ID: 952888898 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:38028519-38028541 |
Sequence | CCATCCATCTAAACTGTTCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 144 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 132} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
952888898_952888912 | 26 | Left | 952888898 | 3:38028519-38028541 | CCATGAACAGTTTAGATGGATGG | 0: 1 1: 0 2: 0 3: 11 4: 132 |
||
Right | 952888912 | 3:38028568-38028590 | CAAGGGTACTAAAAAAGAGAGGG | 0: 1 1: 0 2: 0 3: 15 4: 263 |
||||
952888898_952888905 | 9 | Left | 952888898 | 3:38028519-38028541 | CCATGAACAGTTTAGATGGATGG | 0: 1 1: 0 2: 0 3: 11 4: 132 |
||
Right | 952888905 | 3:38028551-38028573 | ACTAAAGCCTCCAACCCCAAGGG | 0: 1 1: 0 2: 1 3: 12 4: 105 |
||||
952888898_952888904 | 8 | Left | 952888898 | 3:38028519-38028541 | CCATGAACAGTTTAGATGGATGG | 0: 1 1: 0 2: 0 3: 11 4: 132 |
||
Right | 952888904 | 3:38028550-38028572 | CACTAAAGCCTCCAACCCCAAGG | 0: 1 1: 0 2: 12 3: 299 4: 4159 |
||||
952888898_952888911 | 25 | Left | 952888898 | 3:38028519-38028541 | CCATGAACAGTTTAGATGGATGG | 0: 1 1: 0 2: 0 3: 11 4: 132 |
||
Right | 952888911 | 3:38028567-38028589 | CCAAGGGTACTAAAAAAGAGAGG | 0: 1 1: 0 2: 0 3: 5 4: 136 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
952888898 | Original CRISPR | CCATCCATCTAAACTGTTCA TGG (reversed) | Intronic | ||