ID: 952888899

View in Genome Browser
Species Human (GRCh38)
Location 3:38028519-38028541
Sequence CCATGAACAGTTTAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952888893_952888899 2 Left 952888893 3:38028494-38028516 CCCTTCTCTTTCCCATCTATTAT 0: 1
1: 0
2: 6
3: 74
4: 736
Right 952888899 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 1
3: 16
4: 146
952888895_952888899 -9 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888899 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 1
3: 16
4: 146
952888894_952888899 1 Left 952888894 3:38028495-38028517 CCTTCTCTTTCCCATCTATTATG 0: 1
1: 0
2: 4
3: 41
4: 434
Right 952888899 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 1
3: 16
4: 146
952888896_952888899 -10 Left 952888896 3:38028506-38028528 CCATCTATTATGTCCATGAACAG 0: 1
1: 0
2: 1
3: 9
4: 206
Right 952888899 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 1
3: 16
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952888899 Original CRISPR CCATGAACAGTTTAGATGGA TGG Intronic