ID: 952877577

View in Genome Browser
Species Human (GRCh38)
Location 3:37959738-37959760
Sequence TTGTGGAAATGCTAGGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952877577 Original CRISPR TTGTGGAAATGCTAGGTCAA AGG Intronic
903038353 1:20509399-20509421 AGGTAGAATTGCTAGGTCAATGG + Intergenic
904648125 1:31983585-31983607 GAGTGGAACTGCTAGGTCAGAGG - Intergenic
906174952 1:43762997-43763019 AAGTGGAAATGCTGGGTCCAAGG - Intronic
906572754 1:46858304-46858326 TTATTGAAATGCAAGGTTAAGGG + Intergenic
908017746 1:59862365-59862387 TTGTGGAAATGATTGGAAAATGG + Intronic
908448374 1:64224215-64224237 AAGTGGAAATGCTGTGTCAAAGG - Intronic
910610056 1:89131565-89131587 ATGTGGAAATGCTAGATCAAAGG + Intronic
912250441 1:108006543-108006565 TTTTGGAATTATTAGGTCAAAGG - Intergenic
912879332 1:113392041-113392063 TTGTTGAAGTGGTAGGTTAAAGG + Intronic
912955376 1:114151968-114151990 TTGTGGCAATGTTTAGTCAATGG - Intronic
913523318 1:119666975-119666997 GAGTGGAAATGCTATGTCATAGG + Intronic
914751319 1:150537088-150537110 TTGGGGAAAAGCTGGGGCAAGGG - Intergenic
916779752 1:168012002-168012024 AAGTGGAAATATTAGGTCAATGG + Intronic
917504024 1:175612163-175612185 CTGTGGAAAGGCAAGGGCAAGGG - Intronic
917878520 1:179309397-179309419 AAGTGAAATTGCTAGGTCAAAGG + Intronic
917988309 1:180345486-180345508 TTCTAGAAATGCTAAGTGAAAGG - Intronic
918942249 1:191015541-191015563 AAGTGGAAAGGCTGGGTCAATGG + Intergenic
919608871 1:199720310-199720332 ATCTGGAAAAGCTAGGTAAAGGG + Intergenic
919957699 1:202435788-202435810 TTGTGGAAATGAGAGAACAAAGG + Intronic
921333326 1:214062339-214062361 TTGTGGAAAACCTAGGTGATGGG - Intergenic
921378463 1:214499113-214499135 TTAGTGTAATGCTAGGTCAAAGG - Intronic
921755422 1:218850234-218850256 TTGTGGATATCCAAGGACAATGG + Intergenic
922991289 1:229914268-229914290 GAGTGGAAATGCCAGGTCAGAGG + Intergenic
923266447 1:232319173-232319195 TTGTGCAACTGCTATTTCAAGGG - Intergenic
923621802 1:235585748-235585770 TTCTGGAATTACTGGGTCAAAGG + Intronic
924091023 1:240500872-240500894 CGGTGGAAATGCTGGGTCACAGG + Intronic
924197400 1:241622624-241622646 TTGTTGAAATTCTAGAACAATGG - Intronic
924307592 1:242707267-242707289 AAGTAGAAATGCTGGGTCAAAGG + Intergenic
924834041 1:247630220-247630242 TAATGGGAATGCTGGGTCAAAGG + Intergenic
1063694205 10:8317121-8317143 ATTTGGAAATTCTAGGTCAGGGG + Intergenic
1064151185 10:12866521-12866543 AGGTGGAATTGCTGGGTCAAGGG - Intergenic
1064366495 10:14713227-14713249 TTATGGAATTGCTGGGTCAAGGG - Intronic
1065083773 10:22153836-22153858 TAATTGGAATGCTAGGTCAATGG - Intergenic
1066309355 10:34180726-34180748 TTGTGGAAAATCTAAATCAATGG + Intronic
1068073797 10:52228955-52228977 TTGAGGATATGCTATGTCAGTGG - Intronic
1068735099 10:60405148-60405170 ATGTGGAATTGCTAGGTTATAGG - Intronic
1069830607 10:71280140-71280162 TTGGGGAAATGCTAATCCAAGGG - Intronic
1070054007 10:72916696-72916718 TAATGGCATTGCTAGGTCAAAGG + Intronic
1071529132 10:86376088-86376110 CAGTGGAATTGCTGGGTCAAAGG + Intergenic
1071530352 10:86386400-86386422 GAGTGGAAATGCTGGGTCAGAGG - Intergenic
1071538909 10:86461561-86461583 GTGTGGAACTGCTAAGTCAAAGG + Intronic
1071866657 10:89741819-89741841 ATGTGGATATGCTAGGCAAAGGG - Intronic
1072541913 10:96405029-96405051 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1072625736 10:97110299-97110321 GAGTGGAATTGCTAGGTCATGGG - Intronic
1073665070 10:105522350-105522372 TTGTGGAAAAGCATGGTAAATGG + Intergenic
1074579199 10:114701386-114701408 ATGTGGAATTGCTAGGTCGGAGG - Intergenic
1075212030 10:120499664-120499686 TGCTGGAAATGCTAGCTCTAAGG + Intronic
1075605507 10:123802668-123802690 GAGTGGAATTGCTAGGTCATAGG + Intronic
1076432395 10:130414151-130414173 GTGTGGAAAGGATAGATCAAAGG - Intergenic
1078076241 11:8163859-8163881 CTATGGAAATGCTAGGTCACAGG + Intronic
1078523650 11:12084339-12084361 GAGTGGAATTGCTAGGTCATAGG - Intergenic
1078553907 11:12302279-12302301 GGGTGGAATTGCTAGGTCATAGG + Intronic
1078925035 11:15866946-15866968 GTGTGTAATTGCTTGGTCAAAGG - Intergenic
1079634779 11:22722939-22722961 TTATGGAAATGATATGTTAATGG - Intronic
1080047986 11:27829383-27829405 TTGTGGGAAAGCTGGGTGAAGGG + Intergenic
1080148000 11:29011745-29011767 TAGTAGAAATGTTAGGTCAATGG + Intergenic
1083868963 11:65475263-65475285 TGGTGGAAACACTAGTTCAAAGG + Intergenic
1084723897 11:70927927-70927949 TGGTGTAAATGCCAGGACAAGGG - Intronic
1086105614 11:83143991-83144013 AGGTGGAATTGCTAGTTCAAGGG - Intergenic
1088322085 11:108564638-108564660 ATGTGGAATTGCCAGGCCAAAGG + Intronic
1089057111 11:115594591-115594613 TAGTGGAACTGCTGGATCAATGG + Intergenic
1089451893 11:118604621-118604643 TTGTGGATCTTCTAGGACAAGGG - Intergenic
1090533551 11:127616014-127616036 TTGAGGAAATGCTATGTGAGTGG + Intergenic
1091238018 11:134034479-134034501 TTCTGGACATGCTAGGTGGAGGG - Intergenic
1092465841 12:8730671-8730693 TTGTGGAAAGGGTAGGGCAAGGG + Intronic
1094657948 12:32439098-32439120 TTGGGGAAATGTTTGGTCAAAGG - Intronic
1096356812 12:50948520-50948542 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1096706293 12:53424456-53424478 AGGTGGAAATGCAAGGTGAATGG + Exonic
1096915410 12:55026900-55026922 TTGTGGAGATGCTGTGTAAAGGG + Exonic
1097853243 12:64434878-64434900 TTGTGCATCTGCCAGGTCAAAGG - Exonic
1098507477 12:71270792-71270814 TAATGGGATTGCTAGGTCAATGG - Intronic
1098756895 12:74375272-74375294 TAGTAGACAAGCTAGGTCAATGG + Intergenic
1099897419 12:88666779-88666801 ATGTGGAAATGCGAGGTGACGGG + Intergenic
1100507198 12:95233928-95233950 TGGTAAAATTGCTAGGTCAACGG + Intronic
1102318889 12:111913830-111913852 GAGTGGAAGTGCTAGGTCATAGG - Intergenic
1102780117 12:115557117-115557139 TGGTGCAATTGCTGGGTCAAAGG + Intergenic
1103289666 12:119834726-119834748 AAGTGGAATTACTAGGTCAAAGG - Intronic
1104604053 12:130175046-130175068 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1105014749 12:132779501-132779523 TTGTGGCAAAGCCAGGTCATAGG + Intronic
1106721828 13:32442440-32442462 TTGTGATAATGGTAGCTCAAGGG + Exonic
1106874505 13:34056988-34057010 TTGTGGAAATGCAAGTATAAAGG - Intergenic
1107002934 13:35572091-35572113 GTGTTGAAAAGATAGGTCAAAGG - Intronic
1107370450 13:39740970-39740992 TTCTGGAAATGCTGGGTTTATGG + Intronic
1107671594 13:42751766-42751788 ATGTGTAAATGCTGGGTCAAAGG - Intergenic
1108474768 13:50803128-50803150 AATTGGAATTGCTAGGTCAAAGG + Intronic
1108813581 13:54262664-54262686 TTTTGGAAATGCCAGGTGGAGGG + Intergenic
1109764373 13:66874285-66874307 TTACTGAAAAGCTAGGTCAAAGG + Intronic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110604383 13:77414655-77414677 TTGTGAAACTGCTGGGTCAAAGG - Intergenic
1110711047 13:78651435-78651457 ATATTGAAATGGTAGGTCAAGGG - Intronic
1111885946 13:94020688-94020710 TTGGGGAAATGCAATGTAAAGGG - Intronic
1112513571 13:100032093-100032115 AAGTGGATATGCTAAGTCAAAGG - Intergenic
1113491706 13:110697413-110697435 AAGCGGAATTGCTAGGTCAAAGG - Intronic
1114792749 14:25678288-25678310 TTGAGGAAAAGATATGTCAAAGG + Intergenic
1115341687 14:32299575-32299597 TAGAGGAATTGCTAGGTCAAGGG - Intergenic
1116459486 14:45155925-45155947 TTTTGGAAGGGCTAGGGCAAGGG + Intronic
1116828181 14:49692172-49692194 ATGTGGAATTGCTGGGTCAGAGG - Intergenic
1117342939 14:54807324-54807346 AGGTGAAATTGCTAGGTCAAAGG + Intergenic
1117403363 14:55378279-55378301 ACGTGGAATTGCTTGGTCAAAGG - Intronic
1118089959 14:62463180-62463202 GTGTGGATATGCTAGGCAAAGGG + Intergenic
1118914992 14:70095368-70095390 TTGTGTCAATGCTAGGTCACTGG - Intronic
1120168623 14:81226537-81226559 ATTTGGCATTGCTAGGTCAATGG - Intergenic
1120656365 14:87194853-87194875 AAGTAGAAATGCTTGGTCAAAGG - Intergenic
1121059536 14:90892815-90892837 TTATGAAAATGTTAGTTCAAAGG + Intronic
1122479253 14:102035500-102035522 AAGTGGAACTCCTAGGTCAAAGG - Intronic
1123674693 15:22698714-22698736 GAGTGGAATTGCTGGGTCAAAGG - Intergenic
1123739285 15:23219658-23219680 TGGTGGAGATGATAGGACAAGGG + Intergenic
1124290504 15:28448614-28448636 TGGTGGAGATGATAGGACAAGGG + Intergenic
1124292733 15:28468934-28468956 TGGTGGAGATGATAGGACAAGGG - Intergenic
1126188597 15:45855312-45855334 TTCTGCAAATGCTGGGGCAATGG + Intergenic
1127229999 15:56980636-56980658 TTGAGGAAATGCTAAGTCTAAGG - Intronic
1129004916 15:72364588-72364610 AGGTGGAAATGCTAGGCCACAGG + Intronic
1130038806 15:80386414-80386436 CTATGGAAATGGTAGGTCAGAGG + Intronic
1130142522 15:81240375-81240397 GTGTGGAAATGGTGAGTCAAAGG + Intronic
1130808486 15:87352397-87352419 TTGGGAAAATGCTATATCAAGGG + Intergenic
1131193531 15:90336506-90336528 AAGTGGAAATGCTAGGTCAAAGG + Intergenic
1133006688 16:2885849-2885871 TAGTGGAATTGCTGGGTCATAGG + Intronic
1133122859 16:3621856-3621878 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1133293497 16:4738014-4738036 TCGTGGAAATGCTAGAACAGTGG - Intronic
1133447784 16:5877011-5877033 TTGTGGAAATCCCAGGCCAAGGG + Intergenic
1135128936 16:19835918-19835940 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1135743637 16:24997824-24997846 CTCTGGAAATGCTGGGTGAAGGG + Intronic
1135787485 16:25363296-25363318 TAGTGGCATTGCTGGGTCAAAGG + Intergenic
1137039375 16:35596408-35596430 TTGATGAAATGCTAGGGTAAAGG + Intergenic
1137800916 16:51261327-51261349 GTCTGGAAATGCTGGGTCATGGG + Intergenic
1138092401 16:54186527-54186549 TTTGGCAAATGCTAGTTCAAAGG - Intergenic
1138328811 16:56195791-56195813 TTCTGGAAATGCTAAATAAAAGG - Intronic
1138396248 16:56706980-56707002 TAGTGGAATTGCTGGGTCAATGG + Intronic
1140077333 16:71713444-71713466 AAGTGGAACTGCTGGGTCAAAGG - Intronic
1141244936 16:82297104-82297126 CTGTGGGATTGCTGGGTCAAAGG + Intergenic
1143869383 17:9947237-9947259 TTGTGCAATTGCTGGGTCAAAGG - Intronic
1143976483 17:10834060-10834082 AAGTGGAACTGCTGGGTCAAAGG - Intronic
1144558216 17:16300344-16300366 CTGTGAAAATGCTTGGTAAAAGG - Intronic
1146077077 17:29741318-29741340 TTCTGGGATTGCTAGGACAAAGG - Intronic
1148221115 17:45862879-45862901 TTGTGGAATTCCTGGGTCAAGGG - Intergenic
1149717571 17:58808013-58808035 TAGTAGAACTGCTTGGTCAAAGG - Intronic
1150688422 17:67340686-67340708 TTGGGGAACTGAAAGGTCAAAGG + Exonic
1151408959 17:73908043-73908065 ATGTGGAACTGCTGGATCAAAGG - Intergenic
1151903000 17:77029666-77029688 CTGTGAAATTGCTGGGTCAAAGG - Intergenic
1152026953 17:77816147-77816169 TTGTAAAAGTGCTATGTCAATGG - Intergenic
1152439789 17:80299373-80299395 AAGTGGAACTGCTAGGTCAAAGG + Intronic
1152491991 17:80641335-80641357 TTCTGGAAATTCTAATTCAATGG - Intronic
1155409215 18:25523952-25523974 TTTGGGGAATGCAAGGTCAAGGG - Intergenic
1155813231 18:30266870-30266892 CTGTAGAGATGCAAGGTCAAGGG + Intergenic
1156339010 18:36194561-36194583 AAGTGGAATTGCTAGGTCAAAGG + Intronic
1156842464 18:41625893-41625915 TTCTGAAAATACTATGTCAAGGG - Intergenic
1158169095 18:54576262-54576284 GAGTGGAATTGCTAGGTCATAGG + Intergenic
1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG + Intergenic
1158623699 18:59053684-59053706 AACTGGAATTGCTAGGTCAAAGG + Intergenic
1159089240 18:63828539-63828561 TAGTGGAATTGCTGGGTCATAGG + Intergenic
1160429666 18:78802787-78802809 TAATGGGATTGCTAGGTCAAAGG - Intergenic
1165562554 19:36692727-36692749 TTGTGGAGACGCTAGGTGAAAGG + Intronic
1166827416 19:45617997-45618019 ATGTGGGAATGCTGGGACAAAGG + Intronic
1167644416 19:50697911-50697933 TTCTGGGAAGGCCAGGTCAAAGG - Exonic
925203280 2:1986295-1986317 TGGTGGGAATGCCACGTCAATGG + Intronic
926283387 2:11468238-11468260 TTGGGGAAAAGCCAGGTCACAGG - Intergenic
926327129 2:11795094-11795116 TTATGCAAATGCTTGATCAAGGG - Intronic
926748098 2:16176479-16176501 TGGTGGAACTGCTGGGTCATAGG + Intergenic
927739607 2:25556288-25556310 ATGAGGAACTGTTAGGTCAAAGG + Intronic
928433297 2:31238035-31238057 AAGTGGAATTGCTAGGCCAAAGG + Intronic
929676248 2:43933587-43933609 TAGTGGAATTGATAAGTCAAGGG - Intronic
930185989 2:48412547-48412569 CAGAGGAACTGCTAGGTCAAAGG + Intergenic
931448097 2:62344119-62344141 AAGTGGAATTGCTAGGTCAAAGG + Intergenic
932069538 2:68604936-68604958 ATGTGGGATTGCTAGGTCAAGGG + Intronic
932932110 2:76053544-76053566 GAGTGGAATTGCTAGGTGAAAGG + Intergenic
934046830 2:88179282-88179304 GTGTGGAGAGGCAAGGTCAAGGG + Intronic
935066499 2:99652845-99652867 TTGTGGTAATCCTATGACAATGG - Intronic
936483788 2:112909175-112909197 ATGTGTAAATGCTAGACCAAAGG - Intergenic
939090033 2:137769569-137769591 GTGTCGAAATGCCATGTCAAAGG - Intergenic
939729448 2:145764021-145764043 TCCTGGAAATTCTAGTTCAATGG - Intergenic
940768364 2:157814603-157814625 TAGTAGAATTGCTGGGTCAAAGG - Intronic
941171907 2:162148275-162148297 TTGTAGAAATACTGTGTCAAAGG - Intronic
941652265 2:168104782-168104804 AACTGGAAATGCAAGGTCAAAGG - Intronic
942744785 2:179219482-179219504 TTCTGGAAATGCAAGGCCAAAGG - Intronic
943205126 2:184885312-184885334 TAGTGAAAATGTTGGGTCAAAGG - Intronic
943786863 2:191886884-191886906 TTGTGGCAGTACAAGGTCAATGG + Intergenic
946801440 2:223420446-223420468 AAGTGGAAATGCCAGGTCATAGG + Intergenic
947169659 2:227298572-227298594 TTGTGGCAATGCTAAGTGAAGGG + Intronic
947571326 2:231237487-231237509 AAGTGGAATTGCTAGGGCAAAGG + Intronic
948112460 2:235467514-235467536 TGATGGAAATACTAGGTCAAAGG - Intergenic
948539658 2:238680733-238680755 AAGTGGAATTGCTGGGTCAAGGG + Intergenic
1169921400 20:10737832-10737854 TAGTGGAATTGCTGGGTCAGAGG + Intergenic
1171362637 20:24599455-24599477 TAGTGGGATTGCTGGGTCAAAGG - Intronic
1171724100 20:28599657-28599679 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1171753956 20:29083376-29083398 ATGTGGAATTGCTGTGTCAAAGG + Intergenic
1171788287 20:29494152-29494174 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1171859265 20:30380368-30380390 ATGTGGAATTGCTGTGTCAAAGG + Intronic
1172360646 20:34310539-34310561 AAGTGGAACTGCTTGGTCAAAGG - Intronic
1172529769 20:35621911-35621933 AAGTGGAAGTGCTAGATCAAAGG - Intergenic
1172529985 20:35624004-35624026 AAGTGGAAATGCTATATCAAAGG - Intergenic
1172613880 20:36271000-36271022 TAGTAGAATTGCTGGGTCAAGGG + Intergenic
1175292558 20:57886592-57886614 TAGTGGGATTGCTAGATCAAAGG + Intergenic
1177773361 21:25541702-25541724 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1178951329 21:36988574-36988596 CTGTAGAATTGCTGGGTCAAGGG + Intronic
1179466735 21:41580910-41580932 TTGTGGAAATGCAGGGTCTGAGG + Intergenic
1180297652 22:10958333-10958355 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1180410772 22:12605453-12605475 ATGTGGAATTGCTGTGTCAAAGG + Intergenic
1183189004 22:36309510-36309532 GGGTGGAAATGCTGGATCAAAGG - Intronic
1183432929 22:37776405-37776427 GAGTGGAAATGCTAGGCCATAGG - Exonic
1184456506 22:44613582-44613604 GAGTGGAATTGCTGGGTCAAAGG - Intergenic
949803178 3:7925655-7925677 TTATGAAATTGGTAGGTCAAAGG + Intergenic
951321995 3:21255868-21255890 AAGTGGAATTGCTATGTCAAAGG + Intergenic
951820492 3:26804872-26804894 TTTTGGAATTGCTAAGTCACAGG - Intergenic
951935701 3:28020568-28020590 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
952080365 3:29751023-29751045 TTGTGAAAATGATAATTCAAAGG + Intronic
952420102 3:33122773-33122795 TGGTGAAAATTCTAGGTCTAAGG + Intronic
952877577 3:37959738-37959760 TTGTGGAAATGCTAGGTCAAAGG + Intronic
953795647 3:45983954-45983976 CTGTGGCCATGCTAGGCCAATGG + Intronic
954268414 3:49488391-49488413 ATGTGGAATTGCTGGGTCAAAGG - Intronic
956144962 3:66183099-66183121 CTGGGGAAATGCAAGGCCAAGGG - Intronic
956424839 3:69123333-69123355 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
956920637 3:73925160-73925182 TTCTAGAAATGCTAGGTAAAGGG + Intergenic
957335461 3:78822147-78822169 TTCTGGAAATGCTAATTCACAGG + Intronic
957847850 3:85762020-85762042 TTGTGGAAATACTAAATGAAAGG + Intronic
958716350 3:97787028-97787050 ATGTGGAATTGTTGGGTCAAAGG - Intronic
959283224 3:104374160-104374182 TAGTGGGATTGCTGGGTCAAAGG - Intergenic
960064663 3:113357814-113357836 TTGTGGAACTGCTGGGCCATAGG - Intronic
962387602 3:134944788-134944810 AAGTGGAATTGCTGGGTCAAAGG + Intronic
963039805 3:141060641-141060663 AAGTAGAATTGCTAGGTCAAAGG + Intronic
963418602 3:145030114-145030136 TTTTTGAAATGTTAGGTAAATGG - Intergenic
966895002 3:184437928-184437950 TTGGGGAAGTCCAAGGTCAAGGG - Intronic
968083306 3:195862287-195862309 CAGTGGGACTGCTAGGTCAAAGG - Intergenic
970737015 4:19183279-19183301 TTGTGGAAAAGCATGGTAAATGG + Intergenic
971301787 4:25448051-25448073 GAGTGGAATTCCTAGGTCAAGGG + Intergenic
972273186 4:37532006-37532028 TTGTGGAAATACTATGTAATGGG + Intronic
972931284 4:44073785-44073807 ATTTGGAAATGCAAAGTCAAGGG - Intergenic
973140361 4:46760180-46760202 TAATGGAATTGCTGGGTCAAAGG - Intronic
973974335 4:56247066-56247088 TTGTGGTATTACTAGGACAAGGG + Intronic
974064289 4:57063298-57063320 TTGTGAAAATGCTATGATAAGGG - Intronic
976307697 4:83577664-83577686 AAGTGGAATTGCTAGGTCATAGG + Intronic
979473741 4:121130459-121130481 TTGTGGAAATGCTAATGTAATGG - Intergenic
979944333 4:126808004-126808026 TTGTAGAAATGTTATGTCTAAGG - Intergenic
981509082 4:145535308-145535330 ATGTGGAAATGCTGGGTGAATGG - Intronic
983257261 4:165413848-165413870 TTCTGGAAATGTTTAGTCAAAGG + Intronic
984731485 4:183072262-183072284 TTGTGGAATTGCTAAATCAAAGG - Intergenic
984733225 4:183087756-183087778 TTCTGGAATTACTGGGTCAAAGG - Intergenic
985437406 4:189943972-189943994 ATGTGGAATTGCTGTGTCAAAGG + Intronic
986868715 5:12020853-12020875 TTGTGGAATTGCAAGGCCAAAGG - Intergenic
988705224 5:33719456-33719478 AAATGGAATTGCTAGGTCAAAGG - Intronic
990058929 5:51622297-51622319 GTGTGGAAAAGCTAGATAAAGGG - Intergenic
990858080 5:60293955-60293977 GAGTGGAATTGCTAGGTCAAAGG + Intronic
991950313 5:71940867-71940889 TTGTGGATATGCTGTGTTAACGG - Intergenic
995446564 5:112251255-112251277 TAGTGGGATTGCTAGGTCATAGG - Intronic
995935506 5:117506560-117506582 TTGAGGAATTTCTATGTCAAGGG - Intergenic
996402643 5:123079746-123079768 TAGTAGAATTGCTGGGTCAAAGG - Intergenic
998241392 5:140448400-140448422 AAGTGGAATTGCTGGGTCAAAGG + Intronic
999851360 5:155542975-155542997 GAGTGGAATTGCTAGGTCACAGG + Intergenic
1002858485 6:1058734-1058756 AAGTGGAAATGCTGGGTCATAGG - Intergenic
1002914295 6:1516666-1516688 TTGGGGAAATGCCAGGTCAATGG - Intergenic
1002916374 6:1531191-1531213 AAGTGGGATTGCTAGGTCAAAGG + Intergenic
1003762327 6:9193889-9193911 GAGTGGAACTGCTGGGTCAAAGG - Intergenic
1003976437 6:11349392-11349414 TAATGGAATTGCTGGGTCAAAGG - Intronic
1004465984 6:15885275-15885297 TAGTGGAACTGTTAGATCAAAGG + Intergenic
1004597207 6:17111342-17111364 ATGTGGATATGCTGGGTCTAAGG - Intronic
1005937124 6:30531844-30531866 AAGTGGAAATGCTAAATCAAAGG - Intergenic
1006731297 6:36238286-36238308 GAGTGGAATTGCTAGGTCACGGG + Intergenic
1006968550 6:38015457-38015479 TTCTGGAAATGCTTGTTCAAAGG + Intronic
1008091649 6:47299940-47299962 AAGTGGAATTGCTGGGTCAAAGG - Intronic
1008157276 6:48031695-48031717 TTGGGGAAATGCTTCATCAATGG - Intronic
1008563265 6:52742916-52742938 TTGAGGAATTGCTTGGTCATTGG + Intergenic
1008566903 6:52777559-52777581 TAGTGGAATTGCTAGGTCATTGG + Intergenic
1008570446 6:52811623-52811645 TAGTGGAATTGCTAGGTCATTGG + Intergenic
1008577800 6:52878102-52878124 TAGTGGAATTGTTAGGTCATTGG + Intronic
1009958506 6:70488053-70488075 AAGTGGGGATGCTAGGTCAAAGG - Intronic
1010000455 6:70943814-70943836 TTGGGGAAATGTTTGGTCAAAGG + Intronic
1012409874 6:98945135-98945157 ATATGGAATTGCTAGGTCAGAGG - Intronic
1015785477 6:136918556-136918578 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1016620173 6:146099888-146099910 CAGTGGAATTGCTGGGTCAAAGG + Intronic
1016964014 6:149701408-149701430 TTGGGGAAATGATAGTTCCAAGG - Intronic
1018187877 6:161283403-161283425 ATGTGGAAGTGCCAGGTCACAGG - Intergenic
1018709163 6:166485576-166485598 TTGTCCAAATGCTATGTCAAAGG - Intronic
1019393776 7:805464-805486 AAGTGGAACTGCTGGGTCAAGGG - Intergenic
1021138721 7:16996696-16996718 TAATGGGAATGCTAGGTCAATGG + Intergenic
1022903005 7:34828745-34828767 TTGTGGAATTACTAGATCAAAGG + Intronic
1023602825 7:41897197-41897219 TTTTGAAACTGCTGGGTCAAAGG - Intergenic
1024026761 7:45416200-45416222 TTGGGGAGATGTTAGTTCAAGGG - Intergenic
1024586175 7:50843986-50844008 TTGTTGAAATTCAAGGTCATTGG - Intergenic
1025119744 7:56291193-56291215 TTGTGCATCTGCCAGGTCAAAGG - Intergenic
1025233378 7:57217788-57217810 TTGTTGAAATCCGAGGTCATGGG + Intergenic
1025614687 7:63107477-63107499 AGGTGGAATTGCTAGGTCAAAGG - Intergenic
1030537546 7:110788126-110788148 TAGAGGAGATGTTAGGTCAAAGG - Intronic
1031067770 7:117124798-117124820 ATGTGGAAATGTCAGGTCAGAGG + Intronic
1031257487 7:119473058-119473080 CTGAGGAAAAGCTAGGTGAAGGG - Intergenic
1031381886 7:121096540-121096562 ATGTGTAATTGCCAGGTCAATGG - Intronic
1032265994 7:130370400-130370422 TAGTGGAAATTCGAGGTCATGGG + Intergenic
1033630702 7:143154668-143154690 TTGTGGAGGTGCTGGGTCAAAGG - Intergenic
1034471996 7:151259964-151259986 GTGTGGAAGTGCTTGGTCAATGG - Intronic
1035210680 7:157325838-157325860 GTGTGGCAATGGTGGGTCAATGG + Intergenic
1036222372 8:6931463-6931485 TTTAGGAAATGCTTGGTCCAAGG - Intergenic
1038911111 8:31965573-31965595 TAGTGGTATTGCTAGGTCAATGG + Intronic
1040656646 8:49518338-49518360 TGGTGGGATTGCTGGGTCAAAGG - Intergenic
1041370562 8:57155437-57155459 TAGTGGAATTGCTGGGTCATAGG + Intergenic
1043490947 8:80748602-80748624 TAGTGGAAATGGTAGGGGAATGG + Intronic
1043702553 8:83308774-83308796 AAATGGCAATGCTAGGTCAATGG + Intergenic
1044830952 8:96248196-96248218 AAGTGGAAATGCTAGGTCAAAGG - Intronic
1045632715 8:104145220-104145242 AAGTTGAAATGCTAGGTTAAAGG + Intronic
1045981974 8:108200359-108200381 TTGTGAAAATGCCAGGTATAGGG - Intergenic
1046315276 8:112492867-112492889 TGATGTAAATGCTAGGTAAACGG - Intronic
1046513877 8:115233429-115233451 TAGTGGAACTTCTGGGTCAAAGG - Intergenic
1046664330 8:116982767-116982789 TAGTGGAACTCCTAGGTAAAGGG + Intronic
1046681340 8:117173680-117173702 TTCTGGAAATCCTATGTCAATGG + Exonic
1046717144 8:117580249-117580271 ATGTGGAATTACTAGGTAAATGG - Intergenic
1046966293 8:120169234-120169256 CTGTGGAACTGCAAGGTTAAAGG + Intronic
1047435994 8:124835805-124835827 TTATGGAAAGGATGGGTCAAGGG + Intergenic
1047987349 8:130248633-130248655 TGGTGGAAATGGAAGGTAAAGGG + Intronic
1049460005 8:142722346-142722368 TTGTGGGAGTCCTAGGTCAGGGG - Intergenic
1051325535 9:15963459-15963481 CAGTGGAATTGCTAGGTCAAAGG + Intronic
1053037864 9:34840906-34840928 TAGTGAAATTGCTGGGTCAAAGG + Intergenic
1053559050 9:39170623-39170645 TTGGGCAAATGCTAGGTTAGGGG - Intronic
1053725504 9:40995411-40995433 ATGTGGAATTGCTGTGTCAAAGG + Intergenic
1053823170 9:41990864-41990886 TTGGGCAAATGCTAGGTTAGGGG - Intronic
1054138061 9:61448323-61448345 TTGGGCAAATGCTAGGTTAGGGG + Intergenic
1054340439 9:63856467-63856489 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1054607403 9:67196501-67196523 TTGGGCAAATGCTAGGTTAGGGG + Intergenic
1055108325 9:72535781-72535803 GTGTGGAAATCATAGGGCAAGGG + Intronic
1055695661 9:78881512-78881534 GAGTGGAATTGCTGGGTCAAAGG + Intergenic
1055874603 9:80926964-80926986 TTCTGGAAATGCTCACTCAAAGG + Intergenic
1057099334 9:92342856-92342878 TAGTAGAATTGCTGGGTCAAAGG + Intronic
1057754704 9:97822949-97822971 AAGTGGAATTGCTAGGTCATAGG - Intergenic
1060486105 9:124047335-124047357 AAGTGGAAATGCTGGGTTAAAGG + Intergenic
1060800699 9:126543806-126543828 AGGTGGAAATGCTGGGTCAGAGG - Intergenic
1060870158 9:127033494-127033516 TTATGAAAACTCTAGGTCAATGG + Intronic
1061266770 9:129510536-129510558 GAGTGGAAATGCTTGGTCAGAGG - Intergenic
1203449309 Un_GL000219v1:96561-96583 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1185895572 X:3855494-3855516 TAGTGGAGTTGCTGGGTCAAAGG + Intergenic
1185900691 X:3893918-3893940 TAGTGGAGTTGCTGGGTCAAAGG + Intergenic
1185905807 X:3932357-3932379 TAGTGGAGTTGCTGGGTCAAAGG + Intergenic
1186173678 X:6903412-6903434 TAGTGGGATTGCTGGGTCAAAGG - Intergenic
1186754487 X:12656318-12656340 GAGTGGAATTGGTAGGTCAAAGG - Intronic
1187010344 X:15271986-15272008 GAGTGGAAATGCTAAGTCAAAGG + Intergenic
1187441563 X:19325472-19325494 AAGTGGAATTGCTAGGTCAATGG - Intergenic
1188357457 X:29209760-29209782 TTGTAGAATTGCTATGTCAAAGG + Intronic
1188454723 X:30350869-30350891 TTGTGGCAATGCCATGTAAATGG - Intergenic
1189963038 X:46343206-46343228 ATGTGGGATTGCTAGGTCAAGGG + Intergenic
1190127014 X:47715068-47715090 TAATGGGATTGCTAGGTCAAGGG - Intergenic
1190405426 X:50081951-50081973 AAGTGGAATTGCTGGGTCAAAGG - Intronic
1191693076 X:63960711-63960733 TGTTGGAAATGCTAGCTCTAGGG + Intergenic
1191754365 X:64578191-64578213 AAGTGGAATTGCTGGGTCAAGGG + Intergenic
1192491837 X:71582590-71582612 TAGTGGAACTGCTACTTCAAAGG - Intronic
1192944629 X:75951941-75951963 TAGTGGAATTGCTAGATCAAAGG + Intergenic
1193669137 X:84362351-84362373 ATCAGGAAAAGCTAGGTCAAAGG + Intronic
1193682024 X:84533369-84533391 AGGTGGAAATGAAAGGTCAAGGG - Intergenic
1193824051 X:86200908-86200930 TAATGGAATTGCTGGGTCAAAGG - Intronic
1195885375 X:109632002-109632024 GTGTGGAAATGCTGGGTCATGGG + Intronic
1195912947 X:109906965-109906987 TAGTGGAATTGCTGGATCAAAGG + Intergenic
1197686953 X:129450521-129450543 AAATGGAATTGCTAGGTCAAAGG - Intronic
1198142019 X:133813854-133813876 TGGTGGAAATGGTGGGTGAATGG + Intronic
1198372839 X:136007903-136007925 GAGTAGAATTGCTAGGTCAATGG + Intronic
1199049997 X:143226749-143226771 TTGTGGAATTTGTGGGTCAAAGG - Intergenic
1199846713 X:151696909-151696931 TTGTGGAAACGCCACATCAAGGG - Intronic
1199898889 X:152153545-152153567 TTGTGGAAATGCAATGTCTCTGG + Intergenic
1200989047 Y:9333183-9333205 TTGTGGAAATGGTAGGTCTGGGG - Intergenic