ID: 952888902

View in Genome Browser
Species Human (GRCh38)
Location 3:38028526-38028548
Sequence CAGTTTAGATGGATGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952888895_952888902 -2 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888902 3:38028526-38028548 CAGTTTAGATGGATGGGTGGTGG 0: 1
1: 1
2: 3
3: 24
4: 235
952888893_952888902 9 Left 952888893 3:38028494-38028516 CCCTTCTCTTTCCCATCTATTAT 0: 1
1: 0
2: 6
3: 74
4: 736
Right 952888902 3:38028526-38028548 CAGTTTAGATGGATGGGTGGTGG 0: 1
1: 1
2: 3
3: 24
4: 235
952888894_952888902 8 Left 952888894 3:38028495-38028517 CCTTCTCTTTCCCATCTATTATG 0: 1
1: 0
2: 4
3: 41
4: 434
Right 952888902 3:38028526-38028548 CAGTTTAGATGGATGGGTGGTGG 0: 1
1: 1
2: 3
3: 24
4: 235
952888896_952888902 -3 Left 952888896 3:38028506-38028528 CCATCTATTATGTCCATGAACAG 0: 1
1: 0
2: 1
3: 9
4: 206
Right 952888902 3:38028526-38028548 CAGTTTAGATGGATGGGTGGTGG 0: 1
1: 1
2: 3
3: 24
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952888902 Original CRISPR CAGTTTAGATGGATGGGTGG TGG Intronic