ID: 952879309

View in Genome Browser
Species Human (GRCh38)
Location 3:37973427-37973449
Sequence GGGGCAGGTGGGAGCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 512}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952879309 Original CRISPR GGGGCAGGTGGGAGCCATCC AGG (reversed) Intronic
900178156 1:1299715-1299737 AGGGCAGGTGGGAGACAGGCAGG + Intronic
900186180 1:1334320-1334342 TGGGCAGGTGGAAGGCAGCCAGG - Exonic
900231828 1:1562949-1562971 GGTGGTGCTGGGAGCCATCCTGG - Intronic
900874962 1:5335612-5335634 GGCAAAGGTGTGAGCCATCCAGG - Intergenic
900887127 1:5423082-5423104 GTGGCAGGTGGGAGACAGCCTGG - Intergenic
901302980 1:8212976-8212998 GGGGCCTGTGGAAGCCATGCTGG + Intergenic
901641038 1:10693210-10693232 GAGGCAGGTGGGAGACAGTCCGG + Intronic
902635339 1:17731412-17731434 GGGGCAGGGGGGAGTGTTCCTGG + Intergenic
902769296 1:18636499-18636521 GGGGCAGCTGGGAGCCGCTCAGG + Intronic
902857946 1:19222717-19222739 GGGGCAGCTGGGGGCGGTCCAGG + Exonic
903447157 1:23429831-23429853 GGGGCATGTGGGGGCCAGCAAGG + Exonic
903467069 1:23559132-23559154 TGGGAAGGTGGGGGCCATCAGGG + Exonic
903690867 1:25172586-25172608 GGGGCAGGAGGGAGCCTTCTGGG + Intergenic
903969003 1:27107032-27107054 GGAGCAGGCAGGAGCCAACCAGG + Intronic
904004541 1:27356915-27356937 GGGGCCGGTGGGGGCCAGGCGGG - Intronic
904007573 1:27371659-27371681 GGGGGAGGTGGAAGACATCAGGG - Intronic
904009321 1:27380913-27380935 GGCACAGCTGGGAGCCACCCAGG - Intronic
904266808 1:29323009-29323031 GGGGTGGGTGGGAGTGATCCAGG + Intronic
904485698 1:30823446-30823468 GGGGCAGTTTGCAGCCACCCAGG - Intergenic
904788205 1:32998347-32998369 AGGGCAGGTGGGAGGCAGCAGGG - Intergenic
904891692 1:33784218-33784240 GGGGCAGTGGGGAGCCATGGAGG + Intronic
904913317 1:33951554-33951576 GGGGTAGGTGGGAGAAAGCCAGG - Intronic
905308488 1:37034407-37034429 GGGGCAGGTGGGAGCCCGCGCGG - Intergenic
905370193 1:37478975-37478997 GGGGCAGCTGGGGGCCATGGAGG - Intronic
905422740 1:37859585-37859607 GGGGAAGGTGGGGGCAATCATGG - Exonic
906606322 1:47174862-47174884 CAGGCAGATGGGAGCCATCTGGG + Intergenic
907039884 1:51249468-51249490 GGGGCAGGAGGGAGCCTTTTGGG - Intronic
907179043 1:52553504-52553526 AGGGGAGGAGGGAGCCACCCGGG + Intergenic
907285527 1:53377098-53377120 GGGGCGAGAGGGAGCAATCCAGG + Intergenic
907909762 1:58815535-58815557 GGAGCAGGTGGAAGAAATCCAGG + Intergenic
907992221 1:59594146-59594168 GGTGCAGGTGGAAGAAATCCAGG - Intronic
908177136 1:61566711-61566733 GGGGCAGGTGGGAGGTATTTGGG - Intergenic
911520937 1:98929738-98929760 GGGTCAGGGGGGAGTCATACTGG - Intronic
912500878 1:110121225-110121247 GGGGTAGGTAGGAGCCATTCGGG - Intergenic
913174001 1:116257257-116257279 GGGGCAGGTGCCAGCCAGCTGGG - Intergenic
913531942 1:119739771-119739793 GGGGCAGGGGGCAGCCAGCCAGG + Intronic
913709984 1:121473145-121473167 GTGGCAGGTAGGAGCCCTCATGG - Intergenic
914376397 1:147077344-147077366 GGGGCAGGTGGGAGGCGCGCGGG - Intergenic
914934977 1:151970787-151970809 GGGGCAGGTGGGGGGCATTGGGG + Intergenic
915127992 1:153679126-153679148 GGCGCAGGCGGGAGCCAGCGGGG - Exonic
918039109 1:180901430-180901452 GGGGAAGGAGGGAACCATCCAGG + Intergenic
922192622 1:223332838-223332860 GGGGAGGGTGGGGACCATCCTGG + Intronic
922566658 1:226605721-226605743 GGGGCAGGGTGGAGGCGTCCAGG - Exonic
922891170 1:229062805-229062827 GGTGCAGATGTGAGCCACCCAGG + Intergenic
1062824124 10:556220-556242 GGGGTGGGTGGGTGCCGTCCTGG - Intronic
1062824152 10:556292-556314 GGGGTGGGTGGGTGCCGTCCTGG - Intronic
1062824168 10:556331-556353 GGGGTGGGTGGGTGCCGTCCTGG - Intronic
1063185449 10:3646437-3646459 GGGGCAGGTGGGAAGGTTCCAGG + Intergenic
1063294214 10:4786520-4786542 AAGGCAGGTGGGAGGCATCACGG + Intergenic
1065198925 10:23295264-23295286 AGAGCAGGTGGGAGCCACACCGG - Intronic
1065975313 10:30836485-30836507 GGGGCAAAGGGGAGCCACCCAGG + Intronic
1066047057 10:31603513-31603535 CTGGCAGGTGGGAGCCTCCCTGG + Intergenic
1066180524 10:32957743-32957765 AGCGCAGGTGGGAGCCAGCGAGG - Exonic
1067448824 10:46368933-46368955 GGGGCTGGGCGGAGCCACCCTGG - Intergenic
1067476932 10:46573557-46573579 GGGGCAGGAGTGAGCCATGGAGG + Intergenic
1067555597 10:47267720-47267742 GGGGCAGGAGGGAGGCAGCAAGG - Intergenic
1067588548 10:47491832-47491854 GGGGCTGGGCGGAGCCACCCTGG + Intergenic
1067617806 10:47768224-47768246 GGGGCAGGAGTGAGCCATGGAGG - Intergenic
1067635674 10:47999923-47999945 GGGGCTGGGCGGAGCCACCCTGG + Intergenic
1067830447 10:49608811-49608833 GGCAGAGCTGGGAGCCATCCTGG + Intergenic
1067877846 10:50020471-50020493 GGGGCTGGGTGGAGCCACCCCGG - Intergenic
1068635639 10:59345112-59345134 GGTGCAGGTGGCTGCCATACAGG - Intronic
1069504947 10:68989252-68989274 GGCGCAGGTGAGAGCGAGCCCGG + Exonic
1069729095 10:70599692-70599714 CGGGCATGTGGGACCCATCCAGG - Intronic
1069903870 10:71720904-71720926 GGGGCAGGCAGTAGGCATCCAGG + Intronic
1070132232 10:73663930-73663952 GGGGCTGGGCGGAGCCACCCTGG + Intergenic
1070644326 10:78190998-78191020 GGTGCTGGTGGAGGCCATCCAGG + Intergenic
1071609450 10:87020145-87020167 GGGGCTGGGCGGAGCCACCCTGG - Intergenic
1072462290 10:95630772-95630794 GGGGTAAGTGTGAGCCACCCTGG - Intronic
1072709657 10:97707703-97707725 CAGCCCGGTGGGAGCCATCCTGG + Intergenic
1073320526 10:102613592-102613614 GTGGCAGGCAGGAGCCACCCAGG - Intronic
1074466126 10:113682465-113682487 AGGGTAGGTGGGAGCGATGCAGG - Intronic
1074693945 10:116030777-116030799 GGGGCAGTTGGCAGGGATCCAGG + Intergenic
1074711196 10:116178982-116179004 GGAGCAGATGGGATCCAACCAGG - Intronic
1075200380 10:120397886-120397908 AGGGCATGAGGGAGCCATCTGGG + Intergenic
1075787055 10:125057081-125057103 GGGGCAGGAGGGAGACAGCAAGG + Intronic
1076360064 10:129881779-129881801 GGGGCAGCTGGGTGCCACTCCGG + Intronic
1076369336 10:129941568-129941590 GGGTCAGGGGGGAGCCCTCCAGG + Intronic
1076530648 10:131142206-131142228 GGGGCAGGTGGGATCCAGGTGGG + Intronic
1076678010 10:132158055-132158077 GGGGCGGTGGGCAGCCATCCTGG - Intronic
1076947960 10:133664872-133664894 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076948950 10:133668182-133668204 GGGGCAGATGCAAGGCATCCCGG + Intronic
1076949934 10:133671481-133671503 GGGGCAGATGCAAGGCATCCCGG + Exonic
1076950918 10:133674780-133674802 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076951908 10:133678090-133678112 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076952897 10:133681400-133681422 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076953881 10:133684699-133684721 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076954865 10:133741051-133741073 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076955854 10:133744361-133744383 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076956844 10:133747671-133747693 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076957831 10:133750980-133751002 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076958816 10:133754279-133754301 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076959805 10:133757589-133757611 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1076960789 10:133760888-133760910 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1077012240 11:384526-384548 GGGCCGGGTGGGGGCCTTCCTGG - Intergenic
1077222649 11:1424405-1424427 AGGGCAGGTGGGGGCCACCCCGG - Intronic
1077226825 11:1442232-1442254 GGGGCAGGAAGGAGCCTGCCAGG + Intronic
1077307206 11:1873765-1873787 GGGGCAGGAAGTAGCCATCAGGG + Intronic
1077373585 11:2195006-2195028 GTGGCAGGTGGCAGGCATGCTGG + Intergenic
1077555822 11:3225561-3225583 GGGGCAGGTGGGAGCCTGGACGG + Intergenic
1077867327 11:6234192-6234214 GGCGCAGGTGGGAGCCTGCGGGG - Intronic
1078366674 11:10712334-10712356 GGGTCAGGTGGGATGGATCCTGG - Intergenic
1078714364 11:13825887-13825909 AGGGCAGGATGGAGCCATGCAGG + Intergenic
1078902792 11:15656877-15656899 GGGGCAGATGGGAACACTCCTGG + Intergenic
1079130480 11:17744327-17744349 AGGGCACGTGTGAGCAATCCTGG + Intronic
1079321601 11:19456095-19456117 GGAGCTGGTGGGAGCAATCCAGG - Intronic
1080847128 11:36036273-36036295 GGGTGGGGTGGCAGCCATCCTGG + Intronic
1081805779 11:45889776-45889798 GGGGCAGATGGCAACCATCCAGG - Intronic
1083195852 11:61086674-61086696 GGGGCAGTGGGGAGCCTCCCAGG + Intergenic
1083610430 11:64001681-64001703 GGAGCAGGTGGAAGGGATCCAGG - Intronic
1083615211 11:64022743-64022765 GTGGAAGGTGGGAGACTTCCTGG + Intronic
1083996859 11:66277137-66277159 GGGGAATGTGGGTTCCATCCAGG + Exonic
1084033132 11:66492656-66492678 GGGTGAAGTGGGAGCCCTCCTGG + Intronic
1084170117 11:67396942-67396964 GGGGCCTGAGGGAGGCATCCCGG - Intronic
1084313778 11:68331973-68331995 AGGGCAGGTGGGGGCCAAGCTGG + Intronic
1084435710 11:69138124-69138146 GGGGCATGAGGGAGCCAGCAGGG + Intergenic
1084973286 11:72782721-72782743 GGGGCAGGGGGGAGCCTCCCTGG - Intronic
1085272835 11:75280484-75280506 GGGGCAGGCATGAGACATCCGGG + Intronic
1085458035 11:76676491-76676513 GGGGCAGGTGGAAGCCCTCAAGG + Intergenic
1087065480 11:94024034-94024056 GGAGCAGGAAGGAGCCATCGTGG + Intronic
1088833375 11:113557024-113557046 CTGGCAGATGGGAGGCATCCTGG + Intergenic
1089155967 11:116402888-116402910 GTGGCAGGAGGGAGCTATGCAGG - Intergenic
1089779425 11:120862645-120862667 TGGGCAGAAGGGAGCCATTCTGG - Intronic
1089789831 11:120934604-120934626 AGGGCAGGCGGGAGCCAGCCTGG - Intronic
1090382152 11:126335053-126335075 GGGGATGGTGGCTGCCATCCTGG - Intronic
1091074919 11:132606539-132606561 GGGGGTGGTGGCAGCCCTCCTGG - Intronic
1091338904 11:134795224-134795246 GGGGCAGATGGCAGACAACCAGG - Intergenic
1092278673 12:7082203-7082225 GGGGCAGGGAGGAGCCAACATGG + Intronic
1092291184 12:7160267-7160289 GAGGCAGGTGGGAGGCAGGCGGG - Intergenic
1093654214 12:21676365-21676387 AGGTCAGGTGGTAGCCATCAAGG - Intronic
1095825998 12:46531059-46531081 GGGCAAGGTGGGGGCCTTCCTGG - Intergenic
1095942386 12:47735576-47735598 GGGGCAGCTGGGAGACCACCGGG + Intronic
1096080361 12:48828603-48828625 GTGGCAGATGGGAGCCAACCTGG + Exonic
1096238184 12:49943734-49943756 GAGGCAGCTGGGAGCCATTGTGG - Intergenic
1096405522 12:51341289-51341311 GCCCCAGGAGGGAGCCATCCTGG - Exonic
1099626051 12:85075600-85075622 GGGGTAGGGGGGATCCATCAGGG - Intronic
1100266228 12:92978877-92978899 GGGGCAGGGTGGTGGCATCCAGG - Intergenic
1101187303 12:102292516-102292538 GGGCCACCTGGGAGCCACCCAGG - Intergenic
1101442731 12:104715687-104715709 GGTGCATGTGGGGGCCCTCCTGG - Intronic
1102463921 12:113117027-113117049 GGGCCAGGCTGGAGCCATGCCGG - Intronic
1102595613 12:113990624-113990646 GGGTCAGGGGGGAGCCAGCTGGG - Intergenic
1103747466 12:123135197-123135219 GGTGAAGGTGGGATCCTTCCCGG + Intronic
1103959386 12:124599199-124599221 GGGGCAGGAGGGAGCCTCCTGGG - Intergenic
1104016726 12:124966723-124966745 GGGGCTGGTAGCTGCCATCCTGG + Intronic
1104680550 12:130748262-130748284 AGGGCTGGTGCGAGCCAGCCTGG - Intergenic
1104988696 12:132612061-132612083 GGGGAAGGTGCTAGCCACCCTGG - Intergenic
1107711615 13:43156140-43156162 GTGACTGGTGTGAGCCATCCAGG - Intergenic
1107742319 13:43464431-43464453 GGGGAAGGAGGGAGGCAGCCTGG + Intronic
1107884693 13:44865721-44865743 GGGGCAGGTGAGAGGCAACCTGG - Intergenic
1112567493 13:100563868-100563890 GGAGGAGGTGGGTGCCTTCCAGG + Intronic
1114538627 14:23438639-23438661 AGGGCAGAGGGGAGCCACCCAGG + Intergenic
1114718134 14:24850294-24850316 GGGGCAAGTGAGGGCCAGCCTGG + Intronic
1118156619 14:63248846-63248868 GGAGCTGCTGGGAGCCATCTGGG - Intronic
1118471910 14:66082185-66082207 GGGTCAGCTGTGAGCCCTCCAGG + Intergenic
1118883184 14:69845826-69845848 GTGGCAGGTGGAAGCCAGTCAGG + Intergenic
1119069959 14:71572515-71572537 GGGAGACGTGGGATCCATCCAGG + Intronic
1119380848 14:74227341-74227363 GGGGCATCTGGGAGTCATCGAGG + Intergenic
1119443924 14:74648077-74648099 AGGGCAGGTGGCAACCAGCCTGG + Intergenic
1120402247 14:84046823-84046845 AGGGCAGTGGGGACCCATCCTGG + Intergenic
1121831067 14:97053065-97053087 GAGGCAGGTGACAGTCATCCCGG + Intergenic
1121950524 14:98167390-98167412 GAGGCAGGTGGGAGCCTCCATGG - Intergenic
1121955573 14:98209910-98209932 GGGGCAGGTGGCTGCCATCTTGG + Intergenic
1122300543 14:100728670-100728692 GGGGCAGGTGGGACCACTGCAGG + Intronic
1122393519 14:101407029-101407051 GGCACAGGTGGCAGCCACCCAGG - Intergenic
1122652417 14:103232769-103232791 GGGGCAGATGGGGACCATCCCGG + Intergenic
1122925022 14:104895490-104895512 GGGTCAGGTGGGAGCCACCAGGG - Exonic
1123040473 14:105488258-105488280 GAGGTAGGTGGGACCCACCCTGG + Exonic
1202848596 14_GL000225v1_random:1623-1645 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1202853768 14_GL000225v1_random:37391-37413 GGGGCAGATGAAAGGCATCCCGG + Intergenic
1202857280 14_GL000225v1_random:59122-59144 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1202860548 14_GL000225v1_random:79007-79029 GGGGCAGATGCAAGGCATCCCGG - Intergenic
1202864146 14_GL000225v1_random:104523-104545 GGGGCAGATGCTAGGCATCCCGG - Intergenic
1202868105 14_GL000225v1_random:136021-136043 GGGGCAGATGCAAGGCATCCCGG - Intergenic
1202922099 14_KI270723v1_random:35699-35721 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1123438496 15:20272940-20272962 CGGCCAGGTGAGACCCATCCTGG + Intergenic
1124114383 15:26827635-26827657 GGGGCAGGAGGGAGCTACCTGGG - Intronic
1124476312 15:30037997-30038019 GGGGTCGCTGGGAGCCATGCTGG + Intergenic
1128254103 15:66184643-66184665 GGAGTAGGTGGGAGGCACCCAGG - Intronic
1128873289 15:71180792-71180814 GGGGCATGAGGGAACCTTCCAGG + Intronic
1128982044 15:72195432-72195454 GGGGCGGGGTGGAGCCACCCAGG + Intronic
1129232824 15:74206193-74206215 GGGGCAGGTGGGAGGCAATGGGG - Intronic
1129296409 15:74602599-74602621 GGAGCCTGTGGGAGCCATGCAGG + Intronic
1129409280 15:75339926-75339948 TGGGCAGGTGGGAGGCAGTCAGG - Intronic
1130008773 15:80130052-80130074 GGGGTAGTTGGGAGCCATTGAGG + Intronic
1130610897 15:85360123-85360145 GGGGCAGATGGGAGCCAGAAAGG + Intergenic
1130679535 15:85984374-85984396 GGAGCAGACAGGAGCCATCCAGG - Intergenic
1131403346 15:92144042-92144064 GGGACAGGTCGGCGCCTTCCGGG + Intronic
1132533579 16:466341-466363 TGGGCAGGAGGGAGCCACCTGGG + Intronic
1132588869 16:717770-717792 GAGGCAAGTGGGAGCCAGCCAGG - Exonic
1132664141 16:1073973-1073995 GAGGCAGGTGTGGGCCAGCCTGG - Intergenic
1132882346 16:2168004-2168026 GGGGGAGGTGGGGCCCATGCTGG - Intronic
1132898876 16:2242775-2242797 GGGGCAGGAAGGAGCCTCCCTGG + Intronic
1133221907 16:4322536-4322558 TGGGGAGGTGGGAGCCCTGCGGG - Intronic
1135039524 16:19107330-19107352 CGGGCTGGTGTGAGCGATCCCGG + Intergenic
1135338981 16:21630305-21630327 GGTGCAGGCGGGAGCCAGCGTGG - Intronic
1135758656 16:25118683-25118705 GGGGCAGGAGTGAGCCCTCTGGG + Intronic
1136030037 16:27496020-27496042 GGGCCAGGTGGGAGGCGTCTGGG + Intronic
1136169772 16:28482041-28482063 GGGGAAGCTGGGAGCCAAGCTGG + Intronic
1136533120 16:30883077-30883099 AGGGCAGGTGGGACCCAGCAGGG + Intronic
1138389926 16:56662884-56662906 GGGGCAGGTGGGAGGCATGGTGG + Intronic
1138391873 16:56676117-56676139 GGGGCAGGTGGGAGGCGTGGTGG - Exonic
1138521963 16:57576128-57576150 GGGGCGGGTGGGACCTACCCAGG + Exonic
1139370725 16:66467867-66467889 GGGGCAGGTGTGGCCCATGCTGG - Intronic
1139390072 16:66601778-66601800 AGGGCAGGTGGGGGCCTTCCTGG + Intergenic
1139671105 16:68492945-68492967 GAGGCAGGTGGCAGCCATCCCGG - Intergenic
1139961602 16:70721281-70721303 GGAGTCAGTGGGAGCCATCCTGG + Intronic
1140541242 16:75758367-75758389 GTGGGAGGTGGGATCTATCCAGG + Intronic
1141034063 16:80612745-80612767 GGGGCAGGATGGAGGCACCCAGG + Exonic
1141139929 16:81490760-81490782 GGTGAAGGAGGGAGCCACCCTGG + Intronic
1141651391 16:85394928-85394950 GGGGCAGGCTAGAGGCATCCAGG + Intergenic
1141666304 16:85467211-85467233 GGGGCCGGAGCGAGCCAGCCTGG + Intergenic
1141705403 16:85661825-85661847 GGGGCAGGTGGCTGGCATGCAGG - Intronic
1142237435 16:88928847-88928869 AGGGCAGCTGGGAGCCACGCAGG + Intronic
1142420711 16:89967838-89967860 GGGGCAGGTGGGGGAGATGCTGG - Exonic
1142613835 17:1123962-1123984 GGGGCAGGTGGGAGGCAAGGGGG - Intronic
1142723034 17:1790059-1790081 GTGGCAGGAAGGAGCCGTCCAGG + Intronic
1143028783 17:3955820-3955842 GGGGCAGGCAGGAGGCATCATGG - Intronic
1143162538 17:4881001-4881023 GGGGCAGCTGGCTGCCATCAAGG + Exonic
1143538934 17:7558235-7558257 GGGGCGGGCAGGAGCCAGCCTGG + Intronic
1143646607 17:8234526-8234548 TGGGCAGGTAGGAGGCCTCCGGG + Exonic
1143904382 17:10197893-10197915 GGAGCAGGCGGGAGCGTTCCCGG - Intronic
1144329549 17:14211891-14211913 AGGGCAGGTGGGCCCCATTCAGG + Intergenic
1144640175 17:16932560-16932582 GGGTCTGGTGGGAGCCGTTCGGG - Intronic
1144724834 17:17496560-17496582 GGGGCTGGGGGGAGCAGTCCAGG + Intergenic
1144831119 17:18131701-18131723 GGGGCAGGGAGGAGCCACCGTGG - Intronic
1144960105 17:19039976-19039998 AGGGCAGTTGGGAGCCATGGAGG - Intronic
1144975055 17:19134548-19134570 AGGGCAGTTGGGAGCCATGGAGG + Intronic
1145166396 17:20615877-20615899 GGGGCAGGTGGGGGAGATGCTGG - Intergenic
1146095987 17:29930430-29930452 GGGGCCGAAGGGAGCCAGCCCGG + Intronic
1147342054 17:39758522-39758544 GGGGAAGGTGGGTGGCATCTTGG + Intergenic
1147420367 17:40319398-40319420 GGGGCAGGAGGTACCCTTCCAGG - Intronic
1148095691 17:45051513-45051535 CGGGCCGGTGAGAGCCAGCCGGG - Intronic
1148799373 17:50213736-50213758 GGGGCAGGGAAGAGCCGTCCCGG - Intergenic
1148841226 17:50498583-50498605 GACCCAGGTGGGAGCCATTCAGG - Intergenic
1149575778 17:57711582-57711604 GGGGCAGGTGGCAGCAACCCAGG - Intergenic
1149636021 17:58170081-58170103 GGGGCTGGTGGTAGCCACCTGGG + Exonic
1149993330 17:61394713-61394735 GAGGCCGGTGGGAGCCAGCGTGG + Intergenic
1150290326 17:63977626-63977648 TGGGAGGGTGTGAGCCATCCCGG - Intergenic
1151241822 17:72764242-72764264 TGGGGAGGTGGGAGACAGCCTGG + Intronic
1151813964 17:76461966-76461988 GGGAGAAGCGGGAGCCATCCAGG + Intronic
1152157754 17:78646062-78646084 GCGGCAGGCGGGACTCATCCGGG + Intergenic
1152193615 17:78903267-78903289 GGGACAGCTGTGAGCCAGCCAGG + Intronic
1152280705 17:79383562-79383584 GGGGCAGGAGGCAGCCATCGGGG - Intronic
1152309769 17:79542994-79543016 GTGGCCGGTGGCTGCCATCCAGG + Intergenic
1152587273 17:81194667-81194689 GGGGCAGGTGGGCTCCACACAGG - Intronic
1152620733 17:81363481-81363503 GGAGCAGGGAGGAGGCATCCTGG - Intergenic
1152861476 17:82698838-82698860 GGGGCGGGTGGGCGACAGCCCGG - Intergenic
1153151870 18:2105148-2105170 GTGGCATGTGGGAGCCATGAGGG - Intergenic
1153489022 18:5629586-5629608 GGGGGAGGGGGGGGCCTTCCGGG - Intronic
1154102558 18:11489613-11489635 GGGGTCGGTGGGAGCCATATTGG + Intergenic
1155035515 18:22021915-22021937 CGCTCAGGTGGGAGCCATCCAGG + Intergenic
1156260121 18:35438670-35438692 GAGGCAGTAGGGAGCCATTCAGG - Intergenic
1156350204 18:36296919-36296941 TGGGGAGGTGGGAGCCCTTCTGG - Intergenic
1156449637 18:37259628-37259650 AGGGCAGGAGGGAGGCCTCCCGG - Intronic
1156865782 18:41887387-41887409 GGGCCAGGTGGCAGCTTTCCTGG - Intergenic
1158299821 18:56038750-56038772 AGGGCAGGTAGGAGACATGCTGG + Intergenic
1160408702 18:78660217-78660239 AGGGCAGGAGGGTGACATCCAGG - Intergenic
1160408719 18:78660285-78660307 AGGGCAGGAGGGTGACATCCAGG - Intergenic
1160680395 19:409328-409350 GGGGCCGGTGGGAGACAAGCAGG + Intergenic
1160716224 19:578045-578067 GGGTCAGGTGGTTGCGATCCGGG - Exonic
1160904322 19:1445394-1445416 GCGGGAGGTGGGAGCCACCGCGG - Intergenic
1160985245 19:1835655-1835677 GGAGCAGGTGGGCTCCTTCCTGG + Intronic
1160992116 19:1864154-1864176 GGGCCAGGAGGGAAGCATCCGGG - Intergenic
1161137127 19:2626424-2626446 AGGGCAGGAGGGAGCCATAGCGG - Intronic
1161195424 19:2983693-2983715 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161238846 19:3210804-3210826 AGGGCAGCTGGGAGCCATGGAGG + Intergenic
1161257329 19:3316595-3316617 GAGGAAGGTGGGAGCCATGGAGG + Intergenic
1161273122 19:3401224-3401246 AAGGCAGGTGGGAGCCATAGAGG + Intronic
1161284164 19:3460189-3460211 GGAGCAAGAGGGGGCCATCCGGG + Intronic
1161366314 19:3881713-3881735 GGGGCTGGTGGGAGTGTTCCTGG + Intronic
1161431254 19:4233592-4233614 AAGGCAGGTGGGAGCCATGGAGG - Intronic
1161465586 19:4428568-4428590 GGTGCTGGTGGGATTCATCCAGG - Intronic
1161477711 19:4495654-4495676 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1161482976 19:4519889-4519911 GGAGAAGGTGGGAGCCATGGAGG - Intergenic
1161492110 19:4567786-4567808 GAGGCAGGTGGGAGCCATGGAGG - Intergenic
1161503847 19:4633316-4633338 GAGGGAGGTGGGAGCCATAGAGG + Intergenic
1161534707 19:4811912-4811934 CAGGCGGGTGGGAGCCATGCAGG - Intergenic
1161596679 19:5154259-5154281 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161599192 19:5170523-5170545 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161619180 19:5289482-5289504 GAGGCAGGTGGGAGCCATGGAGG - Intronic
1161620950 19:5296802-5296824 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1161621396 19:5299174-5299196 GAGGGAGGTGGGAGCCATGGAGG - Intronic
1161650398 19:5480659-5480681 GAGGGAGGTGGGAGCCATTGAGG + Intergenic
1161663843 19:5563195-5563217 GAGGGAGGTGGGAGCCATGGAGG + Intergenic
1161664186 19:5565048-5565070 GAGGGAGGTGGGAGCCATAGAGG - Intergenic
1161756450 19:6137544-6137566 GAGGGAGGTGGGAGCCATGGAGG + Intronic
1162087875 19:8259464-8259486 GGGGGAGATGGGAGCCATGGAGG + Intronic
1162131298 19:8527582-8527604 GAGGAAGGTGGGAGCCCTCCAGG + Intronic
1162304463 19:9863326-9863348 GAGGAAGGTGGGAGCCATGGAGG + Intronic
1162569086 19:11460432-11460454 GAGGAAGGTGGGAGCCATAGAGG - Intronic
1162871682 19:13591199-13591221 GAGTCAGGTGGGAGCCATGGAGG + Intronic
1162894663 19:13758000-13758022 GAGGAAGGTGGGAGCCATGGAGG - Intronic
1162999251 19:14355873-14355895 GGGTGAGGTGGGAGCCATAGAGG + Intergenic
1163064882 19:14785479-14785501 GGGTAAGGTGGGAGCCATAGAGG - Intergenic
1163122451 19:15226087-15226109 GGGGCTTGTGGGAGCTCTCCTGG + Intergenic
1163166367 19:15500804-15500826 GAGGAAGGTGGGAGCCATACAGG - Intergenic
1163176446 19:15566968-15566990 GGCGCCCGTGGGAGGCATCCAGG - Intergenic
1163347067 19:16749997-16750019 GGGGCAGTTGAGAGGCAGCCAGG - Exonic
1163508705 19:17722996-17723018 GGGGCCGGTGAGGGCCAACCCGG - Intronic
1163728954 19:18938950-18938972 GGGGGAGGTGGGAGCTCACCTGG + Exonic
1163750877 19:19076789-19076811 GGGGCAGGAAGGAGCCAGCTGGG - Intronic
1164678952 19:30121308-30121330 GGGGCAGGTGGGCTCTATGCTGG + Intergenic
1164788553 19:30957096-30957118 GGGGCAGGTGGGACCACACCTGG + Intergenic
1164930607 19:32172979-32173001 GGGGCAGGTGGGAGAGAACCTGG - Intergenic
1165320270 19:35080645-35080667 CAGGCAGGAGGGAGCCATCAGGG - Intergenic
1165349929 19:35269745-35269767 GGGCCAGGTCCGAGCCTTCCCGG - Intronic
1165502677 19:36202592-36202614 GGAGCAGGTGGGAGCCTTCTAGG - Intronic
1165742386 19:38211759-38211781 GGGGGTGGTGGGTGCCAGCCAGG - Exonic
1166554258 19:43687789-43687811 GGGGCATGGATGAGCCATCCTGG + Intergenic
1166689362 19:44813403-44813425 GGGGGAGGTGGCAGTCAGCCAGG - Intronic
1166695246 19:44848111-44848133 GAGGCCAGTGAGAGCCATCCTGG - Intronic
1166882905 19:45940075-45940097 GAACCTGGTGGGAGCCATCCTGG - Exonic
1166916114 19:46196968-46196990 AGGGCAGGTGGGTCCCAGCCTGG - Intergenic
1166921197 19:46230216-46230238 GTGGCAGGTGGGTCCCAGCCTGG - Intronic
1167366223 19:49056259-49056281 GGGGCTAGTGGGAGCCTGCCGGG - Exonic
1167648546 19:50718307-50718329 GGGGCAGGGAGGAGGCAGCCGGG - Intronic
1168309917 19:55455214-55455236 GGTGCACGTGGGGGCCATCAGGG - Intronic
1168404366 19:56103088-56103110 GGGTCAGGTGGGAGGCAGCGGGG + Intronic
1168406981 19:56115640-56115662 GGTGCGGGTGGGAGGCATGCGGG - Intronic
928237459 2:29556669-29556691 GGGGCCTGTGAGAACCATCCAGG + Intronic
928320925 2:30282341-30282363 AGGGCAGGAGGAAGCCATCTGGG + Intronic
929061638 2:37930699-37930721 GGGGAATGTGGGTTCCATCCAGG - Intronic
930605194 2:53486309-53486331 GGGCCACGCGGGAGCCTTCCGGG - Intergenic
930888494 2:56355907-56355929 GGACCAGATGGGAGCCATTCTGG + Intronic
932227325 2:70052876-70052898 GGGACAGCTGGGAGCAAGCCTGG + Intergenic
932522266 2:72427124-72427146 GGGACAAGTGGGAGCCCCCCTGG + Intronic
933900169 2:86844092-86844114 GAGGCTGTTGGAAGCCATCCTGG - Intronic
934950151 2:98570578-98570600 TGGGCAGGTGGGACACACCCTGG + Intronic
935780387 2:106505131-106505153 GAGGCTGTTGGAAGCCATCCTGG + Intergenic
935790933 2:106589545-106589567 GGGGAAGGAGAGAGCCATACAGG + Intergenic
936243392 2:110806907-110806929 GGCAGAGGTGGGAGCCTTCCAGG + Intronic
936418279 2:112339599-112339621 GGGGCAGGCGGGAGTTGTCCAGG + Exonic
937348368 2:121142585-121142607 GTGGCAGGTCAGACCCATCCTGG - Intergenic
937851392 2:126639425-126639447 GGGGCAGGTGGGGCCCACTCTGG - Intergenic
937892130 2:126946877-126946899 GGGGCAGGGGTGACCCAACCTGG - Intergenic
937984841 2:127633754-127633776 GGGGCAGGTAGGAGACCACCAGG + Intronic
938096522 2:128467514-128467536 GGGGCAGGAGGGGGCCTTCTCGG + Intergenic
940897491 2:159094777-159094799 GGGGGGGGTGGGGGCCAGCCTGG + Intronic
941616493 2:167726359-167726381 GGGGCAGGTGGGCGGATTCCTGG - Intergenic
941860442 2:170273396-170273418 TGGGCAGCTGTGGGCCATCCAGG - Intronic
943846563 2:192656216-192656238 GGGGCAGGTGGGAGACTCTCTGG + Intergenic
943931778 2:193863935-193863957 GGGGCAGGTGCGAGTCATTCAGG - Intergenic
946202302 2:218077629-218077651 GGGGCAGGTGTTAGCCATGTGGG - Intronic
946409386 2:219508738-219508760 GGGGTAGGAGGGCGCCAGCCCGG + Intergenic
947344764 2:229179275-229179297 GGGGCTGATGGGAGCCATGGAGG - Intronic
947653995 2:231810726-231810748 GGTGCAGGAGGTCGCCATCCAGG - Intergenic
947918134 2:233847914-233847936 AGGGCTGGTGGGTGCCATACTGG + Intronic
948385040 2:237575846-237575868 GGCCCAGGTGGGTGCCGTCCAGG - Intronic
948503433 2:238411245-238411267 GGGGCAGGTGGGGGGCGTCAAGG + Intergenic
948597210 2:239087769-239087791 GGGCCAGCTGGGAGCCTTTCCGG + Intronic
948693990 2:239723561-239723583 AGGGCAGCTGGGACTCATCCAGG - Intergenic
948777452 2:240297038-240297060 AGGGCAAGTGGGATCCATGCAGG - Intergenic
948826744 2:240576740-240576762 GCGGCAGCGGGGACCCATCCAGG - Exonic
948927800 2:241110636-241110658 GGTGCAGGGGGGATCCAACCTGG - Intronic
949048907 2:241886521-241886543 GGGGCAGGTGGCAGACCTCGGGG + Intergenic
1171018299 20:21561600-21561622 GGGGCGGGTGAGAGCCAGCAGGG - Intergenic
1172178844 20:32988413-32988435 GAGGCCGGTGAGAGCCATTCAGG - Intronic
1172274476 20:33672344-33672366 GGGCAGGGTGGGAGGCATCCAGG - Intronic
1172277182 20:33686112-33686134 GGGGCCGGTGGGAGCCGGCGGGG + Exonic
1172666698 20:36605382-36605404 GGGGCAGCTTGGAGCTACCCTGG + Intronic
1172777259 20:37414904-37414926 GGTGCTGGTGAGAGCCATGCGGG - Intergenic
1172870259 20:38131257-38131279 AGGGCAGGTGGGATCCAGGCTGG + Intronic
1173075635 20:39816786-39816808 GGAGCAGGTGGGAGCCTTCTTGG - Intergenic
1173390366 20:42626710-42626732 GGGTCAGGTGGAATCCATCATGG + Intronic
1173624944 20:44465860-44465882 GGGGCAGCTTGAAGCCAGCCAGG - Intergenic
1174196069 20:48773774-48773796 GGGTAAGGTGGGAGCCATGGAGG + Intronic
1174421267 20:50400554-50400576 GGGGTAGGTGAGAGCCATGGAGG + Intergenic
1174483741 20:50848718-50848740 AGGGCACGTGGGTGCCCTCCAGG + Intronic
1175193724 20:57228213-57228235 TGGGCAGGTGGGTGCTATACGGG - Exonic
1175233194 20:57489070-57489092 GGGGCAAGTGAGAGCCGTACGGG - Intergenic
1175326053 20:58129262-58129284 GAGGCAGGTGGGTGCCTCCCAGG + Intergenic
1175792823 20:61752875-61752897 GGGGCAGCAGGAAGCCATGCTGG + Intronic
1175820308 20:61905547-61905569 GGGGCAGGAGGGCACCCTCCTGG - Intronic
1176116342 20:63433124-63433146 AGGGCAGGTGGCAGCCAGCTGGG - Intronic
1176143885 20:63557006-63557028 GGGGATGGTGGGAGGCATCACGG - Intergenic
1176144471 20:63559444-63559466 GGGTCAGGTGGGAGTCAGTCAGG + Intronic
1176144538 20:63559704-63559726 GGGTCAGGTGGGAGTCAGTCAGG + Intronic
1176295259 21:5068767-5068789 GGGGCAGGGGGGAGGCCTCCTGG - Intergenic
1177168563 21:17629995-17630017 GGGGCAGTTTGGAGACATCCTGG - Intergenic
1178507137 21:33171425-33171447 GGGACAGGTGGGAGGAATACGGG - Intergenic
1179473366 21:41627009-41627031 GTGGAAGGTGGGAGCCAGCACGG - Intergenic
1179861790 21:44193361-44193383 GGGGCAGGGGGGAGGCCTCCTGG + Intergenic
1179950193 21:44704854-44704876 GAGGCAGCTGGGCTCCATCCAGG - Intronic
1180051515 21:45333652-45333674 GGGTGAGTTGGGAGCCACCCTGG - Intergenic
1180937807 22:19637605-19637627 GGGGCAGGAGGGAGTCAGCCTGG - Intergenic
1181029201 22:20141779-20141801 GGGGCTGGCGTGGGCCATCCAGG + Intronic
1181031386 22:20150205-20150227 GGAGCAGCTGGGGGCCCTCCTGG - Exonic
1181511947 22:23393197-23393219 GGAGCAGCTGGGGGCCCTCCTGG + Intergenic
1181589713 22:23876655-23876677 GGGACAGCTGGTAGGCATCCAGG + Intronic
1181807802 22:25385573-25385595 AGGGCAGGTGGGGGCCAAGCTGG - Intronic
1181882563 22:25992525-25992547 GCAGCAGGTGGGCGGCATCCTGG + Intronic
1182045480 22:27270807-27270829 GGGGCACCTGGGAGCAATGCGGG + Intergenic
1182328895 22:29536324-29536346 GAGGCCGGTGGGGGCCATGCAGG + Intronic
1182546782 22:31081265-31081287 GGGGCAGGGCGGGGCCAGCCGGG + Intronic
1182691861 22:32169899-32169921 GGGGCAGTTGGGAGCTACTCAGG + Intergenic
1183349176 22:37325113-37325135 GAGGCAGCTGGGAGACACCCAGG + Intergenic
1183362331 22:37389253-37389275 GGGGCCAGTGGGAGCCATTGTGG - Intronic
1183735776 22:39644046-39644068 TGGGGAGGTGGGAGGCTTCCTGG + Intronic
1183744673 22:39685735-39685757 GGGGGAGGTGGGAGCCGTGGAGG - Intronic
1184297437 22:43533817-43533839 GGGGCAGGTGGCAGCAAGGCCGG + Intronic
1184298866 22:43543324-43543346 GGGGCAGGTGGGAGCCGCCCTGG - Intronic
1184468687 22:44683578-44683600 GGGGCTGGGGGGAGCCAGCCAGG + Intronic
1184492919 22:44820554-44820576 GGGGCTGGTGGGACCCCTGCAGG - Intronic
1184732394 22:46377993-46378015 GAGGGAGGTGGGAGCCAGCCTGG - Intronic
1184852936 22:47131158-47131180 GGGCCTGGTGGGAGGCATCTGGG - Intronic
1184857697 22:47155509-47155531 GAGGGAGGTGGGAGCCGCCCTGG + Intronic
949441929 3:4090868-4090890 GAGGCAGGTGGATCCCATCCTGG + Intronic
949891334 3:8735721-8735743 CTGGCAGGTGGGAGCCAACCAGG - Intronic
950170322 3:10834671-10834693 GGGGCAGATGGAAGACATGCAGG + Intronic
950460711 3:13120728-13120750 TGTGCAGGTGGGAGCCAAGCAGG - Intergenic
950543437 3:13625523-13625545 GGGGAAGGTGGGAGCCCTGCTGG - Intronic
950563398 3:13749091-13749113 GAGGAAGGTGGGAGCCATGGAGG - Intergenic
950664094 3:14484428-14484450 GGGGAAGGTGGGAGCCATGGAGG + Intronic
952016046 3:28958840-28958862 TGGCCAGGTGGGAGCTCTCCAGG + Intergenic
952879309 3:37973427-37973449 GGGGCAGGTGGGAGCCATCCAGG - Intronic
952882678 3:37994485-37994507 GGGGCAGGAGGGAGCCGTGGAGG + Intronic
954124510 3:48520698-48520720 GGGCCAGAAGGGAGCCATCCAGG + Intronic
954745937 3:52787610-52787632 GGAGTAAGTGGCAGCCATCCTGG + Exonic
955747646 3:62155894-62155916 GGGGCTGGTGGAAGCCATGAAGG + Intronic
955978101 3:64497538-64497560 ATGCCAGGTGGGAGACATCCGGG - Intergenic
958622862 3:96583988-96584010 GATGCAGGTGGGAGCCATTCAGG - Intergenic
960628423 3:119703368-119703390 GGGGCAGCTCCGAGCCCTCCAGG + Intronic
961092940 3:124130966-124130988 GGGGCATGAGGGAGCCTTCTGGG + Intronic
961382995 3:126508172-126508194 GGGGCCTGTGGGAGCTGTCCAGG - Intronic
961383551 3:126510978-126511000 GGGGCAGGAGGGGGCGATCAGGG - Intronic
961457825 3:127032992-127033014 GGGCCAGGAGGGAGCCTGCCAGG + Intronic
961477805 3:127159448-127159470 GGCACAGGTGGGAGCTCTCCTGG + Intergenic
961738073 3:129014813-129014835 CGAGCAGGTTGGAGCCAGCCTGG + Intronic
961814303 3:129540915-129540937 CGGGCAGTGGGGAGCCATGCAGG + Intergenic
962373628 3:134841406-134841428 GGGACAGGTGGGAGGTCTCCAGG + Intronic
963691841 3:148514002-148514024 GGAGCAGGTGGGGGCAATTCAGG - Intergenic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968763083 4:2452340-2452362 GGAGCAGGTGGGTGCCATGCAGG + Exonic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968880581 4:3296779-3296801 GGGAGAGGCGGGAGCCATCCTGG + Intronic
968946371 4:3666746-3666768 GGGGCCGGTGGGAGGCTTCCTGG + Intergenic
969265618 4:6062332-6062354 GGAGCAGGTGGGAGGCACGCTGG - Exonic
970163320 4:13210668-13210690 GGGGGAGGTGGCAGCGAGCCAGG - Intergenic
972287363 4:37661963-37661985 TTGGCAGGTGGGTGCCATCTGGG - Intronic
972731364 4:41798478-41798500 GGGCCAGGTGGGAGGCAGACTGG + Intergenic
982132593 4:152244015-152244037 AGGGGACGTGGGAGCCATTCTGG + Intergenic
982204984 4:152990866-152990888 GGGCGAGCTGGGAGCCAGCCTGG + Intergenic
985451417 4:190065680-190065702 GGGGCAGATGCAAGGCATCCCGG + Intergenic
985452406 4:190068972-190068994 GGGGCAGATGCAAGGCATCCCGG + Intergenic
985453391 4:190072269-190072291 GGGGCAGATGCAAGGCATCCCGG + Exonic
985454381 4:190075562-190075584 GGGGCAGATGCAAGGCATCCCGG + Exonic
985455369 4:190078855-190078877 GGGGCAGATGCAAGGCATCCCGG + Exonic
985456354 4:190082149-190082171 GGGGCAGATGCAAGGCATCCCGG + Exonic
985457341 4:190085449-190085471 GGGGCAGATGCAAGGCATCCCGG + Intergenic
985458328 4:190088742-190088764 GGGGCAGATGCAAGGCATCCCGG + Exonic
985459317 4:190092042-190092064 GGGGCAGATGCAAGGCATCCCGG + Exonic
985463569 4:190174811-190174833 GGGGCAGATGCAAGGCATCCCGG + Exonic
985536318 5:467577-467599 GGACCAGGAGGGCGCCATCCAGG - Intronic
985536346 5:467669-467691 GGACCAGGAGGGCGCCATCCAGG - Intronic
985536372 5:467761-467783 GGACCAGGAGGGCGCCATCCAGG - Intronic
985631541 5:1016685-1016707 AGGGCAGGTGGGAGCCCTGGAGG - Intronic
985678465 5:1244133-1244155 GGGTCAGGAGGAAGCCAGCCAGG - Intronic
986337591 5:6766856-6766878 GGAGCAGCTGGGTGCCATGCGGG + Intergenic
987300938 5:16597707-16597729 GGGGCATGTGGGAGACATGTTGG - Intronic
989966884 5:50475307-50475329 GTGGCAGGTAGGAGCCCTCATGG + Intergenic
991353539 5:65745053-65745075 GGTGCAGAGGGCAGCCATCCAGG + Intronic
992626941 5:78644890-78644912 GGGGCAAGTGAGAGCCAGACAGG - Intronic
994355892 5:98793417-98793439 GGGCCAGGTGTCTGCCATCCTGG + Exonic
996930012 5:128874974-128874996 GGGCCTGGTGGGAGCCATTTTGG + Intronic
997476009 5:134142955-134142977 GGGGCAGGTGGGGTGCATCAGGG - Intronic
998018417 5:138751259-138751281 GGGGCTGGTGGGAGGCATTTGGG - Intronic
998134928 5:139669523-139669545 CTGGCAGGTGTGAGCCATGCTGG - Intronic
1000411602 5:160938970-160938992 GTGGCAGGTGGCGGCCAACCCGG + Intergenic
1001245263 5:170101363-170101385 GAGGCAGGTGGGAGCCAGCCTGG - Intergenic
1002060945 5:176625714-176625736 GGAGCAGGTGGGAGCTGTGCTGG - Intronic
1002080484 5:176734431-176734453 GGGTCAGGTGGGTGCCAAGCTGG + Intergenic
1002212179 5:177605607-177605629 GGGGATGGTGGGAGTCAGCCCGG - Intronic
1002441675 5:179267542-179267564 GGGGCAGGTGCTTCCCATCCTGG - Intronic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1003196020 6:3915640-3915662 GGGAAAGGGGGAAGCCATCCTGG - Intergenic
1003426340 6:6000432-6000454 GGGGCAGGTGGGGACCAGCCCGG - Intronic
1003436201 6:6090847-6090869 GGGAAAGGGGGAAGCCATCCTGG + Intergenic
1003639684 6:7866115-7866137 AGGGCAAGTGAAAGCCATCCAGG - Intronic
1003869651 6:10391366-10391388 GGGGCAGGTGGGACCCAGTGAGG + Intergenic
1005290739 6:24376307-24376329 GGGGGAGGTGAGAGTCATTCTGG + Intergenic
1006505692 6:34487267-34487289 GGAGCAGGAGGGAACCTTCCAGG - Intronic
1006839814 6:37021574-37021596 GGGGCCTGAGGGAGACATCCAGG + Exonic
1006842385 6:37037628-37037650 GGGGCACAAGGGAGCCCTCCGGG - Intergenic
1007424485 6:41737866-41737888 GGGGCTGGTGGGTGCTATCAGGG - Intronic
1011014666 6:82741977-82741999 TGTGCAGCTGTGAGCCATCCTGG - Intergenic
1011087902 6:83562872-83562894 AGGGAAGTGGGGAGCCATCCAGG - Intronic
1012372984 6:98529733-98529755 AGCGCAGGTGGGGGCCCTCCAGG + Intergenic
1014029137 6:116681195-116681217 GGCGCAGGTGGCCGCCATCTTGG + Exonic
1014805037 6:125820050-125820072 AGGGGAGGTGGGAGCCAACAAGG - Intronic
1015390715 6:132678446-132678468 GGGTCTGGTGGGAGGCATCTGGG - Intergenic
1017048114 6:150366002-150366024 GGGGCAGGAGAGAGCCTTCCAGG - Intergenic
1018035273 6:159876211-159876233 GGGGCAGGGGAGAGCCTTCGGGG - Intergenic
1019183443 6:170207370-170207392 GTGTCAGGTGCCAGCCATCCTGG - Intergenic
1019550308 7:1599139-1599161 GGGCCAGGTTGGAGCCCTCCAGG + Intergenic
1019623292 7:2002944-2002966 GGGGCAGTGGGGAGCCAAGCGGG - Intronic
1019671189 7:2279787-2279809 TGAGCAGGTGGAAGCCTTCCAGG - Intronic
1019739907 7:2667526-2667548 GAGGGAGGTGGGAGCCATGAAGG + Intergenic
1019886303 7:3908984-3909006 TGAGCAGGGGGCAGCCATCCGGG - Intronic
1020177425 7:5894234-5894256 AGGCCAGGTGGAAACCATCCTGG - Intergenic
1020261960 7:6535847-6535869 GGGCCAGGTGCTAGCCATACAGG - Intronic
1020983507 7:15102436-15102458 GGGGCAGGTGGGATGCTTTCTGG - Intergenic
1023767178 7:43522558-43522580 GGGGCAGGTGAGAGCACGCCAGG - Intronic
1024044502 7:45577625-45577647 TGGGCAGGTAGTAGCCATGCTGG + Intronic
1024220999 7:47286551-47286573 GGGTCTGGTGGGTGCCTTCCTGG - Intronic
1025019182 7:55467315-55467337 GGGGCAGGAGGGAGTCAGGCAGG + Intronic
1026650394 7:72211171-72211193 GGGTCAGGTTGGGGCCAGCCTGG - Intronic
1026771709 7:73205580-73205602 GAGCCAGGTGGGAGCCTTCCCGG + Intergenic
1026845660 7:73697688-73697710 AGGGCAGGTGAGTGCCAGCCTGG + Exonic
1026916007 7:74120824-74120846 TGGGCATCTGGGTGCCATCCAGG - Intronic
1026976644 7:74502751-74502773 GGGGCAGGTGGCAGGCAGGCAGG + Intronic
1027012577 7:74758977-74758999 GAGCCAGGTGGGAGCCTTCCCGG + Intronic
1027075463 7:75187076-75187098 GAGCCAGGTGGGAGCCTTCCCGG - Intergenic
1029081413 7:97976767-97976789 AGGCCAGGTGGAAACCATCCTGG + Intergenic
1030147066 7:106367644-106367666 GGGGTAGGTGGGAGGCATGGTGG + Intergenic
1032389130 7:131544435-131544457 GGGCAGGGTGGGAGCCGTCCTGG - Intronic
1033442511 7:141393154-141393176 GGGGAAGGAGGCAGCCCTCCTGG + Intronic
1033790835 7:144790861-144790883 GGGTGAGGAGGGAGCCACCCAGG + Intronic
1035075021 7:156171572-156171594 GAGGCAGGTGGCAGCCACACTGG + Intergenic
1035171633 7:157020713-157020735 GGGGCAGGTGGGCACCACGCGGG + Intergenic
1035412530 7:158656596-158656618 GGGGCAGGTGGGGCACATTCTGG - Exonic
1035485984 7:159226393-159226415 GAGGGAGGTGGCACCCATCCTGG + Intergenic
1036419244 8:8580886-8580908 GGGGCAGGTTGGAGCAGTCCAGG - Intergenic
1037013806 8:13877856-13877878 GCTGAAGGTGGCAGCCATCCAGG - Intergenic
1037308192 8:17528002-17528024 GGGGTGATTGGGAGCCATCCAGG + Intronic
1037832706 8:22198743-22198765 GGGGCAGGTGCATGGCATCCGGG - Intronic
1038356235 8:26831892-26831914 GGGAGAGGTGGGAGCCAGCCTGG - Intronic
1038494089 8:27989694-27989716 GGGGCAGGGAGGAGAGATCCTGG - Intronic
1039827046 8:41183465-41183487 GGTGCAGGTTGGAGCCAGCATGG - Intergenic
1040590316 8:48786848-48786870 GGGGCAGGTGGGAGTGAACTGGG - Intergenic
1041642019 8:60213525-60213547 GGGCCTGGTGGCTGCCATCCTGG - Intronic
1042654978 8:71085872-71085894 GGGGCAGGTGGGGGGCATACAGG + Intergenic
1046620625 8:116525904-116525926 GAGGCAGCTGGGAGGCAGCCAGG + Intergenic
1049200228 8:141336477-141336499 GGGGAGGGTGTGAGGCATCCTGG + Intergenic
1049294292 8:141822598-141822620 GGGGCAGATGGCAACCATCTGGG - Intergenic
1049308962 8:141923353-141923375 GGGCCACGTGGGAACCTTCCAGG + Intergenic
1049425329 8:142535571-142535593 GGGCCAGGTGGAGGCCATGCCGG + Intronic
1049463166 8:142739386-142739408 AGGGCAGGTGGGCGTCCTCCAGG + Intergenic
1049553774 8:143272396-143272418 GCGGCAGGTGGGTGCTTTCCTGG - Intronic
1049567485 8:143348608-143348630 GGGGGGGGTGGGGGCCCTCCAGG + Intronic
1049585004 8:143428971-143428993 GGGGCAGGCAGGGGCCACCCGGG + Exonic
1049660486 8:143817635-143817657 GCGGCAGGTGGGAGGCCTCCAGG + Exonic
1053379240 9:37635774-37635796 GGGGAATGTGGGTTCCATCCAGG - Intronic
1054713918 9:68538541-68538563 GGGGCAGGCAGCAGTCATCCTGG - Intronic
1056513773 9:87330751-87330773 GGGGCAGGCGGGAGCCAGAAAGG + Intergenic
1056756843 9:89387058-89387080 GGGGCAGGTGTGAGCCACCTGGG - Intronic
1056824570 9:89867916-89867938 GGGACTGGTGGGAGCCAGCCTGG + Intergenic
1056826366 9:89878977-89878999 GGAGCAGCTGGGAGCCAGCTGGG + Intergenic
1056949197 9:91028609-91028631 GGAGCAGCTGGGGGCCAGCCAGG - Intergenic
1057197047 9:93121056-93121078 AGGGGAGCTGGGAGCCATGCCGG - Intergenic
1057304248 9:93903203-93903225 GGGGTAGGTGGGGGCCATCCTGG + Intergenic
1057888856 9:98852890-98852912 GGGGCAGGTGGGAACCCACTCGG - Intergenic
1059153911 9:111973179-111973201 GGGGCAGGTGGGGGCCGTTGAGG + Intergenic
1059570643 9:115430824-115430846 GTGGCAGGTGGGAGACATTGGGG - Intergenic
1060548450 9:124474318-124474340 GGGGTAGTTGGGAGCCATGCAGG + Intronic
1060553367 9:124496062-124496084 GGGGCAGGTGGGATCCCGGCCGG - Intronic
1061060970 9:128250447-128250469 GCTCCAGGTGGGAGCCACCCCGG - Intronic
1061294517 9:129669681-129669703 GGGTGAGGTGGGAGCCCTCGAGG + Intronic
1061411519 9:130424684-130424706 GGGGCAGTGGGGAGCCATGACGG + Intronic
1061569585 9:131468835-131468857 TGGGCACCTGGGAGCCTTCCAGG + Intronic
1062217851 9:135398923-135398945 TGGGTAGGCAGGAGCCATCCAGG + Intergenic
1062243420 9:135551608-135551630 GGGGGCGGTGGGAACCAGCCTGG - Intergenic
1062501553 9:136854106-136854128 TGGGCAGGTGGGGGCCCTCCCGG - Intronic
1203736670 Un_GL000216v2:144246-144268 GGGGCAGATGCAAGGCATCCCGG + Intergenic
1203740175 Un_GL000216v2:171493-171515 GGGGCAGATGCTAGGCATCCCGG + Intergenic
1190123655 X:47684499-47684521 GGGGCATGAGGGAGCCTTCTGGG + Intergenic
1190318889 X:49167679-49167701 GGGGTAGCTGGAAGCCACCCTGG - Intronic
1190439360 X:50462242-50462264 GGGGCAGCGGGAAGCCAGCCTGG + Intronic
1190486555 X:50931584-50931606 AGGGCAGGTGAGAGCCAAACAGG - Intergenic
1192885020 X:75327857-75327879 GGTGCAGGTGGGAGCCCCCGAGG - Intergenic
1192958096 X:76095225-76095247 GCATCAGGTGGGTGCCATCCTGG - Intergenic
1193620689 X:83749960-83749982 GGTGCAGGTGGGGGCCCCCCAGG - Intergenic
1196797775 X:119515983-119516005 GGGGGAGGTGGGTGTCAGCCTGG + Intergenic
1197639293 X:128950414-128950436 GGGGCAGTGGGGAGCCATTGAGG - Intergenic
1199765448 X:150937883-150937905 GGGGCAGGTGAGAACGCTCCAGG + Intergenic
1201073795 Y:10171802-10171824 GGAGCAGATGTAAGCCATCCAGG - Intergenic
1201175865 Y:11307947-11307969 GGGGCAGTAGCAAGCCATCCCGG + Intergenic
1201178252 Y:11322589-11322611 GGGGCAGATGCAAGGCATCCGGG + Intergenic
1201251889 Y:12067144-12067166 GGGGCCTGTGGGAGCTATGCAGG - Intergenic