ID: 952880216

View in Genome Browser
Species Human (GRCh38)
Location 3:37980711-37980733
Sequence CAGTGCATGGAGGAGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 498}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952880216_952880221 3 Left 952880216 3:37980711-37980733 CCTGCTGCCTCCTCCATGCACTG 0: 1
1: 0
2: 3
3: 65
4: 498
Right 952880221 3:37980737-37980759 TCCAGGTGCCTGTGCAGTCCTGG 0: 1
1: 1
2: 2
3: 22
4: 279
952880216_952880224 19 Left 952880216 3:37980711-37980733 CCTGCTGCCTCCTCCATGCACTG 0: 1
1: 0
2: 3
3: 65
4: 498
Right 952880224 3:37980753-37980775 GTCCTGGTTCGATGACATGACGG 0: 1
1: 0
2: 0
3: 4
4: 54
952880216_952880226 25 Left 952880216 3:37980711-37980733 CCTGCTGCCTCCTCCATGCACTG 0: 1
1: 0
2: 3
3: 65
4: 498
Right 952880226 3:37980759-37980781 GTTCGATGACATGACGGACACGG 0: 1
1: 0
2: 2
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952880216 Original CRISPR CAGTGCATGGAGGAGGCAGC AGG (reversed) Intronic
900206373 1:1433537-1433559 CTGTGCCTGCAGGAGGCAGAGGG + Intergenic
900477260 1:2881815-2881837 CCCTGCAGGGAGGAGGCATCAGG + Intergenic
900479409 1:2890865-2890887 CAGGGCCTGGAAGAGGCAGGAGG - Intergenic
900481332 1:2900883-2900905 CTGTGCAGGAAGGAGGCAGACGG - Intergenic
900686018 1:3948094-3948116 CAGTCCAGGGAGGAGGCAGAGGG + Intergenic
901120013 1:6883505-6883527 CAGTGGAGGGAGGAGGCATAAGG + Intronic
901455795 1:9362090-9362112 GAGTGCAGGAAGGAGGCACCCGG - Intronic
901712444 1:11126309-11126331 GAGGCCAGGGAGGAGGCAGCTGG - Intronic
901941111 1:12662559-12662581 GAGTGGATGGAGGGGGCAGTAGG + Intronic
902569543 1:17338377-17338399 CAGGGCCTGTAGGAGGCATCAGG - Intronic
902573367 1:17361076-17361098 CAGTTCAGGGAGGAGCCAGCAGG + Intronic
903589010 1:24440311-24440333 CCCTGCAGAGAGGAGGCAGCTGG - Intronic
903690621 1:25170773-25170795 GTGTGCAGGGAGGGGGCAGCAGG - Intergenic
904788206 1:32998348-32998370 CAGGGCAGGTGGGAGGCAGCAGG - Intergenic
905205172 1:36339313-36339335 CCTTGCATGCAGGAGGCAGCGGG - Intergenic
905876378 1:41434383-41434405 CAGTCAAGGAAGGAGGCAGCAGG - Intergenic
905925775 1:41748666-41748688 CATTGCATGATGGAGGCAGGAGG + Intronic
906996187 1:50796722-50796744 GAGTGACTGCAGGAGGCAGCTGG - Intronic
907290907 1:53412357-53412379 CCCTGCATGAAGGAGGCAGAAGG + Intergenic
907517826 1:55004453-55004475 CAGATCATGAAGGAGGCAGTGGG - Intronic
908208697 1:61878012-61878034 GGGTCCATGGAGGAGGCAGTGGG + Intronic
908322508 1:62991884-62991906 GAATGCATAGAGGAGACAGCAGG - Intergenic
908627825 1:66066269-66066291 TAGGGGATGGAGGAGGCTGCGGG - Intronic
909591106 1:77350537-77350559 CAGTGAATGGAGGAAGCATCTGG + Intronic
912857976 1:113188833-113188855 CATTTCATGGTGGAGGAAGCTGG - Intergenic
912957690 1:114167017-114167039 AAGAACATGAAGGAGGCAGCAGG - Intergenic
913692181 1:121289554-121289576 CAGTGCAGGGGGGAGGCTGAAGG + Intronic
914054940 1:144161331-144161353 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
914124206 1:144805030-144805052 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
914145374 1:144990560-144990582 CAGTGCAGGGGGGAGGCTGAAGG - Intronic
915286423 1:154856224-154856246 GCCTGCAGGGAGGAGGCAGCAGG + Intronic
915471756 1:156129928-156129950 CAGGGCACGGATGAGGCAGGAGG + Intronic
915579233 1:156803571-156803593 CTCTGCCTGGAGGAGGCAGGAGG + Intergenic
915730049 1:158046893-158046915 CAGAGCATGGAGGGGGTTGCTGG + Intronic
916560202 1:165928548-165928570 CATGACATGGGGGAGGCAGCAGG - Intergenic
917444927 1:175099179-175099201 CCCTGCCTGGAGCAGGCAGCTGG - Intronic
919891945 1:201982367-201982389 CACTGCCTAGATGAGGCAGCAGG + Intronic
921051948 1:211517213-211517235 AACTGCATGGTGGAGGAAGCAGG + Intergenic
921565493 1:216712571-216712593 CAGTGCTGGGAGGCAGCAGCAGG - Intronic
922875606 1:228937627-228937649 CAGTGCAGGGGGGAGGGTGCTGG - Intergenic
924445339 1:244124662-244124684 CAGGTCATGGAGCAGGCAGGAGG + Intergenic
1062974403 10:1672708-1672730 CGGTGCGTGGAGGAGGCAGGCGG - Intronic
1063303641 10:4876611-4876633 CAGGGCATGGTGGTGGCAGCAGG - Intergenic
1063461734 10:6219180-6219202 CCGTGCCGGGAGGAGGCTGCTGG - Intronic
1064343387 10:14507441-14507463 TTGTGCATCGGGGAGGCAGCAGG + Intergenic
1065867005 10:29923057-29923079 TATTGCTTGGAGGTGGCAGCTGG - Intergenic
1066518457 10:36189764-36189786 GAGAGCATGGAGGAGGCCTCAGG + Intergenic
1067032152 10:42885318-42885340 CGCTTCCTGGAGGAGGCAGCTGG - Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067987891 10:51171388-51171410 AAGTGAATGGAGGAGGCTGGTGG + Intronic
1069604755 10:69732180-69732202 CAGTGCATGCAGGAAGAAGGAGG + Intergenic
1069753130 10:70757621-70757643 CAGTGCATGCAGGTGGTAGTAGG + Intronic
1069771739 10:70904815-70904837 CAGGGAGTGGAGGAGGAAGCTGG + Intergenic
1069778567 10:70940972-70940994 CAGGGCTGGGAGGAGGGAGCAGG - Intergenic
1069960129 10:72074681-72074703 CAGTGAGAGAAGGAGGCAGCAGG + Intronic
1070312775 10:75285831-75285853 GTGTCCATGGAGGAGACAGCAGG + Intergenic
1070776186 10:79111226-79111248 CAGGGCAGGGAGGAGACAGTTGG + Intronic
1070856196 10:79609935-79609957 CAGTGCAGGGTGGGGGCAGGTGG - Intergenic
1072616995 10:97056639-97056661 CTATGCATGGAGGAGGCAGTCGG - Intronic
1073054353 10:100689501-100689523 GAGTGGATGCAGGAAGCAGCAGG - Intergenic
1073118813 10:101108698-101108720 CAGGGGATGGAGGAGGCAATGGG + Intronic
1073179331 10:101574472-101574494 GTGTCCATGGAGGAGGCCGCAGG - Intronic
1074104786 10:110381242-110381264 CAGAGCATGCAGTAGGCACCTGG + Intergenic
1074284210 10:112082656-112082678 GTGTGCATGGAGCAGGGAGCGGG - Intergenic
1075062489 10:119266631-119266653 CTGTGGCTGGAGGAGGAAGCGGG + Intronic
1075207937 10:120462829-120462851 CACCGCAGGGTGGAGGCAGCAGG + Intronic
1075724495 10:124604521-124604543 AAGTGCCTGGAGGATGCAGCTGG - Intronic
1076080537 10:127576511-127576533 CTGTGCATCTTGGAGGCAGCAGG + Intergenic
1076236759 10:128869449-128869471 CGCTGGATGGAGGAGGCAGAGGG - Intergenic
1076409387 10:130234954-130234976 CAGACCCTGGAGAAGGCAGCTGG - Intergenic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076578631 10:131491402-131491424 CAGGGCATGGAGGATGCAAGGGG + Intergenic
1076865630 10:133164982-133165004 CAGAGCAGGGTGGAGGCTGCAGG + Intronic
1076984255 11:223825-223847 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1076984276 11:223897-223919 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1076984318 11:224041-224063 CTGTGCAGGGAGGAGGCTGGAGG - Intronic
1077047473 11:552801-552823 CAGAGCATGGCTGAGGAAGCAGG - Intronic
1077064832 11:636564-636586 GAGGGAATGGAGGAGGGAGCGGG + Intergenic
1077233631 11:1469597-1469619 TTGGGCATGGAGGAGGCAGCAGG + Intronic
1077244031 11:1527259-1527281 CAGAGCATGGAGACGGCAGTGGG - Intergenic
1079195730 11:18324862-18324884 CAGTGCAGGGAAGAGGCAGGAGG - Intronic
1079304408 11:19309705-19309727 CAAGGCATGGAGGAGGGAGGGGG - Intergenic
1081751429 11:45513921-45513943 CAGTGCCTGCAGGAGAAAGCTGG - Intergenic
1081812944 11:45923355-45923377 CAGTGTGCGGAGGGGGCAGCAGG - Intronic
1081864613 11:46352651-46352673 CTGTTCAAGGAGGAGGCAGAGGG - Intronic
1083596689 11:63920981-63921003 CCGTGCAAGGAGGCGGCAGAGGG + Intergenic
1083796536 11:65020145-65020167 CTGTTCATGGAAGAGGAAGCTGG + Intronic
1083851867 11:65372765-65372787 CAGTGCAGGAAGTAGGCAGGAGG - Intergenic
1084090990 11:66879278-66879300 CACTGCATAGGGGAGCCAGCAGG + Intronic
1084420622 11:69058769-69058791 CTTTGCAGGGAGGAGGCTGCGGG - Intronic
1084526316 11:69700691-69700713 GACTGAATGGAGGAGACAGCGGG - Intronic
1084693189 11:70738836-70738858 CAGTGCATGGACGTGGCTGGAGG - Intronic
1084717434 11:70882905-70882927 CAGGGCAGGCAGGAGGCAGGTGG + Intronic
1084792647 11:71484398-71484420 CAGCTCATGGAGGAAGCAGCAGG + Exonic
1084864580 11:72045299-72045321 CAGGGCCTGGAAGAAGCAGCAGG - Intronic
1085413469 11:76305611-76305633 CAGTGCAAGGAGGAGGCACTTGG - Intergenic
1086157341 11:83682178-83682200 CAAAGCAGGGAGGAGGCAGGAGG + Intronic
1086960191 11:92973337-92973359 CAGTGGCTGGGGGAGGGAGCAGG - Intronic
1088119150 11:106347634-106347656 CAGAGGCTGGAGGAGGCAGGTGG - Intergenic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089630373 11:119780471-119780493 CAGAGCCAGGCGGAGGCAGCAGG - Intergenic
1089662467 11:119994335-119994357 TATTGCAAGGAGAAGGCAGCAGG + Intergenic
1089969065 11:122677931-122677953 CTGGGCATGGAGGTGGGAGCTGG - Intronic
1090568571 11:128022242-128022264 CAGTGCATAAGGCAGGCAGCAGG - Intergenic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1092140733 12:6181795-6181817 CAGGGCATGGGGAAGCCAGCAGG + Intergenic
1096677235 12:53232322-53232344 CAGGGCACAGAGGAGGGAGCCGG - Intronic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097167368 12:57093089-57093111 CAGGGCCTGGGGGAGGCTGCTGG - Exonic
1098416925 12:70244127-70244149 CTGTGCATGGTGGAGGGAGAAGG + Intronic
1098998862 12:77153064-77153086 CAGTGTATGGGGGAGGGAGAAGG + Intergenic
1099068985 12:78021841-78021863 CAGTGCCTGGAGGAGATATCTGG + Exonic
1099467526 12:83005682-83005704 CTGTGCTTGGTGGAGGCAGGGGG + Intronic
1099824397 12:87756401-87756423 CACTGCCTGGAGGACCCAGCTGG + Intergenic
1099953366 12:89328414-89328436 CAGAAGCTGGAGGAGGCAGCTGG - Intergenic
1100547745 12:95619510-95619532 CATTGCAAGGCGGAGGCAGGTGG - Intergenic
1100990184 12:100243604-100243626 CAGGCCCTGGAGGAGGCAGGAGG - Intronic
1101329514 12:103746137-103746159 CAGTGCATGCAGGCAGCAGGAGG - Intronic
1101565725 12:105903064-105903086 CAGCGCATGGAGGAGAGAGCAGG + Intergenic
1101582793 12:106058605-106058627 CAGTTCATTTTGGAGGCAGCTGG - Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1102816215 12:115868511-115868533 CAGTTCATGCTGGAAGCAGCTGG + Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1102888388 12:116538798-116538820 TAGAGCATGGAGGAGGGAGGTGG - Intergenic
1102899661 12:116626477-116626499 GAATGACTGGAGGAGGCAGCAGG - Intergenic
1103007080 12:117429842-117429864 CACTTCATGGAGCAGGCGGCAGG + Intronic
1103413193 12:120726983-120727005 GAGTGGAAGGAGGAGGCAGGAGG - Intronic
1103527885 12:121579688-121579710 CGGTGGAGGGAGGAGGCAGGGGG - Intronic
1103939789 12:124495487-124495509 CAGTGGATGGAGGAGGGTCCAGG - Intronic
1104595951 12:130120108-130120130 CGGTGCAGGGAGGGCGCAGCTGG - Intergenic
1104607109 12:130198243-130198265 CAGTGCAGGGAGGAAGATGCTGG + Intergenic
1104991296 12:132625224-132625246 CAGGGCCTGGAGGAGGCCTCAGG - Intronic
1105210123 13:18252668-18252690 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1106183369 13:27386951-27386973 GACTGGAGGGAGGAGGCAGCTGG + Intergenic
1106558261 13:30828469-30828491 CAGCACATGGAGGAAGCACCAGG - Intergenic
1106600855 13:31185465-31185487 GACTGCCTGGGGGAGGCAGCTGG - Intergenic
1107882283 13:44843245-44843267 CAGAGCAGGAAGGAGCCAGCGGG + Intergenic
1108731406 13:53239294-53239316 CACTGAATGGAGGAAGCATCTGG - Intergenic
1110770428 13:79337216-79337238 CAGTTCATGGCCGAGGCAGGGGG - Exonic
1112091569 13:96089977-96089999 CGGGGCTCGGAGGAGGCAGCTGG - Intergenic
1113514842 13:110886184-110886206 CAGCCCAGGGAAGAGGCAGCGGG + Intronic
1114447150 14:22797638-22797660 GAGTGCATGGAGGCTGCTGCTGG + Intronic
1115028124 14:28766414-28766436 CAGTACAATGAGGAGGAAGCCGG + Intergenic
1116085805 14:40236535-40236557 CTGTGCATGGAGGGAGCAGTTGG - Intergenic
1117487999 14:56217817-56217839 CACTGTATGGAGCAGGCAGAAGG - Intronic
1117980075 14:61334143-61334165 CAGTGTGTGGTGGAGGCAGCAGG + Intronic
1118640648 14:67789228-67789250 CAGTTATTGGAGGAGGCAGATGG - Intronic
1118915455 14:70099087-70099109 AAGGGCCTGGAAGAGGCAGCAGG - Intronic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1119778147 14:77260760-77260782 CTGCGCAGGGAGGAAGCAGCGGG + Intergenic
1119778845 14:77265117-77265139 CAGAGCATGGAGGAGCATGCAGG + Intergenic
1119829259 14:77686479-77686501 TAGTGCCTGGAGAAGGCAGCAGG - Intronic
1122113718 14:99517670-99517692 CAGGGCTGGGAGGTGGCAGCTGG - Intronic
1122124383 14:99571156-99571178 CAGTGCAGTGAGGGGCCAGCCGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1124341735 15:28894347-28894369 GAGGGCATGGAGGGGGCTGCTGG + Intronic
1124941801 15:34225179-34225201 GCGGGCCTGGAGGAGGCAGCAGG + Exonic
1124945621 15:34262780-34262802 CACTGCTTGGAGCAGCCAGCTGG + Intronic
1126143233 15:45454555-45454577 CAGGGTGTGGAGGAGGCAGCGGG + Intergenic
1126549313 15:49909193-49909215 CAGTGGATGGTGGATGGAGCAGG - Intronic
1127178129 15:56383105-56383127 CCATGCATGGAGGAAGCATCTGG - Intronic
1129054956 15:72812676-72812698 CAGAGCATGGAAGAAGAAGCAGG - Intergenic
1129198940 15:73987156-73987178 CAGTGAAGGGCTGAGGCAGCTGG + Intronic
1129302878 15:74636371-74636393 CTGACCATGGCGGAGGCAGCAGG + Intronic
1129522211 15:76192997-76193019 CAGGGCAGTGAGGACGCAGCCGG + Intronic
1130071817 15:80653418-80653440 CAGAGGATGGAGGAGGTAGGTGG - Intergenic
1130959140 15:88648229-88648251 GAATGCATGGTAGAGGCAGCAGG + Intronic
1131833807 15:96370525-96370547 CAGTGCAGTGAGGTGGGAGCCGG - Intergenic
1132090091 15:98941065-98941087 CAGTGCAGGGGGGAGCCAGGTGG + Intronic
1132356197 15:101173243-101173265 TAGTGAATGGAGGTGGCTGCAGG + Intergenic
1132777570 16:1604208-1604230 CAGTATATGGAGGAGCCTGCTGG + Intronic
1132989633 16:2786116-2786138 CAGCTCCTGGAGGAGGAAGCAGG + Exonic
1133162702 16:3922509-3922531 CAGGGCAGGGAGGAAGCCGCTGG + Intergenic
1133225514 16:4338620-4338642 CAGTGGCTGGAGGAGGGTGCTGG + Exonic
1133437768 16:5794629-5794651 CTGTGGATGGGGGATGCAGCTGG + Intergenic
1133933308 16:10249718-10249740 CAGGACATGCAGGGGGCAGCTGG - Intergenic
1134840721 16:17399433-17399455 CAGTGTAATGAGGAGGGAGCAGG - Intronic
1138240668 16:55424689-55424711 CTGTGCATGGAGGAGGGGTCAGG + Intronic
1138454935 16:57115764-57115786 CAGTGCAGGGAGGGGGCTGCTGG - Intronic
1139172488 16:64648410-64648432 CAGTAGCTGGGGGAGGCAGCTGG - Intergenic
1139671836 16:68497491-68497513 CAGAGCAGAAAGGAGGCAGCAGG - Intergenic
1140801485 16:78492202-78492224 CAGTTTATGGAGGATGAAGCGGG + Intronic
1141099270 16:81185202-81185224 CAGGGCAGGGAAGGGGCAGCTGG - Intergenic
1141377058 16:83541114-83541136 CAGAGGCTGGAGGTGGCAGCTGG - Intronic
1141439814 16:84022779-84022801 CAGTGAATAGATGAGGCAGCAGG + Exonic
1141462348 16:84184956-84184978 CAATGCAGGGCGGAGGGAGCTGG + Exonic
1141777673 16:86135028-86135050 GGGTGCAGGGAGGAGGCAGGTGG - Intergenic
1141920895 16:87134652-87134674 CAGTGCATGGACACGGCAGGCGG - Intronic
1141985152 16:87575170-87575192 CAGTGCAGGGAGGAGGGAGCAGG - Intergenic
1142223061 16:88864754-88864776 CTGTGCAGAGAGGAGCCAGCTGG + Intronic
1142240742 16:88943745-88943767 CAGTTCTTGGATAAGGCAGCAGG - Intronic
1142264411 16:89057204-89057226 CACTTCACGCAGGAGGCAGCAGG + Intergenic
1142429098 16:90016787-90016809 CAGAGCATCGAGGAGGCACTTGG + Intronic
1142941748 17:3385881-3385903 GAGGGGAGGGAGGAGGCAGCCGG - Intergenic
1143474303 17:7194043-7194065 CAGAGCATGGGGGTGGCAGGGGG - Intronic
1143740991 17:8953879-8953901 CAGTCCTTGGAGGAGGCAGAGGG + Intronic
1143995527 17:11003389-11003411 CACTCCATGGAAGGGGCAGCAGG + Intergenic
1144295343 17:13870005-13870027 CAGTCCCTGGAGGAGGGAGTGGG - Intergenic
1145255146 17:21318263-21318285 CAGCGCAGGCAGCAGGCAGCAGG + Intergenic
1145321460 17:21769692-21769714 CAGCGCAGGCAGCAGGCAGCAGG - Intergenic
1146371626 17:32268127-32268149 CAGAGTAGGGAGGAGGCAGGAGG - Intronic
1146563146 17:33888910-33888932 CATTGCATGGGGGAAGCAGAGGG + Intronic
1146969616 17:37062147-37062169 CAGGGCGTGGAGGAGCCAGGAGG + Intergenic
1147165689 17:38592054-38592076 CAGGGCAGGGAGGAGGAAGTAGG - Intronic
1147449626 17:40496056-40496078 CAGTCCCTGGGGGAAGCAGCTGG + Exonic
1148125783 17:45236108-45236130 CGGGGTGTGGAGGAGGCAGCAGG - Intronic
1148211795 17:45813214-45813236 AAGGGCAGGGAGGAGGCAGCAGG - Intronic
1148743963 17:49908211-49908233 AAGTGGATGGAGGAAGCTGCAGG + Intergenic
1148795583 17:50195192-50195214 CAGTGCATGGGGTGGGCAGAAGG + Intronic
1148806666 17:50267289-50267311 CAGAGCCTGGGGGAGGAAGCTGG - Intergenic
1148866145 17:50629722-50629744 GAGTGGATGGTGGGGGCAGCAGG + Intergenic
1149521999 17:57324464-57324486 CAGTTCCTGAAGGAGCCAGCAGG + Intronic
1151817440 17:76478240-76478262 CAGTGCTTTGAGGGGGCAGCAGG - Intronic
1151915008 17:77111482-77111504 CAGTGCAAGCAGCCGGCAGCCGG + Intronic
1151970553 17:77455391-77455413 CAGAGCAGGGCGGGGGCAGCAGG - Intronic
1152305475 17:79517943-79517965 AAGTGCAGACAGGAGGCAGCCGG + Intergenic
1152784210 17:82239623-82239645 CGCTGCATGGAGGGGGCTGCGGG + Exonic
1154334110 18:13452324-13452346 CAGCGCTTGGAGGATGCAGCGGG + Intronic
1155108449 18:22689900-22689922 CACTGCAGGGAGCAGGAAGCAGG + Intergenic
1155171143 18:23267586-23267608 CAGTGCAGGGAGTGGGCAGCCGG - Intronic
1155187661 18:23401637-23401659 CAGGGCATTGAGGAGGAAGGAGG + Intronic
1155592040 18:27438506-27438528 GTGAGCATGGAGGAGGCAGAAGG + Intergenic
1157737130 18:50059688-50059710 CAGAGCGGGGAGGTGGCAGCTGG - Intronic
1157895304 18:51460886-51460908 AAGTTCATGAAGGAGGCAGAAGG - Intergenic
1157905296 18:51564174-51564196 CTGGGCAAGGAGGAGGCTGCAGG + Intergenic
1158212204 18:55064533-55064555 CCTTGCCTGGAGGATGCAGCAGG - Intergenic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1158756540 18:60332188-60332210 CAGTGCCTGGACGTGGCAGGGGG - Intergenic
1159833412 18:73306307-73306329 CAGTGACTCGGGGAGGCAGCTGG - Intergenic
1160008930 18:75089094-75089116 CAGCGGCAGGAGGAGGCAGCTGG + Intergenic
1160106770 18:75985107-75985129 CAGGGCATGGAGGAGGGCACTGG + Intergenic
1160148971 18:76385048-76385070 ACGTGCCAGGAGGAGGCAGCCGG + Intronic
1160167829 18:76529586-76529608 GAGTGCAGGAAGGTGGCAGCGGG - Intergenic
1160381203 18:78457413-78457435 CACGGCATGGAGGAAGGAGCAGG - Intergenic
1160803094 19:979591-979613 CACTGCCTGGAGGAGCCCGCCGG + Intergenic
1160847233 19:1171998-1172020 CAGAGCACAGAAGAGGCAGCAGG - Intronic
1160912472 19:1481324-1481346 CAGTCCATGGAGAATGCAGCCGG - Intergenic
1161102536 19:2428365-2428387 CAGGGCTTGGAAGAGGCTGCAGG + Exonic
1163033830 19:14560663-14560685 CAGTGCCTGGAGTTGACAGCAGG + Intronic
1163353599 19:16795272-16795294 CAGTGCTTGAAGCAGCCAGCTGG - Intronic
1163692490 19:18745237-18745259 GAGTGCCTGGAGGAGGCTGCGGG + Intronic
1164591314 19:29508983-29509005 CAGGGCATGGGAGAGGCAACAGG + Intergenic
1164976883 19:32580422-32580444 TTGTGCGTGGAGGAGGCAGATGG + Intergenic
1165065818 19:33227078-33227100 CAGGGCCTGGAGGTGGGAGCGGG + Intergenic
1165336365 19:35172885-35172907 CAGCGCTGGGAGGAGACAGCTGG - Intergenic
1165762070 19:38327268-38327290 CAGGGCACGGAGGGGGCAGCAGG - Exonic
1166131695 19:40749614-40749636 CAGCGGGTGGAGGAGGCAGTGGG + Exonic
1166266468 19:41687680-41687702 CAGTGCCTGGAACAGGCTGCAGG + Intronic
1166534021 19:43560749-43560771 CAGTGTACGGAGGAGACAGAAGG - Intronic
1166839382 19:45687395-45687417 GAGGGCTTGGGGGAGGCAGCTGG - Intergenic
1167041060 19:47022596-47022618 CGGGGCATGGAGGAGGGGGCGGG + Intronic
1167267422 19:48490671-48490693 CAGAGCAGGGAGGACACAGCTGG - Intronic
1167321393 19:48799201-48799223 CAGGGCAGGAAGGAGACAGCTGG - Intronic
1167561453 19:50228471-50228493 CAGGGCATGAAGCAGCCAGCCGG + Intronic
1167648547 19:50718308-50718330 CGGGGCAGGGAGGAGGCAGCCGG - Intronic
1167740411 19:51321864-51321886 CAGTGCATGTGTGTGGCAGCGGG + Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168651552 19:58095595-58095617 CTGAGCATGGTGGAGGCATCGGG + Intronic
1202694422 1_KI270712v1_random:114006-114028 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
924996577 2:366964-366986 AAGTGCACAGAGGTGGCAGCCGG - Intergenic
925130091 2:1488519-1488541 CAGGTCAGGGAGGAGGCTGCCGG - Intronic
925296257 2:2779596-2779618 CTGTGCAAGCAGGAGGCAGGGGG - Intergenic
925326194 2:3023810-3023832 CAAAAGATGGAGGAGGCAGCGGG + Intergenic
925371565 2:3349318-3349340 GAGTGGCTGGAGGAGGCAGCTGG - Intronic
926123561 2:10257642-10257664 GAGTGCAGGGAGGAGGCACAAGG + Intergenic
926620112 2:15039848-15039870 CAGAGCTTGGAGGAGGCACCAGG - Intergenic
927844188 2:26462957-26462979 GAGTGCCTGGAAGAGGCAGGAGG - Intronic
929022073 2:37563291-37563313 CAGGGAATGGAGGTGGCAGGAGG + Intergenic
929595062 2:43170572-43170594 CCGTGCCAGGAGGTGGCAGCAGG + Intergenic
931553190 2:63469933-63469955 CACTGCATGGAGGAGCATGCAGG - Intronic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932419018 2:71590557-71590579 CAGGTCAGGGAGGAGGCTGCAGG - Intronic
932570388 2:72935460-72935482 CAGGGGGTGGAGCAGGCAGCTGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
933951908 2:87338348-87338370 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
933952139 2:87340558-87340580 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934134150 2:88979124-88979146 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934139087 2:89027824-89027846 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934145158 2:89085831-89085853 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934224094 2:90114724-90114746 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934236150 2:90234682-90234704 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934236383 2:90236896-90236918 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934491050 2:94762253-94762275 CAGTGCATTGAGGGTGCACCTGG - Intergenic
934695857 2:96399772-96399794 CAGTGGAGGATGGAGGCAGCAGG - Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
935698021 2:105786764-105786786 CAATGCGTGGGGGAGGCAGAAGG - Intronic
935793003 2:106611398-106611420 GAGTGCTTGGTGGAGGTAGCAGG + Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
937252618 2:120534120-120534142 CAGGGCTGGGAGCAGGCAGCTGG - Intergenic
937784049 2:125874341-125874363 CAGAGCTGGGAGGAGGCAGACGG + Intergenic
938757949 2:134397786-134397808 CAGTTCATGCAGGAGGGGGCTGG + Intronic
939570414 2:143833651-143833673 CAGTTGGTGGAGGAGGCAGAGGG - Intergenic
940441185 2:153718627-153718649 CAGTGACATGAGGAGGCAGCAGG + Intergenic
940460968 2:153962365-153962387 CAGTACATGGAGGACTCAGCAGG + Intronic
944206747 2:197164738-197164760 GAATGCATGGAGGAGGCTGAGGG - Intronic
945967381 2:216203183-216203205 GAGTGCATGGAGCAGGCACGCGG - Intronic
946394084 2:219434742-219434764 CCGTGGAGGGAGGGGGCAGCAGG - Intergenic
946880216 2:224170124-224170146 CAGTGGATGAATGAGGAAGCAGG - Intergenic
947053644 2:226075557-226075579 CAGTGCCTGGAGCAGCCAGCTGG + Intergenic
947462841 2:230318034-230318056 CAGAGCAGGAAGGAGGCAGAGGG + Intergenic
947635894 2:231680740-231680762 CAGTTAGTGGAGGAGGCCGCAGG - Intergenic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948109824 2:235445479-235445501 CAGAGCATGGAGGAAACAGGTGG - Intergenic
948161857 2:235831091-235831113 CAGTGCAGAGAGCAGCCAGCAGG - Intronic
948650345 2:239439866-239439888 CTGTAGATGCAGGAGGCAGCTGG + Intergenic
948754923 2:240153979-240154001 AAGTCCATAGAGCAGGCAGCAGG + Intergenic
948781513 2:240324479-240324501 CAGGGCCTGGAGGAGGCAGAAGG - Intergenic
948882929 2:240869506-240869528 CACCGCCTGGAGGAGGCAGTGGG - Intronic
1168853023 20:989565-989587 CAGTGCATGGTGGGGGTGGCAGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170508517 20:17053985-17054007 AAGTACATGTAGGAGGTAGCTGG + Intergenic
1170945970 20:20891218-20891240 CAGTGAATTAAGGAGGCATCAGG - Intergenic
1171291271 20:23984358-23984380 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1172093335 20:32448505-32448527 CAGTGGATGGAGGAAGGGGCTGG + Intronic
1172408350 20:34705117-34705139 CAGTGCATGGAAGGGGCAACAGG + Intronic
1172477375 20:35248976-35248998 TGGTGAAAGGAGGAGGCAGCGGG + Intronic
1172690122 20:36784308-36784330 TGGGGCATGGAGGAGGCGGCTGG + Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173846273 20:46190760-46190782 CAGTTCAAGGAGGAAGCACCGGG - Intronic
1173849398 20:46208343-46208365 CAGAGCAGGGATGGGGCAGCTGG - Intronic
1173869581 20:46332914-46332936 CAGAGCATGAGGGAGGCATCGGG + Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1175063251 20:56263156-56263178 CTGGGCTTGGGGGAGGCAGCAGG + Intergenic
1175205954 20:57311268-57311290 CATTGCCGGGAGGTGGCAGCTGG + Intergenic
1175335775 20:58195322-58195344 CAGGCGATGGAGGAGGAAGCTGG + Intergenic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1176168539 20:63686815-63686837 CAGTGCGTGCCTGAGGCAGCCGG + Intronic
1176249709 20:64114684-64114706 CAGTGCTGGGAGGTGGCACCTGG + Intergenic
1178407250 21:32334988-32335010 CAGTGGATGGGGGAGGGAGGAGG - Intronic
1179884747 21:44309071-44309093 CTGAGCTTGGAGGAGGCAGAGGG + Intronic
1180188570 21:46152031-46152053 CAGTTCCTGGAGGACGCAGGTGG + Intronic
1180234274 21:46447939-46447961 CAGGTCAGGGAGGCGGCAGCAGG - Intergenic
1180766134 22:18346736-18346758 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1180780179 22:18515642-18515664 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1180812895 22:18772963-18772985 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1180935916 22:19625419-19625441 TAGTGTATGGAGGCGGCAGCAGG + Intergenic
1180954015 22:19733402-19733424 CAGTGCGGGGAGGAGGGAGCTGG - Intergenic
1181199073 22:21207279-21207301 CTGTGCACAGAGGAGGGAGCAGG + Intergenic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181400689 22:22648577-22648599 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1181513253 22:23398163-23398185 CAGAGGACGGAGGAGGCAACAGG + Intergenic
1181648700 22:24247311-24247333 CTGTGCCTGGAGGAGGGAGCAGG + Intergenic
1181702669 22:24629675-24629697 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
1182015886 22:27039344-27039366 GAGGGCATGGTGGAGGCTGCAGG + Intergenic
1182037973 22:27214247-27214269 GAGGGGACGGAGGAGGCAGCCGG - Intergenic
1182103102 22:27671150-27671172 GAGATCATGCAGGAGGCAGCTGG + Intergenic
1182186306 22:28406138-28406160 CAGTGAATGGAAGAGGTAACTGG - Intronic
1182459213 22:30472195-30472217 CCCTGCCAGGAGGAGGCAGCTGG + Intergenic
1182473755 22:30564596-30564618 CAGTGCAGGCAGCTGGCAGCAGG + Intronic
1182696567 22:32202845-32202867 CTGTGGGTGGAGGAGGCATCAGG - Exonic
1182709305 22:32310635-32310657 CACTGCCTGGAGGAGACAGCTGG + Intergenic
1182790818 22:32951343-32951365 CTTTGCAGGGAGGATGCAGCTGG - Intronic
1183068521 22:35380341-35380363 CAGAGTGTGGAGGAGGCAGGCGG + Intronic
1183394639 22:37564416-37564438 TCACGCATGGAGGAGGCAGCTGG + Intronic
1183440303 22:37819104-37819126 GAGTGGATGGAGGTGGCACCGGG + Intergenic
1184048475 22:41987372-41987394 CAGAGCATGGAGGGTGCAGATGG - Intronic
1184165361 22:42724136-42724158 CAGGGCGTGAAGGAGGAAGCAGG + Intergenic
1184218204 22:43081334-43081356 CAGTGCATGACGGAGGGAGTGGG + Intronic
1184258917 22:43303345-43303367 CAGGGCATGGATGGGGCAGGAGG - Intronic
1184396889 22:44247551-44247573 CACTGCCTGGAGGAGACAGCTGG + Exonic
1184406351 22:44302917-44302939 GGGTGCAGTGAGGAGGCAGCAGG + Intronic
1184640798 22:45868972-45868994 CACTGCAGGAAGGAGGCTGCAGG - Intergenic
1185202967 22:49519520-49519542 CAGTGCACGCAGTTGGCAGCCGG - Intronic
1185337043 22:50275348-50275370 TAGGGCATGGAGGCGGCTGCTGG + Exonic
1185338801 22:50282648-50282670 AAGGGCACTGAGGAGGCAGCTGG + Intronic
1185366075 22:50437447-50437469 CCGGTCATGGAGGAGGCATCAGG - Intronic
1203227752 22_KI270731v1_random:87627-87649 CTGTGCACAGAGGAGGGAGCAGG - Intergenic
950311336 3:11960972-11960994 CAGAGAACGGAGGAGGCAGGAGG + Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
951538998 3:23764792-23764814 CATTCCATGGAGGAGGAAGTCGG - Intergenic
951584470 3:24201329-24201351 TTGAGCATGGAGGAGGCAGGGGG - Intronic
952646458 3:35664756-35664778 AAGTGCCTGGAGGAGGCAGAAGG + Intronic
952828636 3:37544996-37545018 CTGTCCACAGAGGAGGCAGCAGG + Intronic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
952990881 3:38829690-38829712 CAGCGCATGGGGCTGGCAGCTGG + Intergenic
953999254 3:47543006-47543028 CAGCGAAGGGAGGAGGGAGCCGG + Intergenic
954257182 3:49415022-49415044 CAGTGCCTGGGTGAGGGAGCAGG - Exonic
954410374 3:50367985-50368007 CAGGTCATGGAGGAGGCTCCTGG - Intronic
955978540 3:64501155-64501177 GACTTCATGGAGGAGGTAGCAGG - Intergenic
956779444 3:72592619-72592641 CAGGGGATGGAGGAGACAGCTGG + Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
960618797 3:119619940-119619962 GAGTGCAGAAAGGAGGCAGCCGG - Intronic
960665101 3:120101164-120101186 CAGGGCATGGCTGAGGCAGGAGG - Intergenic
961067072 3:123884489-123884511 CAGTGCATGGGGGCTGGAGCGGG - Intergenic
961140515 3:124551888-124551910 AAGTGCATGGATGAGGAGGCTGG + Intronic
961450489 3:127000218-127000240 CAGAGCAAGGAGGTGACAGCTGG + Intronic
961534535 3:127561760-127561782 GAGTCCATGGAACAGGCAGCAGG - Intergenic
961736925 3:129008087-129008109 CAGGGCCTGGTGGAGGCAGATGG - Intronic
961737959 3:129014165-129014187 CTGGGCATGAGGGAGGCAGCTGG + Intronic
961746036 3:129064068-129064090 CGCTGCATGGAGGAGGGTGCAGG + Intergenic
962411336 3:135143949-135143971 CTGTGCCTGGAGGAGGAGGCAGG - Intronic
962448677 3:135492931-135492953 GAGAGCATGGCAGAGGCAGCTGG - Intergenic
963540906 3:146587103-146587125 TAGTGCATAGAGGAAGCACCTGG + Intronic
963733182 3:148991832-148991854 GAGTGCAGGGATGGGGCAGCCGG + Intronic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
964571077 3:158107296-158107318 CTGTCCATAGAGGAGTCAGCTGG - Intronic
967041034 3:185692279-185692301 CAGTGCATGGAGGAAGCTCTAGG + Intronic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
968228844 3:196992506-196992528 TAGTGGATGGAGGAGGCTGGAGG + Intronic
968661285 4:1799853-1799875 CAGGGCTTGGCGGTGGCAGCGGG - Intronic
968826955 4:2905650-2905672 CAGTCCATGCAGAGGGCAGCTGG - Intronic
968909927 4:3472564-3472586 CTGTGAATGGCGGGGGCAGCAGG - Intronic
968931491 4:3581793-3581815 GAGAGCCTGGAGGAGGCAGCTGG - Intronic
968973995 4:3811639-3811661 CAGTGCAGGGAGGGGGGTGCTGG + Intergenic
969436969 4:7193943-7193965 TGGTGCATGCAGGAGGCAGAGGG + Intronic
969618509 4:8267338-8267360 CAGTGCAGGGCGGGAGCAGCAGG + Intergenic
970004424 4:11396918-11396940 CTGTGGATGCAAGAGGCAGCGGG - Exonic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
972122739 4:35725843-35725865 CAGTGCCTGGAGGAGTTAGCAGG - Intergenic
975643558 4:76524578-76524600 GTGTGCCTGGAGGATGCAGCAGG - Intronic
975947337 4:79723723-79723745 CAGTGCTTTGAGGCGCCAGCAGG + Intergenic
977809654 4:101345856-101345878 CAGGGCACGGAGGAAGCAGGCGG + Intronic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
982260258 4:153488437-153488459 CAGGGCCCAGAGGAGGCAGCCGG + Intronic
982324849 4:154119742-154119764 CATTGTATGGAGGAGAAAGCTGG + Intergenic
983519937 4:168697580-168697602 CAGTCCATGGAGGGGAGAGCAGG - Intronic
984756239 4:183328133-183328155 TAGGCCATGGAGGAGGCAGAAGG + Intergenic
985524657 5:395883-395905 CACTGCATGGAGGAAGCTGGAGG - Intronic
986600469 5:9467714-9467736 CTGTGCCTGGAGGTGGGAGCCGG + Intronic
988526690 5:31993311-31993333 CAGGGGATGGAGGAGACAGTTGG + Intronic
990616710 5:57516193-57516215 AATTTCATGGAGGAGGAAGCAGG + Intergenic
993648336 5:90486697-90486719 CAGTGCATGGAGGATGGAGGTGG - Intronic
996107620 5:119522930-119522952 CAGTGCATGGAAGAGGGAAAAGG - Intronic
996459434 5:123724819-123724841 CTGTGCATGGAGGGAGCATCTGG + Intergenic
997661831 5:135595094-135595116 CAGTCCCTGGTGGAGGCAGGTGG + Intergenic
997691529 5:135830714-135830736 CAGTGCAGGAATGATGCAGCTGG + Intergenic
997801239 5:136864762-136864784 CAGTGGAGGGAGGAGGCTGATGG + Intergenic
998038775 5:138937721-138937743 GAGTGCAGGGAGTAGGGAGCAGG - Intergenic
998353107 5:141513781-141513803 CAGTGCTTCGAGGAGGCAGGCGG - Intergenic
998894805 5:146788086-146788108 AACGGCATGGAGGAGGCAGAGGG - Intronic
1001315096 5:170636345-170636367 CAGTGGAGGCAGGAGGCAGAAGG + Intronic
1001397279 5:171426418-171426440 CAGTGCATGGAGGGGAGGGCTGG + Intronic
1001699134 5:173694164-173694186 CAGTGCATGGAGGAGGACTCAGG - Intergenic
1001952788 5:175827864-175827886 CAGGGCACGCAGGAGGCAGATGG - Intronic
1002431980 5:179209014-179209036 CCCTGCCTGGAAGAGGCAGCAGG - Intronic
1002842774 6:920801-920823 CAGTGGATGGGGGAGCCAGAAGG - Intergenic
1003459612 6:6318097-6318119 CAATGGATGGAGGAGGGAGGAGG + Intronic
1003880104 6:10472353-10472375 CAGAGCATGAAAGAGGCTGCAGG + Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1006635867 6:35460704-35460726 CAGTGCATGGAGGGTCAAGCAGG + Intronic
1007124805 6:39417006-39417028 CAGTGAATCTAGGAGGCAGGAGG - Intronic
1007416056 6:41691888-41691910 AAGTGCCTGGAGGATGTAGCCGG - Intronic
1007593104 6:43035309-43035331 CAGCCCATGGAGGAGGCCTCGGG + Intergenic
1007905984 6:45461207-45461229 CAGTTAATGGAGCAGGCAGTAGG + Intronic
1010824730 6:80458427-80458449 TAGTGGATGGAAGAAGCAGCAGG + Intergenic
1012497967 6:99855741-99855763 CAGTGGTAGCAGGAGGCAGCGGG - Intergenic
1013417060 6:109934478-109934500 CAGTGGATGCAGGAGGCACCCGG + Intergenic
1013796952 6:113898849-113898871 GAGTCCATAGAGCAGGCAGCTGG - Intergenic
1014155140 6:118101243-118101265 CTCTGCATGGTGGAGGCTGCTGG + Intronic
1014429439 6:121349887-121349909 AAGGGCTTGGAGGAGGCAGGAGG - Intergenic
1014755851 6:125301658-125301680 CGGTGGACGGAGGAAGCAGCCGG - Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017852202 6:158314490-158314512 CAGTGCAGGGAGAGGACAGCAGG - Intronic
1018095923 6:160386959-160386981 CAGTGCTTGGAGCAGGGATCTGG - Intronic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1019571956 7:1717028-1717050 CAGAGCATGCAGGAGGGAGGAGG + Intronic
1020607474 7:10356925-10356947 CAGTGCATGGAGGGAGCATTTGG - Intergenic
1020999624 7:15312527-15312549 CAGTGCATGGCGGGGGCGGTGGG + Intronic
1023027456 7:36063628-36063650 CTGTGGATGGAGCAGGAAGCAGG + Intergenic
1023366394 7:39468277-39468299 CCGTGCCCGGAGCAGGCAGCAGG + Intronic
1023868325 7:44249426-44249448 CAGTGCATGAAGGAGCTGGCTGG - Intronic
1024243495 7:47453062-47453084 CTGGGCATAAAGGAGGCAGCTGG + Intronic
1024854333 7:53760129-53760151 CAGTGGATGGGGAATGCAGCAGG + Intergenic
1025639803 7:63355207-63355229 CTGTGCAGGGCGGACGCAGCAGG + Intergenic
1025642896 7:63392885-63392907 CTGTGCAGGGCGGACGCAGCAGG - Intergenic
1025723765 7:64038972-64038994 CTCTGCAGGGAGGATGCAGCAGG + Intronic
1025752913 7:64308527-64308549 CTGTGCAGGGAGGATGCAGCAGG + Intronic
1026741327 7:72980523-72980545 CACTTCATGGAGGAGGGACCAGG - Intergenic
1026876036 7:73879624-73879646 AACAGCATGGAGGAGGCATCCGG - Intergenic
1027102407 7:75384555-75384577 CACTTCATGGAGGAGGGACCAGG + Intergenic
1028934376 7:96448871-96448893 CCATGCATGGATGAGGCATCTGG - Intergenic
1029488950 7:100860001-100860023 CAGGGCATGGAGGATGCGGGAGG - Exonic
1030347328 7:108449358-108449380 CAGTGAAGGGAGGGGGGAGCTGG - Intronic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1032402532 7:131633760-131633782 CAGTGCTTGGAGGAGGATGCTGG - Intergenic
1034015041 7:147573578-147573600 CAGGGCATGGAGGACAGAGCGGG + Intronic
1034091656 7:148369747-148369769 CATTGCCAGGAGGAGGCAGAAGG + Intronic
1034336225 7:150325207-150325229 CAATGCATGGAGGAGACTGTGGG - Intronic
1034418000 7:150975209-150975231 TCGGGCATGGAGGAGGCGGCGGG - Intronic
1034429900 7:151036036-151036058 CAGTGCATTCAGGAGGCAGCTGG - Intronic
1034432215 7:151046734-151046756 CAGTGCATTGATGGAGCAGCTGG + Intronic
1034753203 7:153590364-153590386 CAGTGCAGGGAAGAGCCTGCAGG - Intergenic
1035034689 7:155887103-155887125 CAGTCCCTGGAGGAGACACCAGG - Intergenic
1035100500 7:156392333-156392355 CATTCCAGGGAGGAGGAAGCTGG + Intergenic
1035102594 7:156413935-156413957 CAATGCATGGTGGAGGCATGAGG + Intergenic
1035242246 7:157539804-157539826 ACGTGCCTGGAGGAGCCAGCGGG + Exonic
1035690258 8:1555274-1555296 CACTGGATGGATGGGGCAGCTGG - Intronic
1035981365 8:4375732-4375754 CAGGGCATGGTGCAGGCAGTCGG - Intronic
1036615875 8:10387097-10387119 CCGTGCAGGCAGCAGGCAGCAGG - Intronic
1037919777 8:22797644-22797666 CAGTTGGTGGAGGAGGCTGCTGG + Intronic
1038554246 8:28494977-28494999 CAGCCCGCGGAGGAGGCAGCCGG - Intronic
1039853833 8:41395762-41395784 CAGTGCATGGAAGTTCCAGCAGG - Intergenic
1039904117 8:41773722-41773744 CAGTGCATGCAGGAGGGAGCGGG - Intronic
1041151848 8:54943577-54943599 CAGTGCTTGGAGTGGCCAGCTGG - Intergenic
1041456631 8:58067459-58067481 CAGTGGATGGAGGAGGAAGGAGG - Intronic
1042779616 8:72476137-72476159 CAGTGCACTGGAGAGGCAGCAGG - Intergenic
1044810223 8:96053074-96053096 CAGGGAATGGGGGAGGCAGGTGG + Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1048997786 8:139804825-139804847 CACTGCATGGAAGAGGCTGTGGG - Intronic
1049161877 8:141103108-141103130 CACAGCTTGGAGGTGGCAGCCGG + Intergenic
1049211025 8:141386443-141386465 CAGTGCAGAGAGGACGGAGCTGG + Intergenic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1049455591 8:142684717-142684739 CTGTCCTTTGAGGAGGCAGCAGG - Intergenic
1049513014 8:143039293-143039315 CCGTGCCGGGAGGAGGCTGCAGG - Exonic
1049614525 8:143570300-143570322 ACGTGCATGGAGCAGGCAGGAGG - Exonic
1050407592 9:5326579-5326601 CAGGGTATGGAGGAGCCAGGTGG + Intergenic
1050414598 9:5402636-5402658 CAGGGTATGGAGGAGCCAGGTGG + Intronic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1052534832 9:29733313-29733335 CAGTGCAAGGAGGATCCAGTGGG - Intergenic
1052727983 9:32253102-32253124 CAGTGGATTGAGGAGAAAGCTGG + Intergenic
1052740113 9:32384634-32384656 CGGAGCGTGGAGGCGGCAGCTGG + Exonic
1052785823 9:32827381-32827403 GAGTGCCTGGTGGAGGCACCTGG + Intergenic
1053277492 9:36794438-36794460 CAGTGTGTGGAGGAGGCAGGAGG - Intergenic
1053495256 9:38544594-38544616 CAGTGCATTGAGGGTGCACCTGG - Intronic
1053495427 9:38545297-38545319 CAGTGCATTGAGGGTGCACCTGG + Intronic
1053666934 9:40323428-40323450 CAGTGCATTGAGGGTGCACCTGG + Intronic
1053916526 9:42948537-42948559 CAGTGCATTGAGGGTGCACCTGG + Intergenic
1054378085 9:64463456-64463478 CAGTGCATTGAGGGTGCACCTGG + Intergenic
1054458638 9:65450136-65450158 GAGAGCCTGGAGGAGGCAGCTGG + Intergenic
1054517675 9:66052855-66052877 CAGTGCATTGAGGGTGCACCTGG - Intergenic
1055688687 9:78806890-78806912 CAGTGCATAGAAGATGAAGCAGG + Intergenic
1055737007 9:79341353-79341375 CAGTGCTTGGACCAGGAAGCAGG - Intergenic
1057215000 9:93223120-93223142 CAGAGAATGTTGGAGGCAGCAGG + Intronic
1057294813 9:93828680-93828702 CAGGTCAGGGAGGAGGCAGAGGG - Intergenic
1057359402 9:94359557-94359579 CAGTGCATGCAGTTGTCAGCTGG + Intergenic
1057648363 9:96898035-96898057 CAGTGCATGCAGTTGTCAGCTGG - Intergenic
1058308504 9:103471856-103471878 CAAGGGGTGGAGGAGGCAGCAGG - Intergenic
1058433035 9:104935942-104935964 AAGAGGATGGAGGAGGAAGCAGG - Intergenic
1059214738 9:112550591-112550613 CAGTGCAGGGAAAAGGCAGACGG + Intronic
1059524683 9:114979781-114979803 CAGTCCATGAATGAGGAAGCAGG - Intergenic
1060109283 9:120894834-120894856 CAGGGCACGTAGGAGGCATCCGG + Intronic
1061056487 9:128225465-128225487 CAGTGCATGGCCTGGGCAGCTGG + Intronic
1061995450 9:134180706-134180728 GCCTGCAGGGAGGAGGCAGCAGG - Intergenic
1061998580 9:134204095-134204117 CAGTCTATGGAGGAGGCAGGTGG - Intergenic
1062110314 9:134778663-134778685 CAGCACAGGGCGGAGGCAGCCGG - Intronic
1062270120 9:135704480-135704502 CATGGCATGGAGGTGGGAGCAGG - Intronic
1062426932 9:136510445-136510467 AAGTGCAGGGAGGAGCAAGCCGG + Intronic
1185449515 X:275082-275104 CAGTGAAGGGAGGAGGGAGGAGG + Intergenic
1185481021 X:446367-446389 CACAGCATGGCCGAGGCAGCAGG + Intergenic
1185512532 X:674148-674170 CAGTGAATAAAGGAGCCAGCTGG + Intergenic
1186496800 X:10017136-10017158 CTGTGCAGGTAGGAGGAAGCAGG - Intronic
1186498616 X:10032496-10032518 CAGGCCAAGGAGGAGGCAGTGGG + Intronic
1187165834 X:16803160-16803182 GGCTGCATGGTGGAGGCAGCGGG - Intronic
1187464586 X:19515591-19515613 CGCTGCCTGGAGGGGGCAGCAGG - Intergenic
1187688416 X:21839678-21839700 CGGTGCAGGGAGGAGGACGCCGG + Exonic
1188987766 X:36783136-36783158 CAGTGAGTGGAGGAAGCAGGCGG + Intergenic
1189074679 X:37903843-37903865 TACTTCATGGAGGAGGCAGGAGG - Intronic
1189215632 X:39320697-39320719 CAAAGCATGGATGAGGGAGCAGG + Intergenic
1189261360 X:39681051-39681073 CAGAGCATGGAGGGGGAAGAAGG - Intergenic
1190744759 X:53315906-53315928 CCCTTCATGGAGGTGGCAGCTGG - Intronic
1192212981 X:69139535-69139557 ACGTGTATGCAGGAGGCAGCAGG - Intergenic
1193485396 X:82080332-82080354 CAGTGCCTGGAGTGGCCAGCCGG - Intergenic
1195045545 X:101051678-101051700 CGGGGAATGGAGGAGGCAGGCGG - Exonic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1198111154 X:133503638-133503660 CAGTGGAGAGAGGAGGCATCAGG - Intergenic
1200063071 X:153492159-153492181 CAGGGCTGGGAGGAGGCAGGGGG - Intronic
1201788273 Y:17808899-17808921 CAGTGCATGGATGAGCCTGTTGG + Intergenic
1201813280 Y:18097089-18097111 CAGTGCATGGATGAGCCTGTTGG - Intergenic