ID: 952887530

View in Genome Browser
Species Human (GRCh38)
Location 3:38020760-38020782
Sequence CAGAGTGAACTGAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952887527_952887530 -1 Left 952887527 3:38020738-38020760 CCTCCTGGTCACACTTAGGAGTC 0: 1
1: 0
2: 0
3: 7
4: 96
Right 952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 350
952887528_952887530 -4 Left 952887528 3:38020741-38020763 CCTGGTCACACTTAGGAGTCAGA 0: 1
1: 0
2: 0
3: 11
4: 132
Right 952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 350
952887526_952887530 0 Left 952887526 3:38020737-38020759 CCCTCCTGGTCACACTTAGGAGT 0: 1
1: 0
2: 0
3: 10
4: 133
Right 952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 350
952887525_952887530 1 Left 952887525 3:38020736-38020758 CCCCTCCTGGTCACACTTAGGAG 0: 1
1: 0
2: 0
3: 12
4: 98
Right 952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952887530 Original CRISPR CAGAGTGAACTGAAGGAAGC TGG Intronic
902809743 1:18881344-18881366 CAGAATGAACTGGAGGAGTCAGG - Intronic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
904312420 1:29637575-29637597 CATGGTGAAAGGAAGGAAGCAGG + Intergenic
905212015 1:36380896-36380918 CAGGGTTTACTGAACGAAGCTGG + Intronic
905506201 1:38481492-38481514 CAGAGTGGGATGAAGGAAGGTGG - Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906205157 1:43982584-43982606 CAGAGGGACCTGGAGGATGCAGG + Intronic
906302712 1:44695175-44695197 CACAGTGAACTGCTGGAACCGGG - Intronic
908046980 1:60181336-60181358 CAGAGTAAAAGTAAGGAAGCTGG - Intergenic
908482095 1:64551249-64551271 CACAGAGAACTGAAAGAAGATGG - Intronic
909016632 1:70387280-70387302 CAGAGTGAGCTGAAGTTAGAAGG - Intergenic
909126056 1:71671372-71671394 CAGGGTAAAATGAAGGAAACTGG + Intronic
909265500 1:73553009-73553031 CTGGGTGAATTGGAGGAAGCTGG - Intergenic
911674071 1:100638980-100639002 CTGAATGATCTGGAGGAAGCAGG + Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912507631 1:110167032-110167054 CAGAGTGTACTGAATGTGGCTGG + Exonic
913509512 1:119549153-119549175 CTGAGGGCAATGAAGGAAGCAGG - Intergenic
915471512 1:156128503-156128525 CAGCCTGAGCTGAAAGAAGCTGG - Intronic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
920866295 1:209756680-209756702 CAGTGTGAACTGAGGGGAGAGGG - Intronic
921343362 1:214156378-214156400 CTGCCTGAACTGAAGGGAGCAGG - Intergenic
922014987 1:221636205-221636227 AGAAGCGAACTGAAGGAAGCAGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923121817 1:230999089-230999111 CACAGTGAAGGGAAGGAAGAGGG - Intronic
923193808 1:231645001-231645023 CACAGTGAACAGAAAGAGGCTGG - Intronic
1062973492 10:1665983-1666005 CAGAGTGGCCTGCAGGGAGCTGG + Intronic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1065651499 10:27897172-27897194 CAGAGTGAAGTAAAGAAAGAAGG - Intronic
1065845801 10:29742220-29742242 CAGAGAGAAACCAAGGAAGCTGG - Intergenic
1066321577 10:34308283-34308305 GAGAATAAACTGCAGGAAGCAGG + Intronic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1068329777 10:55547828-55547850 CAGAGTGATATCAAGGTAGCAGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073223761 10:101898539-101898561 CTGAGATACCTGAAGGAAGCAGG + Intronic
1073580679 10:104663079-104663101 CAGAGTGAAAGGAAGGCAGCCGG - Intronic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076775163 10:132691466-132691488 CAGCGTGTGCTGCAGGAAGCTGG + Intronic
1077336957 11:2009676-2009698 CAGCGTGAGCCTAAGGAAGCAGG - Intergenic
1077362741 11:2147907-2147929 CAAGGTGACCTGAAGGAACCCGG - Intronic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1078076231 11:8163771-8163793 TAGAGTGAACTGAAGCAATTTGG - Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1079582707 11:22086315-22086337 CAGAGAGAACTGAAGAGAGCTGG + Intergenic
1079613179 11:22458161-22458183 CAGAAAGAAGTGAAGGAAGGAGG - Intergenic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1080849876 11:36058992-36059014 CAGAGGGAGGTAAAGGAAGCAGG - Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1084024161 11:66437517-66437539 GAAAGTGAGATGAAGGAAGCAGG - Intronic
1084525361 11:69694517-69694539 GATAGTGAACTGTAGGAACCTGG + Intergenic
1085427473 11:76417536-76417558 CAAAGTGATTTGGAGGAAGCAGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088889547 11:114033736-114033758 CAGAGTAACCTGAAGGACTCAGG - Intergenic
1089804108 11:121067709-121067731 CAGTGTGTACTGCAGGTAGCTGG + Intronic
1089975621 11:122729208-122729230 CAGTGGGAACTGCAGGGAGCTGG - Intronic
1090900535 11:131026959-131026981 AAGTGGGAACTGAAGAAAGCTGG + Intergenic
1202819941 11_KI270721v1_random:64858-64880 CAGCGTGAGCCTAAGGAAGCAGG - Intergenic
1091880745 12:3975508-3975530 CAGAGTGAAGTGAAGCACGTTGG - Intergenic
1092603358 12:10091548-10091570 CTCAGTTAACTGAAGGAAACAGG - Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093211851 12:16317448-16317470 CAGAGTGCACTGAAGGATCAAGG - Intergenic
1093669302 12:21853760-21853782 CAAAGTGACCTGAAGGGAGGAGG + Intronic
1094351332 12:29528999-29529021 CAGATTGAACCGACAGAAGCAGG - Intronic
1094407262 12:30130090-30130112 GATAGTGAACTGAAGAAAGGTGG - Intergenic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097482976 12:60154549-60154571 CAAAGTCAATTGAAGGATGCAGG + Intergenic
1098214281 12:68199378-68199400 CAGAGAGACCTGAAGGAAATGGG + Intergenic
1098894393 12:76041008-76041030 TAGATTTGACTGAAGGAAGCTGG + Exonic
1099100295 12:78431556-78431578 CAGAATGAACTGATGGAAATGGG - Intergenic
1100054776 12:90495743-90495765 CAGAGAGATCTGAAGGAGTCTGG - Intergenic
1100281194 12:93119977-93119999 CAGAGAGAACTGAGGGGAGATGG - Intergenic
1101061951 12:100981643-100981665 CAGACTGAATTAAATGAAGCAGG - Intronic
1101488470 12:105190345-105190367 CAGAGAGAACTGCAGGAAATGGG - Intronic
1101759332 12:107645994-107646016 CAGCATGGACTGAAGTAAGCCGG - Intronic
1101788822 12:107910482-107910504 GAGAGTCAACTGTAGGCAGCAGG + Intergenic
1102742870 12:115223549-115223571 CAGGGTGGCCTGGAGGAAGCTGG + Intergenic
1103100826 12:118173995-118174017 CAGAGTAAGCTGGAGTAAGCTGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104223542 12:126809731-126809753 CACATTGAACAGAAGGAAGTAGG + Intergenic
1104294062 12:127495750-127495772 CAGAGTCCACTGAAGGCAGGTGG - Intergenic
1104958930 12:132479028-132479050 CAGAGTGGACTGTAGGAGGCAGG + Intergenic
1105294384 13:19075300-19075322 CAGAGGGAACAGAAGTTAGCTGG + Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106579190 13:31003139-31003161 CGGGGTGAACTGAGTGAAGCAGG - Intergenic
1107087557 13:36442501-36442523 CAGAATGGAAGGAAGGAAGCTGG - Intronic
1107269910 13:38603050-38603072 CAGAGTGAAATAAGGAAAGCAGG - Intergenic
1109231853 13:59766899-59766921 CAGATTGGACTGAAGGACTCGGG - Intronic
1109305821 13:60640480-60640502 CAGAGACAACTGAATGAAGCTGG - Intergenic
1110809568 13:79796713-79796735 CACAGTATTCTGAAGGAAGCAGG - Intergenic
1112492873 13:99883048-99883070 CAGAGTGAAGAAAAGGAAACAGG + Intronic
1114553724 14:23549633-23549655 TAGAATGAACTGAAGGATGGGGG + Intronic
1115418819 14:33168681-33168703 GAGACTGAAATGAAGGAATCAGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115975788 14:38995516-38995538 CAGAGGGAACTGATGCAACCGGG - Intergenic
1117481336 14:56148430-56148452 CAGAGGGAACTGATGCAGGCAGG - Intronic
1117775997 14:59185161-59185183 CAGGGTGACCTGGAAGAAGCTGG + Intergenic
1118249651 14:64147232-64147254 GAGGGTGGTCTGAAGGAAGCCGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118668701 14:68099498-68099520 CAGACTTAACTGCAGCAAGCAGG - Intronic
1118677839 14:68207662-68207684 GAGAGTGAAGTCAAAGAAGCAGG + Intronic
1119030465 14:71188331-71188353 CAGTGTGCAGTGAAGGGAGCTGG + Intergenic
1119889431 14:78172003-78172025 AAGCGGGAACCGAAGGAAGCGGG - Intergenic
1122326578 14:100884355-100884377 CACACTGACCTGAAGGAATCGGG - Exonic
1125190441 15:36986518-36986540 CTGGGAGCACTGAAGGAAGCTGG - Intronic
1125931630 15:43604342-43604364 CAGGGTGAGATGAAGGAAGAAGG - Exonic
1125944734 15:43703822-43703844 CAGGGTGAGATGAAGGAAGAAGG - Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131035228 15:89217759-89217781 CAGAGTGAAATGATGGAAAGAGG - Intronic
1131057188 15:89382317-89382339 CAGAGTGGAATAAAGGAAGTGGG + Intergenic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1131398857 15:92108770-92108792 AGAAGTGAACTGAAGGAAGAAGG - Intronic
1133958295 16:10467130-10467152 CAGAGTGAACTAGAGGTAGAAGG - Intronic
1134011023 16:10853216-10853238 CAGAGTGAATAGAATGAAGTAGG + Intergenic
1134225310 16:12385488-12385510 CAGGGAGAAGTGAAGGAAGGAGG + Intronic
1134325613 16:13204886-13204908 AAGAATGAACTGAAGGAACCAGG - Intronic
1135619378 16:23942222-23942244 CAGAGGGAAGTGTAGGAAACTGG + Intronic
1136632821 16:31499009-31499031 CAAAGGGAAGTCAAGGAAGCTGG + Intronic
1136892218 16:33978115-33978137 CACAGTGAACTTGGGGAAGCAGG + Intergenic
1138101992 16:54259595-54259617 AAGAGAGAAAGGAAGGAAGCAGG + Intronic
1138652804 16:58471404-58471426 CAGAGTGATCAGAACGAGGCTGG - Intronic
1138837873 16:60460040-60460062 CAGAGAGAACTGAGGGTAGTTGG - Intergenic
1138976596 16:62214838-62214860 GAGACTGGACAGAAGGAAGCTGG - Intergenic
1139153904 16:64417895-64417917 CATTGTGAATTGAAGGAGGCAGG + Intergenic
1139166630 16:64573450-64573472 AAGAGGGGAGTGAAGGAAGCTGG - Intergenic
1139169540 16:64614426-64614448 CAGGGAGAACTGAAACAAGCTGG - Intergenic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1141212728 16:81996228-81996250 GAGAATGGACTGAAGGAAGGAGG + Exonic
1141270357 16:82534195-82534217 CACAGAGAACTGAAGGAACCAGG + Intergenic
1203080824 16_KI270728v1_random:1145508-1145530 CACAGTGAACTTGGGGAAGCAGG - Intergenic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1145028642 17:19488086-19488108 CAGAGAGAACTGATTGAATCAGG - Intergenic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1146889728 17:36498653-36498675 CAAGGTGAACTGAAGGCACCTGG + Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148468410 17:47878438-47878460 GAGAGGGAACTGAAGGAATCAGG - Intergenic
1149515207 17:57275923-57275945 CACAGAGAACTGAAGGAGGGAGG - Intronic
1150604778 17:66681428-66681450 CAGAGAGAACTGAATGAAAGTGG + Intronic
1151258453 17:72898080-72898102 CCAAGTGAACTGAATGCAGCAGG + Intronic
1151384022 17:73744256-73744278 CAGAGTGAAAGGCAGGAAGAGGG - Intergenic
1151460788 17:74252912-74252934 CAGAATGATCTGCAGGAGGCAGG + Intronic
1151672263 17:75577676-75577698 AAAAATGAACTGGAGGAAGCTGG + Intergenic
1151760322 17:76098022-76098044 CACAGACAACAGAAGGAAGCAGG + Intronic
1152132978 17:78488404-78488426 AGGAGTGACCTGGAGGAAGCAGG - Intronic
1153403889 18:4713337-4713359 CAGAGTGCATTGAATGAAGGGGG - Intergenic
1153985003 18:10343846-10343868 CAGAGTGCCCAGGAGGAAGCTGG - Intergenic
1154501821 18:15001162-15001184 CAGAGTGAGCTGGGGAAAGCGGG + Intergenic
1156126346 18:33910271-33910293 CACTGTGAACTTAAGTAAGCTGG + Intronic
1156608676 18:38700056-38700078 CACAGGGAAATGAAGGAAACAGG + Intergenic
1156804686 18:41163724-41163746 CAGAGTTGACTGAATGAATCTGG - Intergenic
1157489648 18:48113824-48113846 CAGGGTGCACTCCAGGAAGCAGG + Intronic
1157579771 18:48766883-48766905 CAGAGAGAAATGGAGGCAGCGGG - Intronic
1157939749 18:51915124-51915146 CAGAGTGGACTGGAGGGAGCAGG + Intergenic
1158524291 18:58198357-58198379 CAGAGTGACATGTAAGAAGCTGG + Intronic
1158855797 18:61542430-61542452 GGGAGGGAAGTGAAGGAAGCAGG + Intronic
1159814144 18:73052536-73052558 CAGAGCCAAGTGATGGAAGCAGG - Intergenic
1161585272 19:5102341-5102363 CAGAGGCAACTGCAGGAAGGAGG - Intronic
1161831896 19:6612050-6612072 AAGAGTGAAATGAAGGAATTAGG - Intergenic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1162802165 19:13117519-13117541 CACAGAGAAATGAAGAAAGCTGG - Exonic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1165034642 19:33023923-33023945 CAGAGTGAACCGAAGGTCTCTGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165895132 19:39136775-39136797 CTGACTGAACTGTAGTAAGCTGG + Intronic
1166345238 19:42161619-42161641 CAGAGAGGAATGAAGGGAGCGGG + Intronic
1166627482 19:44372071-44372093 CAGAATGAGCTGTAGGAAGGTGG - Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
1167601438 19:50457289-50457311 CAGAGTGAACTCTAACAAGCTGG - Intronic
1168113946 19:54210396-54210418 GAGAGTGAGCCAAAGGAAGCTGG + Intronic
1168149678 19:54438879-54438901 CAGAGTGGACTGAAGGAGAGGGG + Intergenic
1168585471 19:57588197-57588219 GAGTGTGAACTGAAGGACCCAGG + Intronic
925275609 2:2645818-2645840 CAGAGCCAACTGAGGCAAGCAGG - Intergenic
925708407 2:6713331-6713353 CAGTGTGAACTGAATGGACCAGG - Intergenic
926566514 2:14481442-14481464 CAGAGTGCACTGAAAGAAGCAGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928626472 2:33144649-33144671 TAGAGTAAATTTAAGGAAGCTGG + Intronic
929647169 2:43638831-43638853 CAGAATGAAATGAGGGAATCAGG + Intronic
930654359 2:53993328-53993350 AGGAGTGAAATGAAGGAAGGAGG + Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931222657 2:60302075-60302097 CAGAGTGAACTTGGGGAAGCGGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935235192 2:101132422-101132444 CATACTGTACTGAAGGGAGCAGG - Intronic
935517719 2:104063365-104063387 CAAAGTGAACTTAAGAAAACTGG + Intergenic
937653515 2:124347490-124347512 CAGATTGAGCAGAAGAAAGCTGG + Intronic
938114163 2:128592069-128592091 CAGAGTGCAGTGGAGGAGGCTGG + Intergenic
938501002 2:131831331-131831353 CAGAGTGAGCTGGGGAAAGCGGG + Intergenic
938546023 2:132332490-132332512 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
938598891 2:132817216-132817238 CAGAATCATCTGAAGGAATCAGG + Intronic
939162586 2:138607606-138607628 GAGAAGGAACTGAAGTAAGCGGG - Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
941078896 2:161037304-161037326 CAGATTGAGCTCAAGGAAGAAGG + Intergenic
941253638 2:163199727-163199749 CAAAGTGAACTGTTGGAAGAAGG - Intergenic
941621732 2:167786772-167786794 CAGAAAGTACTGAAGTAAGCAGG + Intergenic
941633452 2:167909357-167909379 CAAAGGGAAATGAAGGTAGCAGG - Intergenic
943794446 2:191974306-191974328 CAGACTCAACTGAAAGAAGAAGG - Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
945079182 2:206071693-206071715 AAGAGTGAGCTGATGGAATCAGG - Intronic
945421143 2:209638211-209638233 CAGAGTGAATTCTAGGAATCAGG - Intronic
946142644 2:217704704-217704726 CAAACAGAACTGAAAGAAGCAGG + Intronic
946283628 2:218685199-218685221 CAGAGTCAGCTGCATGAAGCTGG + Exonic
946921563 2:224585613-224585635 AACAGGGAACTGAAGGAAGTGGG + Intergenic
948602021 2:239112635-239112657 CAGAGTGGAGTGGAGGGAGCAGG + Intronic
1170297454 20:14843996-14844018 CAAAGTGAACTAATGGAGGCAGG - Intronic
1170686736 20:18576155-18576177 CTGAGTGAAGTGCAGGAAGTTGG + Intronic
1171221384 20:23401072-23401094 AAGAGGGAGCTGAAGGAAGCAGG + Intronic
1171523124 20:25790861-25790883 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171530864 20:25852839-25852861 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171553703 20:26065022-26065044 CAGAGCGACCTGAAAGAAGGTGG + Intergenic
1171874886 20:30565223-30565245 CAGAATGAGCTGCAGGAAGGCGG + Intergenic
1171878971 20:30602730-30602752 CAGAGGGAACAGAAGCTAGCTGG + Intergenic
1173189636 20:40866166-40866188 GAGAGTGAATTGGAGGCAGCTGG - Intergenic
1173554256 20:43954418-43954440 CAGAGTCCACTGCAGGAGGCAGG - Intronic
1174199050 20:48794356-48794378 CAGAGAGTCCTGAAGGAAGCTGG + Intronic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174692203 20:52517302-52517324 CAGAGTACTCTGAAGGAACCAGG - Intergenic
1175582296 20:60109871-60109893 TAGAGAGAACTGAACGAACCTGG - Intergenic
1175748408 20:61477579-61477601 CAGACTGAGCTCAAGGAAGGCGG - Intronic
1179831790 21:44001451-44001473 CAGAGTGAGCTGAAGGCATGTGG + Intergenic
1180611113 22:17098620-17098642 GAGAGTGAACTGAAAGGAACAGG + Intronic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1184046038 22:41972722-41972744 CAGAGTGAACAGAGCCAAGCTGG + Intergenic
1184362664 22:44027496-44027518 CAGAGACAGCTGAAGGCAGCGGG + Intronic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
950534595 3:13571674-13571696 CAAAGTGCCCTGAAGGAACCAGG - Intronic
950720845 3:14881606-14881628 CAGAGAGAGCTCAAGGGAGCAGG - Intronic
951617705 3:24566884-24566906 GAGGGTGAACTGAAGCAGGCGGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953611668 3:44451943-44451965 CAAAGTGAACTCAAAGAGGCAGG + Intronic
955515567 3:59723141-59723163 CAGAGTGAACTAAAGAATCCAGG + Intergenic
956384048 3:68698088-68698110 AAGAGTGAACTCAAGGCAGGAGG + Intergenic
957441984 3:80260468-80260490 TAGAGTGAAGTTAAAGAAGCAGG - Intergenic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
961228069 3:125271991-125272013 TACAGTGTACTGAAGGAAGCTGG - Intronic
962241301 3:133753440-133753462 CAGAGTCAACTGAAGCCAGCAGG + Intronic
962347562 3:134629562-134629584 CAGAGAGGATTGAAGGCAGCTGG - Intronic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
962601587 3:136995321-136995343 CAGAGTCAACTCCAGGAAACCGG + Intronic
963718292 3:148830117-148830139 CAGAGTGAACTGGAAGCAGATGG - Intronic
964226029 3:154403275-154403297 AAGAGTAAATTAAAGGAAGCAGG + Intronic
966211769 3:177460904-177460926 CAGAGTTAAATGAAGTTAGCTGG + Intergenic
968669794 4:1843047-1843069 CACAGAGAGCTGATGGAAGCAGG - Intronic
968921907 4:3526748-3526770 CAGACTGAGCTGCAGGGAGCAGG - Intronic
969028728 4:4194488-4194510 CCTAGCAAACTGAAGGAAGCCGG + Intronic
969193886 4:5545505-5545527 CAGAGTTATCAGGAGGAAGCAGG + Intronic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
974397482 4:61357555-61357577 CAGTGTAAACTAAAGAAAGCAGG - Intronic
975742597 4:77443852-77443874 CATAGTGAACTGAGGGATGTTGG - Intergenic
975785370 4:77881869-77881891 GAGAGAGACCTGAAGGAAGTAGG - Intronic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
976496630 4:85737804-85737826 TACAGTGAAAGGAAGGAAGCTGG + Intronic
978298666 4:107239540-107239562 CAGAGTGACTTGAATAAAGCAGG - Intronic
978343202 4:107739029-107739051 CAGAAAGAATGGAAGGAAGCTGG + Intergenic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
979717484 4:123858643-123858665 CAGAGTGGACTGAACTAAGCTGG + Intergenic
982515390 4:156340863-156340885 CAGAATGTAAAGAAGGAAGCAGG + Intergenic
982656893 4:158161449-158161471 AAGTGTGAAGTCAAGGAAGCAGG + Intronic
984387354 4:179078306-179078328 CAGAGAGGAATGATGGAAGCAGG - Intergenic
985013850 4:185612826-185612848 CAGAGTGAACTAAAGGGATGGGG + Intronic
985162795 4:187061863-187061885 CATGGAGAACTGAAGGAAGTGGG - Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986241426 5:5963417-5963439 GAGGGTGAACTGAAGCAGGCAGG + Intergenic
986599670 5:9459226-9459248 GAGTGTGAACAGGAGGAAGCAGG - Intronic
986615238 5:9610151-9610173 CAGAGGTAACAGAATGAAGCTGG + Intergenic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
989758479 5:44984763-44984785 CAGTTTGCACTGAAGGAAGCAGG - Intergenic
990231286 5:53715853-53715875 GAGAGTGAACAGAAGCAAGATGG + Intergenic
992492421 5:77258341-77258363 CAGAGTGAACTGATGGAGCATGG + Intronic
993028579 5:82675370-82675392 CACAGTGAACTGAAGTTAGCTGG + Intergenic
993060881 5:83037589-83037611 CAGAGTCATTAGAAGGAAGCAGG + Intergenic
994067191 5:95556357-95556379 CAAAGGCAAATGAAGGAAGCAGG + Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
997727118 5:136131334-136131356 CAGAGTGAGAGGAAGGGAGCGGG + Intergenic
998503135 5:142651071-142651093 CAGAGAGAGGTGAAGGAAGGCGG + Intronic
998631065 5:143899208-143899230 GAACTTGAACTGAAGGAAGCAGG - Intergenic
999397352 5:151238492-151238514 CAGGGTGAGCTGGAGGCAGCAGG - Intronic
999629866 5:153559867-153559889 AGGAGTGAACTCAAGGAAGTAGG - Intronic
999968823 5:156838378-156838400 CAGAGGAATCTGAAGGAAGGCGG + Intergenic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1002446028 5:179290692-179290714 CAGAGAGCACTGAGGGAGGCTGG - Intronic
1002581221 5:180210419-180210441 CAGAGTGAGGTGAAGGCAGCTGG - Intergenic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1004732709 6:18373777-18373799 CAGAGGGACCTGCAGAAAGCTGG + Intergenic
1006512680 6:34530148-34530170 CAGAGTCCACTCAGGGAAGCAGG - Intronic
1006624451 6:35387332-35387354 CAGGATGAACTCTAGGAAGCTGG + Intronic
1007943714 6:45806218-45806240 CAGAGTGACAGGAAGGAACCAGG + Intergenic
1008045739 6:46849588-46849610 CAGAGCCAAGTGAAGGATGCCGG - Intergenic
1008725606 6:54414656-54414678 GAGAGTAAAGTTAAGGAAGCTGG + Intergenic
1009240403 6:61179469-61179491 CAGAGTCACCTGGTGGAAGCTGG + Intergenic
1009555299 6:65156450-65156472 GAAAGGGAACTGAAGGAAGTTGG - Intronic
1009873222 6:69473904-69473926 CAGAGTGAGAAAAAGGAAGCAGG - Intergenic
1010349438 6:74854793-74854815 CTGAGGGATCTGAAGGATGCAGG + Intergenic
1010816251 6:80361131-80361153 CAGAGAGAAAAGAATGAAGCTGG - Intergenic
1011931601 6:92721520-92721542 CAAAGAGAAATGAAGGAAGGGGG - Intergenic
1011979223 6:93351323-93351345 CAGAGAGAAGGGAAGCAAGCAGG - Intronic
1012207548 6:96479190-96479212 GAGGGTGAACTGAAGCAAGGTGG - Intergenic
1012410073 6:98947383-98947405 CAGAGGGAAATCAAGGCAGCAGG + Intronic
1015181238 6:130365296-130365318 CAGAGGGAACTGAAGCACGGGGG - Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1019477462 7:1250951-1250973 CAGAGTGAAGTGAAGTCAGGGGG - Intergenic
1019895601 7:3980078-3980100 CAGAGTGAAGTCAAAGAAGATGG + Intronic
1022720656 7:32939448-32939470 CAGAGTGGACTGATGGAGTCAGG + Intergenic
1023293366 7:38690138-38690160 CAGAGTTGCCTGAAGGAATCTGG + Intergenic
1023694636 7:42832129-42832151 CAGAGTGAATTGTAGGATGGAGG - Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024930574 7:54663888-54663910 CAGAGGGACATGAAGGAAGCAGG + Intergenic
1028489796 7:91398615-91398637 CAGAGTGCCCTGAAGGGAGATGG - Intergenic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1029286137 7:99467413-99467435 CAGAATGAACTGAACGAGGGTGG - Intergenic
1030764380 7:113390651-113390673 CAGAGTGTAGTGAACAAAGCTGG + Intergenic
1031485991 7:122325209-122325231 CACAGTTACCTGAAGGAAGTAGG - Intronic
1032450276 7:132024674-132024696 AAGAGGGTAGTGAAGGAAGCAGG + Intergenic
1033172172 7:139093911-139093933 CAGAGTGATCAGAAGAAAGTCGG - Intronic
1033206555 7:139428097-139428119 AAGACTGAAATGAATGAAGCAGG + Intergenic
1033207694 7:139436916-139436938 CCGAGTGAAGTGAGGGCAGCAGG - Intergenic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1035057715 7:156046994-156047016 CAGACAGAAATGAAGGAAGGGGG + Intergenic
1035068010 7:156122046-156122068 CAAAGGCAAGTGAAGGAAGCTGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1042443857 8:68860890-68860912 CAGAGAGACCTGAATCAAGCCGG - Intergenic
1042542920 8:69924796-69924818 GAGAGTCAATTAAAGGAAGCCGG - Intergenic
1045342259 8:101265712-101265734 CAGAGTGAAGTCAAGGAAAGAGG - Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047235312 8:123036459-123036481 GACAGTGACCAGAAGGAAGCAGG + Intronic
1049092683 8:140528515-140528537 AAGAGGGAACTGTTGGAAGCAGG - Intergenic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1049505950 8:142998297-142998319 TAGACTGAACTAAAGGAAGACGG - Intergenic
1050037897 9:1456724-1456746 CAGATTGAGATGATGGAAGCTGG + Intergenic
1051413693 9:16816867-16816889 AAGAGTGAATTTAAGGCAGCTGG + Intronic
1051739803 9:20240337-20240359 CAAAGGGAACCCAAGGAAGCTGG + Intergenic
1053651834 9:40177120-40177142 CAGAGCCAAGTGAAGGATGCCGG + Intergenic
1054986068 9:71262812-71262834 GAGAGTGAGCTGAAGCAGGCTGG - Intronic
1056793826 9:89642868-89642890 CACAGTCTACTGAGGGAAGCAGG - Intergenic
1057265457 9:93614409-93614431 CAGAGGGAACAGAAGCTAGCTGG - Intronic
1057910872 9:99019668-99019690 CAGAGAGAAGTGAAGAAAACTGG - Intronic
1058506828 9:105674865-105674887 CAGAGGGAACGGTAAGAAGCAGG - Intergenic
1058906122 9:109484028-109484050 CAGAGTGAAGAGGAGGAAGTTGG - Intronic
1059139156 9:111835704-111835726 GAGAGTTAACTGATGGAATCAGG - Intergenic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1061074452 9:128332651-128332673 AAGAGTGAACAGAAGGGAGTAGG - Intronic
1062434185 9:136539266-136539288 TGGAGTGCTCTGAAGGAAGCTGG - Intronic
1062498669 9:136843188-136843210 CAGAGTGAGCTGGGGAAAGCGGG - Intronic
1187039669 X:15580299-15580321 CAGAGGGGAATGAGGGAAGCAGG - Intronic
1188397234 X:29700400-29700422 CAAAATGAACTGAAGCAAGTGGG - Intronic
1188698676 X:33231704-33231726 AAGAGTCAAGTGAAGGAAGTAGG + Intronic
1190255051 X:48756102-48756124 CAGAGTGAAATGAATGATGGAGG + Intergenic
1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG + Intergenic
1192822925 X:74663558-74663580 TAGAGTGAACTGGAAGGAGCTGG + Intergenic
1193206889 X:78759834-78759856 CAAAGTGAGCTCAAGGGAGCAGG - Intergenic
1194590536 X:95795099-95795121 AAGAGTGAAATGAAGGATTCAGG + Intergenic
1195579427 X:106484510-106484532 CAGAGTGAATGGTAGCAAGCAGG - Intergenic
1195940811 X:110166460-110166482 GTGAGTGAGTTGAAGGAAGCAGG + Intronic
1196747749 X:119086714-119086736 CCGAGGGCACTGAAGCAAGCTGG + Exonic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198558837 X:137826094-137826116 CATGATGAACTGGAGGAAGCAGG + Intergenic
1199927813 X:152487179-152487201 CAGACTGAGCTGGTGGAAGCTGG - Intergenic
1200052392 X:153441582-153441604 CAGATTAAACTGAAGAATGCTGG + Intergenic
1200235184 X:154464662-154464684 CATCGGGAACTGAAGGAAGAAGG - Intronic
1202164641 Y:21973965-21973987 CAGAAAGAACTGCAGAAAGCAGG + Intergenic
1202226715 Y:22612407-22612429 CAGAAAGAACTGCAGAAAGCAGG - Intergenic
1202316406 Y:23583253-23583275 CAGAAAGAACTGCAGAAAGCAGG + Intergenic
1202554358 Y:26086805-26086827 CAGAAAGAACTGCAGAAAGCAGG - Intergenic