242079-211242101 GCCTGGGCATATTTTTCTCATGG - Intergenic
921684631 1:218075852-218075874 CCAAGGATACATTTATCTCAGGG - Intergenic
923497352 1:234537145-234537167 CCCTGAAGACATTTGTCTCTTGG + Intergenic
923687319 1:236162482-236162504 GCCTGGGGACATTTTCCCCATGG - Intronic
1068676891 10:59777926-59777948 GCCTGGAGACATTTTCCTCATGG + Intergenic
1075055093 10:119212297-119212319 CCTTGTGGGCATTTATCTGATGG - Intronic
1075816869 10:125271427-125271449 CCCTTTGGACACTTGTCTCATGG - Intergenic
1077282567 11:1752336-1752358 ACCTGGGGCCATTTATTTCCCGG + Intronic
1077972803 11:7212981-7213003 CCTTGGGGACTTGTCTCTCATGG - Intergenic
1078454926 11:11467536-11467558 CCTTGGGGACATTTATGGCTGGG - Intronic
1080376705 11:31721671-31721693 CCCTGGGGACATTAATCAATTGG + Intronic
1080851037 11:36070454-36070476 CCTTGTGGATATTTATCTCATGG + Intronic
1081528219 11:43941614-43941636 CACTGGTGAGATTTAGCTCAGGG + Intronic
1082291620 11:50381354-50381376 TCATGTGGACATTCATCTCATGG + Intergenic
1082749534 11:57001614-57001636 CCCTGGGCTCATTTATGTTATGG + Intergenic
1085687114 11:78633421-78633443 CACTGGGGACATTTGTCCCTAGG + Intergenic
1086995796 11:93353914-93353936 TCCTGGGGACATTTTCCCCATGG + Intronic
1087749154 11:101987472-101987494 TCCTGAGGATATTTAACTCATGG + Intronic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1093258176 12:16898935-16898957 ACATGGAGACATTTATTTCATGG - Intergenic
1093300023 12:17442711-17442733 GCCTGGAGACATTTTTCCCATGG - Intergenic
1094420224 12:30263524-30263546 GCCTGGAGACATTTTTCTCATGG - Intergenic
1095835753 12:46637520-46637542 CCCTGGGGAGATCCATCCCAGGG - Intergenic
1095916168 12:47481110-47481132 CCCTAGGGTCATTTATCTCCAGG - Intergenic
1097400762 12:59125058-59125080 CCCTGGAGACATTTTCCTCACGG + Intergenic
1099846222 12:88031435-88031457 CCCTGGAGACATTTTCCCCATGG + Intronic
1101506934 12:105355547-105355569 CTCTGGGGACAGTTATGGCAGGG + Intronic
1105530199 13:21212248-21212270 CCCTGGAGACATTTTCCCCATGG - Intergenic
1106821399 13:33468464-33468486 CCATGGGGACATTTCTCTCATGG + Intergenic
1107045720 13:35990153-35990175 CCTTGGGGACAATTAACACATGG - Intronic
1109522460 13:63531851-63531873 GCCTGGAGACATTTTCCTCATGG - Intergenic
1109526345 13:63580716-63580738 CCCTGGAGACATTTTCCCCATGG + Intergenic
1110543079 13:76727747-76727769 TCCTGGAGACATTTTCCTCAGGG - Intergenic
1111219031 13:85180459-85180481 CCCTGGAGATATTTTTCCCATGG - Intergenic
1111574786 13:90138486-90138508 CCATGGGGAGTTTTATCTCCAGG + Intergenic
1112895894 13:104299337-104299359 TTCTGGAGACATGTATCTCATGG - Intergenic
1116127102 14:40801318-40801340 CCCTGTAGACATTTTTCCCATGG + Intergenic
1116147886 14:41099370-41099392 GCCTGGAGACATTTTCCTCATGG - Intergenic
1116256214 14:42559542-42559564 CCCTGGAGACATTTTCCCCATGG + Intergenic
1117198557 14:53364541-53364563 CCCTGGAGACATTTTCCCCATGG + Intergenic
1120413744 14:84193666-84193688 CCCTGGAGACATTTTTCCCATGG - Intergenic
1120443233 14:84563959-84563981 CCCTGGAGACATTTTCCTCATGG - Intergenic
1121112886 14:91324392-91324414 CCCTGGGTACATTTATAGCAGGG + Intronic
1124891242 15:33735302-33735324 CCCTGGGGCTTTTTATCACAAGG + Intronic
1125973189 15:43928854-43928876 GCCTGAGGACATTTATCTTCAGG + Intronic
1126335554 15:47583124-47583146 CCCTTTGGCCATATATCTCAAGG + Intronic
1131153529 15:90061612-90061634 CCCTTGGGACACAGATCTCAGGG - Intronic
1133096497 16:3450327-3450349 CCCTGAGAACATTTTTCCCAGGG - Intronic
1134153641 16:11824591-11824613 CCTTGGGGACAGTTCACTCAAGG + Intergenic
1134237278 16:12476935-12476957 CCTTGGGGACTTTTCTCTCTGGG + Intronic
1134769423 16:16794116-16794138 CCTTGGGGACATTGATGGCAGGG + Intergenic
1135067541 16:19323204-19323226 CCCTTAGGACATATATCTCCTGG - Intergenic
1138190911 16:55013384-55013406 CCCTGGGGACATTTGGCACAAGG - Intergenic
1139812827 16:69636832-69636854 GCCTGGAGACATTTTCCTCATGG + Intronic
1140854319 16:78964695-78964717 GCCTGGAGACATTTTCCTCATGG - Intronic
1140884957 16:79234941-79234963 CCTTGGGGATGTTTCTCTCATGG - Intergenic
1140963200 16:79937401-79937423 CCCTGGGGTCATTTACCTACTGG + Intergenic
1142119863 16:88381999-88382021 CCCGGGGGACCTTTGTCTGAAGG + Intergenic
1145751916 17:27361376-27361398 CCCTGTGGAAATCTTTCTCAGGG + Intergenic
1146697314 17:34919705-34919727 GCCTGGGGACATTTTCCCCATGG - Intergenic
1146908520 17:36633160-36633182 CTCTGGGGACATTCCCCTCAGGG - Intergenic
1146908771 17:36634461-36634483 CACTGGAGACATATATCCCAGGG - Intergenic
1148709219 17:49664936-49664958 GCCAGGGGAGATTTATCTAAAGG - Intronic
1149686970 17:58541370-58541392 GCCTGGGGACACTTCTCTTAAGG + Intergenic
1149864268 17:60141785-60141807 CCCTGGGGAGCTTTCCCTCACGG + Intergenic
1151541938 17:74768996-74769018 CCCTGGACCCATTTATCACATGG - Exonic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1155675591 18:28425514-28425536 CCCTGGAGACATTTTCCCCATGG - Intergenic
1156758899 18:40562600-40562622 CTGTGGGGTCATTTTTCTCAAGG - Intergenic
1156858900 18:41814014-41814036 CCCTGGAGACATTTTCCCCATGG + Intergenic
1156887439 18:42151776-42151798 CCCTGGGCACACTTCTCTCATGG + Intergenic
1159776185 18:72605641-72605663 CCCTGGTGATATTTATGTCTGGG + Intronic
1159878366 18:73834555-73834577 CCCTGGAGACCTTTATCACCTGG - Intergenic
1160615881 18:80127973-80127995 CCCTGTGCAAATTTATCACAAGG + Intronic
1162180098 19:8862795-8862817 CACTGGGGACGTCTAGCTCAAGG + Intronic
1164754120 19:30677553-30677575 CCCGGGGGACATTTTGCTCTGGG - Intronic
1166072702 19:40396158-40396180 CCTTGGGGAGTTTTATCTCTGGG + Exonic
1166496469 19:43306458-43306480 CCCTGGGGACAGTGATGTCTGGG + Intergenic
925805208 2:7641532-7641554 GCCTGGAGATATTTACCTCATGG + Intergenic
925805682 2:7645404-7645426 CTCTGGAGACATTTACCCCATGG + Intergenic
925910449 2:8570296-8570318 TCCTGGGGAAATTTAAGTCATGG + Intergenic
926868914 2:17391312-17391334 CCCTGGAGACATTTTCCCCATGG - Intergenic
927246256 2:20959202-20959224 CCCTGGGCATCCTTATCTCAGGG + Intergenic
927605563 2:24483666-24483688 CCCTGGAGACATTTTCCCCATGG - Intergenic
928329838 2:30349158-30349180 CCATGGGCACATTGATGTCATGG + Intergenic
928830102 2:35471710-35471732 CACTGAAGACAATTATCTCATGG - Intergenic
931176307 2:59858500-59858522 CCCTGGGGCCATGTGTCTGAGGG - Intergenic
931967175 2:67546702-67546724 CCCTGGAGACATGTTTCTCAAGG + Intergenic
933681012 2:85100790-85100812 ACCAGGTGAGATTTATCTCAAGG + Intergenic
933817491 2:86079897-86079919 CACTGGGTACAGTTATCCCATGG + Intronic
935586214 2:104802191-104802213 TCCTGGAGTCATTTATGTCAGGG - Intergenic
936792256 2:116164317-116164339 GCCTGGAGACATTTTCCTCATGG - Intergenic
936913202 2:117613728-117613750 CCCTGGACACAATTATCTCAGGG + Intergenic
937527461 2:122788622-122788644 CCCTGTGGACATTTTCCCCACGG - Intergenic
938405747 2:131032234-131032256 CCCTGGGGACATCTGTCCCCAGG - Intronic
939559339 2:143714442-143714464 GCCTGGAGACATTTTTCCCATGG + Intronic
943823188 2:192354262-192354284 CCCTCGAGACATGTAACTCAAGG - Intergenic
946292116 2:218753355-218753377 CCCTGGGTACCTTTCTTTCAAGG + Intronic
946930179 2:224662942-224662964 CCCTGGAGACATTTTTCCCATGG + Intergenic
947886572 2:233576670-233576692 CCCTGGAGACATTTTCCCCATGG + Intergenic
947893487 2:233646310-233646332 CCCTGGAGACATTTTCCCCATGG + Intronic
1170364990 20:15588384-15588406 GCCTGGAGACATTTTCCTCACGG + Intronic
1176413544 21:6461734-6461756 CCCTGGAGCCCCTTATCTCAAGG + Intergenic
1179689041 21:43070057-43070079 CCCTGGAGCCCCTTATCTCAAGG + Intronic
1182350170 22:29694983-29695005 CCCTGTAGAGATTTCTCTCATGG + Exonic
949244220 3:1906448-1906470 TCCTGGGGACATTCATTTCCTGG - Intergenic
949953772 3:9250960-9250982 ATTTGGGAACATTTATCTCAGGG - Intronic
950144019 3:10635055-10635077 TCCCAGGGACATTTATCTCGGGG - Intronic
950700751 3:14743974-14743996 GCCTGGAGACATTTTTCCCATGG + Intronic
950748358 3:15108550-15108572 CCCTGGGTTCTTTTATCTCTGGG + Intergenic
952715141 3:36472367-36472389 CCCTGGAGACATTTTCCCCATGG + Intronic
952826704 3:37530501-37530523 CCCTGGGGCCACCTATCTCCAGG - Intronic
952874881 3:37936253-37936275 CCCTGGGGACATTTATCTCATGG + Intronic
952908749 3:38164861-38164883 GCCTGGTGACATTTTTTTCAAGG - Intergenic
953274407 3:41480912-41480934 TCATGGGGACAGTTATCTCCAGG - Intronic
957276042 3:78093022-78093044 CCCTGGAGACATTTTCCTCATGG - Intergenic
957759173 3:84532960-84532982 CCCTGGAGACATTTTCCCCATGG - Intergenic
959342595 3:105149484-105149506 GCCTGGAGACATTTTTCCCATGG + Intergenic
959657486 3:108825665-108825687 ACTTGGGGACATTTATTTCTTGG - Intronic
959893718 3:111583877-111583899 GCCTGGGGACATTTTCCCCATGG + Intronic
963379342 3:144507762-144507784 CCCTGGAGACATTTTTCCCATGG + Intergenic
968481193 4:833789-833811 CCTTGGGGACACCAATCTCAGGG - Intergenic
970196834 4:13559505-13559527 CACTGGAGAGATTTATGTCAAGG + Intergenic
970218113 4:13780021-13780043 GCCTGGAGACATTTTCCTCATGG + Intergenic
970519986 4:16873122-16873144 CCCTGGGAATATTTAGCCCAGGG + Intronic
971793711 4:31199911-31199933 GCCTGGAGACATTTTCCTCATGG + Intergenic
973146933 4:46838934-46838956 GCCTGGGGACTTTGATTTCATGG - Intronic
975084523 4:70321874-70321896 GCCTCTGGACATCTATCTCAAGG + Intergenic
975254029 4:72213326-72213348 GCCTGGAGACATTTTCCTCATGG + Intergenic
977996487 4:103502357-103502379 CCCTGGAGACATTTTCCTCATGG - Intergenic
978506442 4:109462966-109462988 CCCTCAGGACATTACTCTCAAGG + Exonic
978696379 4:111584765-111584787 CCCTGGAGACATTTTCCCCATGG + Intergenic
978934195 4:114355230-114355252 GCCTGGAGACATTTTTCCCATGG + Intergenic
984774219 4:183466853-183466875 GCCTGGAGACATTTTTCCCATGG - Intergenic
985766440 5:1782085-1782107 CACTGGGGCCATTTAGCTGAGGG + Intergenic
986081606 5:4400421-4400443 TCTTGGAGGCATTTATCTCATGG - Intergenic
986113981 5:4750893-4750915 CCCTGGAGACATTTTCCCCATGG + Intergenic
986561217 5:9062218-9062240 CCCTGGGCACATTTGTCTGCAGG - Intronic
987680720 5:21133252-21133274 TCCTGGAGATATTTTTCTCATGG - Intergenic
987894397 5:23925874-23925896 GCCTGGAGACATTTTTCCCATGG + Intergenic
988129179 5:27080404-27080426 CCCTGGAGACATTTTCCCCATGG + Intronic
988740150 5:34061831-34061853 CCCTGGAGACATTTTCCCCATGG + Intronic
989489881 5:42037859-42037881 CCTTGGGGAGATTTATTTGATGG + Intergenic
990023072 5:51152414-51152436 ATCTGGTGAGATTTATCTCAGGG + Intergenic
994335484 5:98560589-98560611 TCATGGGGAGAATTATCTCAGGG + Intergenic
995053863 5:107737241-107737263 TCTTGGGAACCTTTATCTCATGG + Intergenic
996263985 5:121512269-121512291 CCATGGGAACATTTTTCACATGG + Intergenic
999580322 5:153031278-153031300 CCCTGGGGACATTTTAGTCATGG + Intergenic
1000030544 5:157397502-157397524 GCCTGGAGACATTTTCCTCATGG + Intronic
1000247991 5:159465763-159465785 CCCAGGGGACATTATACTCAAGG - Intergenic
1000648488 5:163786042-163786064 CCCTGGAGACATTTTCCCCATGG + Intergenic
1000984402 5:167851020-167851042 CCTTGGAGAAATTTATCTCCTGG - Intronic
1001826953 5:174752719-174752741 CCCGGAGGACATTTGTCCCAAGG - Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003401808 6:5796640-5796662 CCCTGGAGACATTTTCCCCATGG + Intergenic
1007413364 6:41677993-41678015 CCCTGGGGACATTTTTTTGGGGG - Intergenic
1008440325 6:51525397-51525419 CTCTGGGAACATTTCACTCATGG + Intergenic
1008664597 6:53703683-53703705 TTCTGGGGACATTTACCTCCCGG + Intergenic
1009546420 6:65025860-65025882 CCCTGGGGAGTTTTTTCTAATGG - Intronic
1011507710 6:88066556-88066578 GCTTGGGGATATTTATCTAAAGG + Exonic
1012254380 6:97015739-97015761 CCCTGGGGACATTTTCCCCATGG - Intronic
1012281004 6:97328387-97328409 CCCTGGAGACATTTTCCCCATGG - Intergenic
1013928923 6:115505791-115505813 TCCTGTGGACAATTATTTCAGGG - Intergenic
1019559689 7:1649851-1649873 CCCTGCGGACACTGATCTCTCGG - Intergenic
1024370674 7:48580368-48580390 CCCCAGGGAGATTTACCTCAGGG - Exonic
1030144737 7:106341578-106341600 CCCTGGAGACATTTTCCCCAGGG + Intergenic
1030307602 7:108034942-108034964 CCCTCGGTACATTCTTCTCAAGG - Intronic
1036749605 8:11435481-11435503 CTCTGGGGAAATTTAACTAACGG - Intronic
1037736561 8:21571652-21571674 TCCTGGAGCCATGTATCTCATGG - Intergenic
1037919892 8:22798396-22798418 CCCTGGGGTGATTTAGCGCAGGG - Intronic
1041145520 8:54872196-54872218 CCTTGATGACATTTATTTCATGG + Intergenic
1041497510 8:58503238-58503260 CCCTGGAGACATTTTCCCCATGG - Intergenic
1041966431 8:63683795-63683817 CCCTGAGGACATTTACTCCAGGG + Intergenic
1042953655 8:74225729-74225751 GCCTGGAGACATTTTCCTCATGG + Intergenic
1043656269 8:82671719-82671741 CCTTGGTGTCATATATCTCAGGG - Intergenic
1047056215 8:121167655-121167677 CCAAGAGGACATTTATATCAGGG + Intergenic
1048116656 8:131531651-131531673 CCCTGGAGACATTTTCCCCATGG - Intergenic
1048324544 8:133429006-133429028 CCCTGGGGACTTTGAGCTCAGGG - Intergenic
1048408411 8:134146347-134146369 CCCGAGGGACATTTGTCCCACGG - Intergenic
1049209536 8:141379110-141379132 CCCTGGGGACCCTGATCTGAGGG + Intergenic
1050479041 9:6070797-6070819 CCCTGGAGACATTCTGCTCATGG - Intergenic
1050929090 9:11301436-11301458 GCCTGGGGACATTTTCCCCATGG + Intergenic
1050999318 9:12260531-12260553 GCCTTGGGAAATTTATTTCATGG - Intergenic
1051840815 9:21396091-21396113 CCCCCGAGACATTTTTCTCATGG - Intergenic
1052522167 9:29562638-29562660 CCCTGGAGACATTTTCCCCATGG - Intergenic
1054394073 9:64637670-64637692 CCCTGGGGACAAAGATCTGATGG - Intergenic
1054428723 9:65142883-65142905 CCCTGGGGACAAAGATCTGATGG - Intergenic
1054501657 9:65878660-65878682 CCCTGGGGACAAAGATCTGATGG + Intronic
1056453026 9:86734896-86734918 CCCTGGGAAAATTTACTTCAAGG - Intergenic
1056710480 9:88988901-88988923 CCATGGTGTCATTTAACTCATGG + Intergenic
1060178417 9:121514582-121514604 GCCTGGAGACATTTTTCCCATGG + Intergenic
1061479513 9:130890148-130890170 CCCTGGGCACAGTTCTCTCCTGG - Intergenic
1186487733 X:9946482-9946504 GCCTGGGGGCATGTGTCTCATGG - Intronic
1186847660 X:13546435-13546457 CCTTGGGTACATTTATTTCTAGG + Intergenic
1187555126 X:20344332-20344354 GCCTGGAGACATTTTCCTCATGG - Intergenic
1188162303 X:26819208-26819230 CCCTGGAGACATTTTCCCCATGG - Intergenic
1188783116 X:34309552-34309574 CCCTGGGGAGATTAATCACCTGG + Intergenic
1189260946 X:39678492-39678514 CAGTGGGGACATTTATCACCCGG + Intergenic
1190376794 X:49796191-49796213 CCTTGGGGGCCTTTCTCTCAGGG + Intergenic
1192508483 X:71706633-71706655 CACTTGGTACATTTTTCTCACGG - Intergenic
1192512164 X:71728083-71728105 CACTTGGTACATTTTTCTCACGG + Intergenic
1192514533 X:71753422-71753444 CACTTGGTACATTTTTCTCACGG - Intergenic
1192518214 X:71774920-71774942 CACTTGGTACATTTTTCTCACGG + Intergenic
1193503604 X:82310478-82310500 GCCTGGAGACATTTTCCTCATGG + Intergenic
1193507976 X:82366014-82366036 CCCTGGTTAGCTTTATCTCAAGG + Intergenic
1193797170 X:85891306-85891328 GCCTGGAGACATTTTCCTCATGG - Intronic
1194215848 X:91129228-91129250 GCCTGGAGACATTTACCCCATGG + Intergenic
1194231444 X:91330066-91330088 CCCTGTGCATATTTATATCATGG - Intergenic
1194544294 X:95213506-95213528 CCCCAGTGACATATATCTCAAGG - Intergenic
1195210141 X:102646420-102646442 GCCTGGAGACATTTTTCCCATGG + Intergenic
1196543257 X:116934267-116934289 CCCTGGAGACATTTTCCCCATGG - Intergenic
1197665993 X:129224103-129224125 CCTTGGGCACGTTTTTCTCACGG + Intergenic
1198083398 X:133261021-133261043 TCATGGGGACATTTGTCACATGG + Intergenic
1199291164 X:146106149-146106171 CCCTGGAGACATTTTCCCCATGG + Intergenic
1199325441 X:146493384-146493406 GCCTGGAGACATTTTTCCCATGG - Intergenic