ID: 952879650

View in Genome Browser
Species Human (GRCh38)
Location 3:37975550-37975572
Sequence TCCTCTCCGTGTACATAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952879650 Original CRISPR TCCTCTCCGTGTACATAAGA TGG (reversed) Intronic
904740187 1:32668767-32668789 GCGTCTCCGTGGACATCAGAAGG + Exonic
905085800 1:35375299-35375321 TAATCACCGTGTAAATAAGAGGG - Intronic
905115049 1:35631435-35631457 TACTCTGAGTGTACAAAAGATGG - Intronic
906724685 1:48035693-48035715 TCCTCTCCTTGTGTAAAAGAGGG + Intergenic
910211260 1:84795841-84795863 TCCTCTCCGTGCTCACAATATGG + Intergenic
1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG + Intronic
1065452759 10:25875804-25875826 TCTTCTCAGTGTACCCAAGAAGG - Intergenic
1071381253 10:85062586-85062608 TCTTCTTCGTGTAGATCAGAAGG - Intergenic
1075823258 10:125331932-125331954 TTTTCCACGTGTACATAAGAAGG + Intergenic
1076157936 10:128217558-128217580 TCTTCTCAGTGTTTATAAGATGG - Intergenic
1083405054 11:62451003-62451025 TCATCTCCATGTACCAAAGATGG - Intronic
1083675453 11:64322562-64322584 CCCTCTCCCTGTCCATCAGATGG - Intergenic
1085995413 11:81906598-81906620 TTCTTTCCGTGTTCATAGGATGG - Intergenic
1086893560 11:92286409-92286431 TTCCCTCCGTGCATATAAGAAGG - Intergenic
1089181464 11:116586068-116586090 TCATCTTTGTGTACGTAAGAGGG - Intergenic
1092979059 12:13775425-13775447 GCCTCTCCGGGTAAATGAGATGG + Intronic
1095155516 12:38848987-38849009 TCCTAACCTTGTATATAAGAAGG + Intronic
1096483054 12:51955739-51955761 TCCTCTCTGTATTCATAAAAAGG + Intronic
1103863809 12:124035307-124035329 TGCTCTCCCTGTTCATGAGAAGG - Intronic
1112196886 13:97235036-97235058 TGCTCTGCGTGTCCCTAAGAAGG - Intronic
1121858899 14:97298243-97298265 TTCTCTCTGTGAACATCAGATGG - Intergenic
1125844243 15:42836898-42836920 GCTTCTCCATGTACAAAAGAGGG + Intronic
1126783668 15:52159471-52159493 TCCTCTCCCTGGACATGGGAAGG - Intronic
1130096870 15:80862582-80862604 CCCTCTCCATGCAGATAAGATGG + Intronic
1138732247 16:59208244-59208266 GCCTCTCAATGTACATGAGAGGG + Intergenic
1140220926 16:73043289-73043311 CCCTCTCCCTGTCCATCAGAGGG - Intronic
1140242258 16:73213851-73213873 TCCTCTCAGTTTTCAGAAGATGG + Intergenic
1141057629 16:80833315-80833337 ACCTCTCCTAGTACATGAGATGG - Intergenic
1143754469 17:9056393-9056415 TCCTCACCGTGCCCACAAGATGG - Intronic
1155398604 18:25414512-25414534 TTGTCTCCATGTAAATAAGAAGG + Intergenic
925292602 2:2757606-2757628 TCCTCTCTGTGGACAAAACAGGG + Intergenic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
928563731 2:32520053-32520075 TTCTATCTGTATACATAAGAAGG + Intronic
937880733 2:126862688-126862710 TCATCTCAGTGTCCAAAAGAAGG - Intergenic
943849700 2:192702514-192702536 ACATATCCGTGTAGATAAGAGGG - Intergenic
1173274354 20:41566577-41566599 TCCTCTACTTGGGCATAAGAAGG - Intronic
1179524869 21:41969312-41969334 TGCTCTCGGTGTACAGTAGACGG + Intergenic
1182638622 22:31749696-31749718 TCCTCTCCGAGGAGATAAGTTGG + Intronic
1183199145 22:36373811-36373833 TCTCCTCAGTGGACATAAGAGGG + Intronic
951356431 3:21672481-21672503 TCCTCTCTGTGGTCATAAGCAGG - Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
953868753 3:46607883-46607905 TCCTCTTTGTGTCCAGAAGAGGG + Intronic
967757250 3:193183922-193183944 TCCTATCCATGTGCATAAAATGG - Intergenic
970422536 4:15918865-15918887 TCCCCACCGTGTACAGGAGAGGG - Intergenic
986485018 5:8227306-8227328 TCCTCTCCATTTACATAGGGCGG - Intergenic
987124377 5:14797866-14797888 GCGTCTCCGTGGACATCAGAAGG - Intronic
990308519 5:54517278-54517300 TCCTCTCCTTGAGCAGAAGAGGG + Intergenic
992897229 5:81255543-81255565 TCCTGTCTGTGTCCAGAAGATGG + Intronic
1011934550 6:92759070-92759092 TTCTATCCTTGTGCATAAGATGG - Intergenic
1013299958 6:108795569-108795591 ACCTCTCCCTGGACAGAAGATGG - Intergenic
1016893910 6:149034070-149034092 TCCTCTCCATCTTCCTAAGATGG + Intronic
1022482064 7:30750880-30750902 TTCTCTCAGTGTACACAAGCTGG + Intronic
1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG + Intronic
1030335629 7:108322944-108322966 TCCTCTCTGTGTACAAAATGGGG + Intronic
1030941603 7:115657730-115657752 GTCTCTCCATGTACATAAAATGG + Intergenic
1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG + Intergenic
1041389341 8:57335154-57335176 TCATCTCCATTTACAGAAGAGGG - Intergenic
1042075521 8:64989646-64989668 TCCTATTCCTGTACATAAAAGGG - Intergenic
1044605166 8:94041929-94041951 TCCTCCCCATTTACAGAAGATGG + Intergenic
1044608630 8:94070189-94070211 TCCTCTCTCTGTCCATGAGATGG - Intergenic
1053162158 9:35820615-35820637 TGCTCTCTGTGTACCTAAGAAGG + Intronic
1058155747 9:101512782-101512804 TCCTCTCCGTGGATTTAAGGGGG + Intronic
1059959305 9:119549870-119549892 TCTTCTCTGGGTTCATAAGATGG - Intergenic
1186793935 X:13025589-13025611 TCCTATGCATGTACATCAGAGGG + Intergenic
1187537448 X:20155886-20155908 TCCTCTCAGTCTACATGAGTAGG - Intronic
1193617008 X:83701384-83701406 TTCTCTCCATGAACATGAGATGG + Intergenic