ID: 952888898

View in Genome Browser
Species Human (GRCh38)
Location 3:38028519-38028541
Sequence CCATCCATCTAAACTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952888898_952888904 8 Left 952888898 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG 0: 1
1: 0
2: 12
3: 299
4: 4159
952888898_952888911 25 Left 952888898 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 952888911 3:38028567-38028589 CCAAGGGTACTAAAAAAGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 136
952888898_952888905 9 Left 952888898 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 952888905 3:38028551-38028573 ACTAAAGCCTCCAACCCCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 105
952888898_952888912 26 Left 952888898 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 952888912 3:38028568-38028590 CAAGGGTACTAAAAAAGAGAGGG 0: 1
1: 0
2: 0
3: 15
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952888898 Original CRISPR CCATCCATCTAAACTGTTCA TGG (reversed) Intronic