ID: 952888902 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:38028526-38028548 |
Sequence | CAGTTTAGATGGATGGGTGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 264 | |||
Summary | {0: 1, 1: 1, 2: 3, 3: 24, 4: 235} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
952888895_952888902 | -2 | Left | 952888895 | 3:38028505-38028527 | CCCATCTATTATGTCCATGAACA | 0: 1 1: 0 2: 1 3: 9 4: 156 |
||
Right | 952888902 | 3:38028526-38028548 | CAGTTTAGATGGATGGGTGGTGG | 0: 1 1: 1 2: 3 3: 24 4: 235 |
||||
952888893_952888902 | 9 | Left | 952888893 | 3:38028494-38028516 | CCCTTCTCTTTCCCATCTATTAT | 0: 1 1: 0 2: 6 3: 74 4: 736 |
||
Right | 952888902 | 3:38028526-38028548 | CAGTTTAGATGGATGGGTGGTGG | 0: 1 1: 1 2: 3 3: 24 4: 235 |
||||
952888894_952888902 | 8 | Left | 952888894 | 3:38028495-38028517 | CCTTCTCTTTCCCATCTATTATG | 0: 1 1: 0 2: 4 3: 41 4: 434 |
||
Right | 952888902 | 3:38028526-38028548 | CAGTTTAGATGGATGGGTGGTGG | 0: 1 1: 1 2: 3 3: 24 4: 235 |
||||
952888896_952888902 | -3 | Left | 952888896 | 3:38028506-38028528 | CCATCTATTATGTCCATGAACAG | 0: 1 1: 0 2: 1 3: 9 4: 206 |
||
Right | 952888902 | 3:38028526-38028548 | CAGTTTAGATGGATGGGTGGTGG | 0: 1 1: 1 2: 3 3: 24 4: 235 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
952888902 | Original CRISPR | CAGTTTAGATGGATGGGTGG TGG | Intronic | ||