ID: 952888900 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:38028520-38028542 |
| Sequence | CATGAACAGTTTAGATGGAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 142 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 9, 4: 131} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952888895_952888900 | -8 | Left | 952888895 | 3:38028505-38028527 | CCCATCTATTATGTCCATGAACA | 0: 1 1: 0 2: 1 3: 9 4: 156 |
||
| Right | 952888900 | 3:38028520-38028542 | CATGAACAGTTTAGATGGATGGG | 0: 1 1: 0 2: 1 3: 9 4: 131 |
||||
| 952888894_952888900 | 2 | Left | 952888894 | 3:38028495-38028517 | CCTTCTCTTTCCCATCTATTATG | 0: 1 1: 0 2: 4 3: 41 4: 434 |
||
| Right | 952888900 | 3:38028520-38028542 | CATGAACAGTTTAGATGGATGGG | 0: 1 1: 0 2: 1 3: 9 4: 131 |
||||
| 952888893_952888900 | 3 | Left | 952888893 | 3:38028494-38028516 | CCCTTCTCTTTCCCATCTATTAT | 0: 1 1: 0 2: 6 3: 74 4: 736 |
||
| Right | 952888900 | 3:38028520-38028542 | CATGAACAGTTTAGATGGATGGG | 0: 1 1: 0 2: 1 3: 9 4: 131 |
||||
| 952888896_952888900 | -9 | Left | 952888896 | 3:38028506-38028528 | CCATCTATTATGTCCATGAACAG | 0: 1 1: 0 2: 1 3: 9 4: 206 |
||
| Right | 952888900 | 3:38028520-38028542 | CATGAACAGTTTAGATGGATGGG | 0: 1 1: 0 2: 1 3: 9 4: 131 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952888900 | Original CRISPR | CATGAACAGTTTAGATGGAT GGG | Intronic | ||