ID: 952888895

View in Genome Browser
Species Human (GRCh38)
Location 3:38028505-38028527
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 156}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952888895_952888904 22 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG 0: 1
1: 0
2: 12
3: 299
4: 4159
952888895_952888901 -5 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888901 3:38028523-38028545 GAACAGTTTAGATGGATGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 217
952888895_952888899 -9 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888899 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 1
3: 16
4: 146
952888895_952888902 -2 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888902 3:38028526-38028548 CAGTTTAGATGGATGGGTGGTGG 0: 1
1: 1
2: 3
3: 24
4: 235
952888895_952888900 -8 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888900 3:38028520-38028542 CATGAACAGTTTAGATGGATGGG 0: 1
1: 0
2: 1
3: 9
4: 131
952888895_952888905 23 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888905 3:38028551-38028573 ACTAAAGCCTCCAACCCCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952888895 Original CRISPR TGTTCATGGACATAATAGAT GGG (reversed) Intronic