ID: 952885403

View in Genome Browser
Species Human (GRCh38)
Location 3:38008612-38008634
Sequence GCCCTGAATTTCCAGACACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952885403_952885409 13 Left 952885403 3:38008612-38008634 CCAGGTGTCTGGAAATTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 952885409 3:38008648-38008670 ACAGAGCAGTCACAGGCTGTGGG 0: 1
1: 0
2: 2
3: 27
4: 358
952885403_952885405 -10 Left 952885403 3:38008612-38008634 CCAGGTGTCTGGAAATTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 952885405 3:38008625-38008647 AATTCAGGGCCACTACAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 100
952885403_952885411 23 Left 952885403 3:38008612-38008634 CCAGGTGTCTGGAAATTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 952885411 3:38008658-38008680 CACAGGCTGTGGGCTGGCCCTGG 0: 1
1: 0
2: 7
3: 67
4: 645
952885403_952885410 17 Left 952885403 3:38008612-38008634 CCAGGTGTCTGGAAATTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 952885410 3:38008652-38008674 AGCAGTCACAGGCTGTGGGCTGG 0: 1
1: 0
2: 5
3: 31
4: 394
952885403_952885412 24 Left 952885403 3:38008612-38008634 CCAGGTGTCTGGAAATTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 952885412 3:38008659-38008681 ACAGGCTGTGGGCTGGCCCTGGG 0: 1
1: 0
2: 6
3: 50
4: 624
952885403_952885413 25 Left 952885403 3:38008612-38008634 CCAGGTGTCTGGAAATTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 952885413 3:38008660-38008682 CAGGCTGTGGGCTGGCCCTGGGG 0: 1
1: 0
2: 10
3: 181
4: 905
952885403_952885407 6 Left 952885403 3:38008612-38008634 CCAGGTGTCTGGAAATTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 952885407 3:38008641-38008663 AGGCAGGACAGAGCAGTCACAGG 0: 1
1: 1
2: 2
3: 28
4: 352
952885403_952885408 12 Left 952885403 3:38008612-38008634 CCAGGTGTCTGGAAATTCAGGGC 0: 1
1: 0
2: 0
3: 13
4: 139
Right 952885408 3:38008647-38008669 GACAGAGCAGTCACAGGCTGTGG 0: 1
1: 0
2: 2
3: 32
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952885403 Original CRISPR GCCCTGAATTTCCAGACACC TGG (reversed) Exonic
900533754 1:3167346-3167368 GGCCTGAATTCCCAGAAAACTGG - Intronic
902563973 1:17297783-17297805 GGCCTGAATTTCTTGAGACCTGG + Intergenic
903691010 1:25173537-25173559 TGCCTGAATTTCCAGACTGCTGG - Intergenic
916539480 1:165739009-165739031 ACACTGAATTTGCATACACCTGG + Intronic
918543645 1:185658422-185658444 CCACTGTAGTTCCAGACACCAGG + Intergenic
919400834 1:197114654-197114676 GCCTTGAATTTCCAGGCTCAAGG + Intronic
919475705 1:198031078-198031100 TCCCTGAGTTCCCAGACACTTGG + Intergenic
1063447152 10:6126529-6126551 CCCCTGCATCTCCAGGCACCGGG - Intergenic
1065231837 10:23606359-23606381 GCCCTGTACCTCAAGACACCTGG - Intergenic
1071011492 10:80945254-80945276 CCCCTGACCTTACAGACACCAGG - Intergenic
1071169007 10:82841545-82841567 TGCCTGAATTTCCAGTCAGCTGG - Intronic
1073099782 10:101000405-101000427 GGCCTGGCTTTCCAGACTCCTGG + Exonic
1073260799 10:102188788-102188810 GCCCTGAGCTTGCACACACCTGG + Intergenic
1075473940 10:122717280-122717302 ATCCTGAATTTCCAGGCCCCTGG + Intergenic
1076549210 10:131267254-131267276 GCCCTGAGTGTGCACACACCTGG + Intronic
1076701858 10:132277398-132277420 GCCCTGAACATCCAGAAACATGG + Intronic
1077578925 11:3404622-3404644 GCCCTGCATTTGCAGCCAGCTGG - Intergenic
1078801228 11:14645032-14645054 GCCTTGTATTTCCAGAGAACAGG + Exonic
1079888372 11:26017654-26017676 TTCCTGAATTTTCAGAGACCTGG + Intergenic
1082072210 11:47948285-47948307 GCCCAGACTTTCCTGACTCCAGG - Intergenic
1085010195 11:73134598-73134620 GTCCTGCCTTTGCAGACACCTGG - Intronic
1085731276 11:79001445-79001467 GCCATGAACTTCCAGAATCCTGG + Intronic
1087971095 11:104485140-104485162 TCCCTTAATCTCCAGACACTTGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1089617594 11:119703724-119703746 ACCCTGAATTTCCATCAACCTGG + Intronic
1090023597 11:123149088-123149110 GCCCTGAATTTTCAGGAAGCGGG + Intronic
1093397028 12:18695055-18695077 GCTTTAAATTTCCAGACCCCTGG - Exonic
1101498019 12:105274496-105274518 CCCCTGAAATTTCAGACTCCAGG + Intronic
1101671185 12:106875098-106875120 GCCCTGAATTTTATGACATCTGG - Intronic
1110144558 13:72174387-72174409 ACCATGAAATCCCAGACACCTGG - Intergenic
1112031090 13:95457397-95457419 TCCCTGAGTTTCTACACACCTGG - Intronic
1116787973 14:49309088-49309110 GCCCAGAATTTAAAGACAGCAGG + Intergenic
1120528022 14:85600296-85600318 GCCCTGCATTTCCAAACCCATGG - Intronic
1121238827 14:92413301-92413323 GCCCAGAATTCCCAGTCTCCTGG + Intronic
1121628512 14:95405242-95405264 ACCCTGAAGTTCCTGACCCCAGG + Intergenic
1121649924 14:95550405-95550427 ACTCTGAAATTCCAGACAGCAGG + Intergenic
1126215153 15:46146136-46146158 GCCCTGAGTGTGCACACACCTGG - Intergenic
1128452032 15:67811342-67811364 GGCCTGAGTGTGCAGACACCTGG - Intergenic
1128795725 15:70465154-70465176 CCCCTTAGGTTCCAGACACCTGG - Intergenic
1129999273 15:80033314-80033336 GCCCTGAATGACCACACAGCTGG - Intergenic
1131230112 15:90653523-90653545 GCCCTGGAGTTACAGAGACCTGG - Intergenic
1133346233 16:5072315-5072337 GCCCTGGAGTTCCACGCACCTGG - Intronic
1133831767 16:9329958-9329980 GCCCTAACTGTGCAGACACCAGG + Intergenic
1137407058 16:48197560-48197582 GCCATGAGCTTCCAGACATCAGG + Intronic
1137563757 16:49520594-49520616 GCACGGAAATTCCAGGCACCTGG - Intronic
1138550356 16:57744316-57744338 GCCCTGAATTCCAAGTCCCCCGG - Intronic
1139167916 16:64592098-64592120 GCAATTAATTTCCAGACATCTGG + Intergenic
1139576495 16:67845674-67845696 GCCCATAACCTCCAGACACCAGG - Intronic
1139703797 16:68726389-68726411 GACCTGAAATTCCAGACTCCGGG - Intergenic
1140240241 16:73193511-73193533 CCCCTGAATTTCCAGTATCCTGG + Intergenic
1141206424 16:81936357-81936379 GCACTCAATTTCCAGACGGCAGG + Exonic
1142036059 16:87862708-87862730 GCCTGGGATTCCCAGACACCTGG + Intronic
1144066529 17:11629432-11629454 GCCCTGGATTTCCACAAACTGGG + Exonic
1144425118 17:15134217-15134239 GCCCTGCCTTTTCAAACACCAGG + Intergenic
1145761974 17:27430328-27430350 GCCCTGCAGCCCCAGACACCTGG + Intergenic
1148104830 17:45113581-45113603 GCCTTGAACTTCCAGACGCCAGG - Exonic
1149519435 17:57307390-57307412 TCCCTGAATTTCCAGACTGTTGG + Intronic
1149884600 17:60327852-60327874 GCCCTGAGTGTCCACATACCTGG - Intronic
1150978069 17:70111052-70111074 TCCCTGCAACTCCAGACACCAGG - Intronic
1151761279 17:76104473-76104495 GGCCTCAGTGTCCAGACACCCGG + Intronic
1151944856 17:77314073-77314095 GCCCTGTAGTTCCAGCTACCCGG + Intronic
1152256731 17:79244333-79244355 GCCCAGAACTTTCAGACAGCAGG + Intronic
1155878049 18:31111350-31111372 GCACTGAATCTCAAGACAGCAGG + Intergenic
1158798017 18:60871880-60871902 GGTCAGAATTTCCAGAGACCTGG + Intergenic
1158871640 18:61693932-61693954 GTCCTGTATTTCCAGCCAACTGG + Intergenic
1159189111 18:65018027-65018049 GCCCTGAGTGTGCACACACCCGG + Intergenic
1164027656 19:21367597-21367619 GCCTTCCATTTTCAGACACCTGG - Intronic
1164965438 19:32479284-32479306 TCCCTGGCTTTCCAGGCACCAGG + Intronic
1165051520 19:33144596-33144618 ACCCCGCAATTCCAGACACCAGG - Intronic
1166076101 19:40414688-40414710 GCCCTGACTCACCAGACCCCGGG + Intergenic
1168565419 19:57418385-57418407 TCCCTGAAATTCCTGACACAGGG - Intronic
934574181 2:95390106-95390128 GACTTGAATTTCCTGACAGCAGG - Intergenic
935586054 2:104801170-104801192 GTCCTTGATCTCCAGACACCAGG - Intergenic
937894318 2:126966955-126966977 CCCCTAAAATTCCAGCCACCTGG + Intergenic
940396338 2:153196387-153196409 GCCCTGAATGTGCACACACCTGG + Intergenic
942212525 2:173685766-173685788 GCACTGAATTTCCAGTTAACAGG + Intergenic
942414062 2:175739872-175739894 GCATTCAATTTCCAGAAACCTGG + Intergenic
944297678 2:198085519-198085541 GCAATGAATTTTCAGACTCCGGG + Exonic
948329277 2:237152122-237152144 GCACAGAATTTAGAGACACCGGG - Intergenic
1169725835 20:8729153-8729175 GCACTTAATTTCCAGACAATGGG + Exonic
1170965309 20:21063456-21063478 GCCCTGAGTTTCCACACCCTGGG + Intergenic
1173227899 20:41172624-41172646 GCCCTCAACTTCCAGACCCCTGG + Exonic
1173966389 20:47115818-47115840 GCCATGACTTTCCAGGCCCCGGG + Intronic
1175167371 20:57054352-57054374 GCCCTGAGATCCCAGACCCCTGG - Intergenic
1175541913 20:59753304-59753326 GCCCTAAATCTCCAGACTTCTGG + Intronic
1178185159 21:30209925-30209947 GCCTTGTATTTCCATTCACCAGG - Intergenic
1182426370 22:30275077-30275099 GCCCTGCACTTCCAGAGGCCTGG - Intergenic
950519850 3:13491616-13491638 GCCTTCACCTTCCAGACACCTGG - Intronic
950952113 3:17011447-17011469 GCCATGAACTTTCAGACACCAGG + Exonic
952885403 3:38008612-38008634 GCCCTGAATTTCCAGACACCTGG - Exonic
953660740 3:44889832-44889854 CCCCTGAAGTTCCAGACACTGGG + Intronic
954115625 3:48465556-48465578 GCCCTGAGTGTCCAGCCACATGG + Exonic
954381912 3:50223776-50223798 GCCTTGAATTTCTAGACTCAAGG + Intergenic
956749585 3:72335429-72335451 GCCCTTAATTCCCAGACCCGAGG - Intergenic
957095249 3:75771952-75771974 GCCCTGAGCTTGCACACACCGGG - Intronic
960313651 3:116149171-116149193 GCCCTCAATGTGCAGACTCCAGG + Intronic
967619688 3:191618140-191618162 GCCCTGAATTTCCAAATTCAGGG - Intergenic
969116385 4:4872970-4872992 GCCCTGGATTTCCTGACAGCCGG + Intergenic
972703462 4:41516563-41516585 GTCCATAATTTCCAGACAGCAGG + Intronic
972848435 4:43018385-43018407 TCACTGATTTTCAAGACACCTGG - Intronic
974420083 4:61662441-61662463 GCCCTGAGTATGCACACACCTGG - Intronic
977265851 4:94853049-94853071 GCCTGGAGTTTCCAGACTCCGGG + Intronic
980306347 4:131065397-131065419 GCCCTGAGTGTGCAGACACCTGG + Intergenic
981423927 4:144581989-144582011 TCCATGCATTTCAAGACACCTGG + Intergenic
983432791 4:167672648-167672670 TCCCTGAATTTCCAGACTGCTGG - Intergenic
983593483 4:169440963-169440985 GCCCTGAATCTCCACACCCCTGG + Intronic
983658589 4:170108832-170108854 GCCTTGATTTCCCAGGCACCAGG + Intergenic
988544860 5:32146078-32146100 GCCCAGGAATTCCAGACCCCTGG + Intronic
989548342 5:42700765-42700787 TCCCAGAATTTTGAGACACCAGG + Intronic
994985328 5:106926197-106926219 TCCCAGAATTTCCAGACTGCTGG - Intergenic
995739742 5:115343144-115343166 GCCCAGAATTCCCAGTCCCCTGG - Intergenic
1000284093 5:159811613-159811635 TCCTGGAATTTCCAGCCACCAGG + Intergenic
1001395347 5:171415480-171415502 ACCCTGTATTTCCAGAGTCCAGG - Intergenic
1002420879 5:179148563-179148585 GCCCTGGAATTCCTGCCACCAGG + Intronic
1003160928 6:3633652-3633674 GCCCTGAATTTGTAGCCAGCTGG + Intergenic
1006482909 6:34313047-34313069 GGCCTGTACTCCCAGACACCAGG + Intronic
1007987462 6:46221236-46221258 ACCCTGAATTTCCAGAATGCAGG - Exonic
1011159393 6:84371110-84371132 GCCCTGAAGTTCAAAAGACCTGG - Intergenic
1013116845 6:107109903-107109925 GGCCTGTAGTTCCAGCCACCTGG + Intronic
1013424417 6:109998140-109998162 GCACTGCATTTCCAGACTCCTGG - Intergenic
1013482079 6:110561608-110561630 CCCCTCAATTTCCAGGCTCCAGG + Intergenic
1013761826 6:113527595-113527617 GCCCTGGCTTTACAGTCACCTGG + Intergenic
1015457709 6:133446626-133446648 GTCCTGCATTTCCATAGACCTGG - Exonic
1016515419 6:144888120-144888142 TCCCTGAGTTTCCAGGCAGCTGG - Intergenic
1017817916 6:158028406-158028428 GCCAGGAATTTTCAGACTCCTGG + Intronic
1021946496 7:25732925-25732947 GCCATGATGTTCCACACACCTGG + Intergenic
1024087831 7:45911385-45911407 GTCCTGGATTTCCAGACACTTGG + Intergenic
1028445248 7:90914856-90914878 GACCTGAATTTAGAGACATCTGG - Intronic
1029969521 7:104775544-104775566 GCCCCTAATTTTCACACACCTGG - Intronic
1030186866 7:106771314-106771336 GCCCTGAATTTAGGCACACCTGG - Intergenic
1030243739 7:107359293-107359315 GCCCTGAGTCTGCACACACCTGG - Intronic
1030298697 7:107954235-107954257 GCCCTGAATTTCCGGGCTCAAGG + Intronic
1031693211 7:124816680-124816702 GCCATGAATTTCTAGATACTTGG + Intergenic
1032931572 7:136678299-136678321 GCCCTGATTTTCCAGAATTCTGG - Intergenic
1036611739 8:10356122-10356144 GCAGTGAATGTCCAGACCCCTGG - Intronic
1038941342 8:32309222-32309244 GCCCTTAATTACCAGAGACTTGG + Intronic
1040960493 8:53027146-53027168 TCCCTGCCTTTCCAGACCCCTGG - Intergenic
1042337727 8:67646292-67646314 GCCCTGTATTTCCAGCTTCCTGG + Intronic
1044406009 8:91827078-91827100 GCTCTGAATTTCCAGATACATGG - Intergenic
1049679656 8:143912351-143912373 GCCTTGCATTTCCTAACACCAGG + Intergenic
1051372383 9:16369669-16369691 GCCCTGAAATTGCTAACACCTGG + Intergenic
1051431519 9:16985013-16985035 GCCCTGGATTACCAGACAAGAGG - Intergenic
1051507511 9:17842701-17842723 GCTCTGAAGGTCCAAACACCTGG - Intergenic
1053204008 9:36171411-36171433 GCCCTGAGTTTCCACCCACTGGG - Intergenic
1053352308 9:37421869-37421891 GCCTGGTATTTCCAGGCACCTGG + Intergenic
1053386664 9:37696666-37696688 GCCCTGAATTTCCTGGTAGCTGG + Intronic
1056477371 9:86965969-86965991 GCCTTTTATTTCCAGTCACCTGG + Intergenic
1058737253 9:107905128-107905150 CCCCTTAATTTCCAGAGCCCTGG + Intergenic
1062062321 9:134503065-134503087 GCCCAGACTCTCCAGACAGCTGG - Intergenic
1195431612 X:104795794-104795816 TCCTTGACTTTCCAGACACAAGG + Intronic
1196146260 X:112320661-112320683 GAACTGAAATTCCAGACACATGG - Intergenic
1196809243 X:119615519-119615541 GGCCTGAAATTCCCAACACCTGG - Intergenic
1197609604 X:128623499-128623521 GCCCTGAGTTTACACACAGCTGG + Intergenic