ID: 952883323

View in Genome Browser
Species Human (GRCh38)
Location 3:37998616-37998638
Sequence CTGGGCGGTCCCGCTTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952883315_952883323 6 Left 952883315 3:37998587-37998609 CCCTGCCTTCAGGTCTGGGGCCC 0: 1
1: 0
2: 1
3: 15
4: 256
Right 952883323 3:37998616-37998638 CTGGGCGGTCCCGCTTTCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 62
952883317_952883323 1 Left 952883317 3:37998592-37998614 CCTTCAGGTCTGGGGCCCTACTG 0: 1
1: 0
2: 0
3: 10
4: 177
Right 952883323 3:37998616-37998638 CTGGGCGGTCCCGCTTTCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 62
952883309_952883323 29 Left 952883309 3:37998564-37998586 CCATGTGTAAAAGGGGCACGTGG 0: 1
1: 0
2: 1
3: 6
4: 105
Right 952883323 3:37998616-37998638 CTGGGCGGTCCCGCTTTCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 62
952883316_952883323 5 Left 952883316 3:37998588-37998610 CCTGCCTTCAGGTCTGGGGCCCT 0: 1
1: 0
2: 1
3: 21
4: 276
Right 952883323 3:37998616-37998638 CTGGGCGGTCCCGCTTTCTGAGG 0: 1
1: 0
2: 1
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952883323 Original CRISPR CTGGGCGGTCCCGCTTTCTG AGG Intronic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
900551706 1:3259691-3259713 CTGGGCTGTCCAGGTTTCTGAGG + Intronic
909726354 1:78840761-78840783 CTGGGCAGCCCCACTTTGTGAGG - Intergenic
913269074 1:117075407-117075429 TTGAGGGGTCCCCCTTTCTGGGG - Exonic
915318021 1:155040649-155040671 CTGGGGGGTCCCTCTCCCTGGGG + Intronic
915537812 1:156548103-156548125 CTGAGCATTCCCACTTTCTGAGG - Exonic
917626753 1:176854182-176854204 CTGGGAGGCCCCAATTTCTGTGG + Intergenic
919814957 1:201431409-201431431 CTGGGCTGAGCCTCTTTCTGAGG + Intergenic
921053049 1:211524750-211524772 CTGGCTAGTCCTGCTTTCTGAGG + Intergenic
1064442959 10:15370578-15370600 CTGGGCGGCCCCTCTGTCCGCGG + Intronic
1072546334 10:96442301-96442323 CTGGGCGGTCTCTTTTCCTGGGG + Intronic
1075161952 10:120032113-120032135 GTGGGAAGTCCTGCTTTCTGGGG + Intergenic
1076055394 10:127368277-127368299 CTGGGTGCTCCAGCTGTCTGTGG + Intronic
1077535820 11:3123557-3123579 CAGGGCGGGCACGCTTTCTCTGG - Intronic
1085184261 11:74562081-74562103 CTGTGCTGTCCCTCTTTCTTGGG + Intronic
1085303524 11:75472505-75472527 CTGGGAGGTCCCTCTGGCTGAGG + Intronic
1096763834 12:53866759-53866781 CTGGGCAGTCCCTCTATCTGAGG + Intergenic
1103704159 12:122862378-122862400 CTGGAAGGGGCCGCTTTCTGGGG + Exonic
1105414085 13:20193726-20193748 CAGGGGGGTCCCGCCATCTGCGG + Intergenic
1106539983 13:30681765-30681787 CTGGAAGCTCCTGCTTTCTGAGG - Intergenic
1107220497 13:37973896-37973918 GTGGCAAGTCCCGCTTTCTGGGG - Intergenic
1113248804 13:108428649-108428671 CTGGGCAGTCCATCCTTCTGTGG - Intergenic
1121321303 14:92993160-92993182 CTGGGCCCTCCGGCTTTGTGAGG - Intronic
1126061695 15:44789131-44789153 CTGGGTCGTCCCTCTTGCTGGGG - Intergenic
1129440729 15:75579210-75579232 CTGGGCGGCCCCGAGCTCTGTGG - Exonic
1136555169 16:31003313-31003335 CTGTGCCGCCCCACTTTCTGGGG - Intronic
1137647608 16:50089468-50089490 CTGGGCTGTCCAGCTTGCTTGGG + Intronic
1151207971 17:72522298-72522320 CTGGAGGTTCCTGCTTTCTGAGG - Intergenic
1152631118 17:81411064-81411086 CTGAGGGGTCCCTCTCTCTGGGG + Intronic
1158650483 18:59280103-59280125 CTGGGCATTCCAGCTTTCAGAGG - Intronic
1160143624 18:76347437-76347459 CTGCCCGGTCCAGCTTTGTGAGG + Intergenic
1160499033 18:79393486-79393508 CTGGGCGGTCACTGTTGCTGGGG - Intergenic
1160846050 19:1166412-1166434 CAGGGTGGTGCGGCTTTCTGTGG + Intronic
1166761098 19:45224859-45224881 CCGGGCCGGCTCGCTTTCTGGGG + Exonic
929772847 2:44907169-44907191 CTGGGCTGTCCGCCTTTCTGGGG - Intergenic
932180623 2:69643429-69643451 CTCGGGGGTCCCGGGTTCTGGGG - Intronic
946239210 2:218343665-218343687 CTGGGCTGGCCTGCTTTCTAGGG - Intronic
946538950 2:220662642-220662664 CTGGGAGCTCCCGCTGCCTGTGG + Intergenic
947400391 2:229726016-229726038 CTGAGGGCTCCAGCTTTCTGGGG + Intergenic
1175908753 20:62394677-62394699 CTGGGCTGTCCCACCTCCTGTGG - Intronic
1179591965 21:42414919-42414941 CTGGGCAGCCCCACTTCCTGTGG + Intronic
1182455631 22:30448414-30448436 CAGGGCAGTCCTGCTTCCTGAGG + Intronic
1183688955 22:39377403-39377425 CTGGGTGGTCCCCACTTCTGGGG - Intronic
1184586055 22:45448837-45448859 CTGGGTGGTCTCCCTTCCTGTGG + Intergenic
1185254883 22:49826774-49826796 ACGGGCGGCCGCGCTTTCTGGGG + Intronic
949586061 3:5438776-5438798 ATGGGTGGTCCCGTTCTCTGTGG + Intergenic
950014145 3:9744301-9744323 TTGGGCGGTCCAGCTGTCTTCGG - Exonic
952883323 3:37998616-37998638 CTGGGCGGTCCCGCTTTCTGAGG + Intronic
960036095 3:113104566-113104588 CTTGGCGGTCCAGCATTCTCAGG - Intergenic
961481776 3:127185013-127185035 CTGGGCTGTCCCCCTACCTGAGG - Intergenic
961482999 3:127196108-127196130 TTGGGAGGTCCTGCTTTGTGGGG + Intronic
979146390 4:117252959-117252981 GTGGCAAGTCCCGCTTTCTGGGG + Intergenic
985280816 4:188283949-188283971 CTGGGCATACCCTCTTTCTGGGG - Intergenic
985543813 5:499406-499428 CGGGGCCACCCCGCTTTCTGGGG + Intronic
988968239 5:36441193-36441215 CTGGGGTGTGCCGCTGTCTGGGG - Intergenic
998302815 5:141041249-141041271 CTGGGCGGTGTCGCTGTCCGTGG + Intergenic
1004925819 6:20414031-20414053 ATGGGCCATCCCGTTTTCTGAGG + Intronic
1006640307 6:35486167-35486189 CTGGGCTGACCCACTTTCTTGGG + Intronic
1013424487 6:109998597-109998619 CTGGGCCCTCCCCCTTGCTGTGG + Intergenic
1023198385 7:37666727-37666749 CTGTGCGGACCTCCTTTCTGAGG + Intergenic
1024322998 7:48088635-48088657 CTGGGAGTTCCCGCTTGCTGGGG - Exonic
1030621558 7:111796096-111796118 CTGGGAGGTCCCCCATTCTTGGG + Intronic
1035164038 7:156973608-156973630 CTGGGCGTTCTCTCTCTCTGGGG - Intergenic
1041145822 8:54875158-54875180 CTGTGGGGTCCCCCTCTCTGGGG + Intergenic
1049096114 8:140549085-140549107 GTGGGCGCTCCCGCTGGCTGTGG - Intronic
1051919099 9:22243251-22243273 CTGGGTGGTCCATCATTCTGAGG + Intergenic
1053149383 9:35732880-35732902 CTGGGCGCTGCCGCTTTCTGAGG + Exonic
1059817103 9:117929182-117929204 TTGAGAGGTCCAGCTTTCTGAGG + Intergenic