ID: 952888904 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:38028550-38028572 |
Sequence | CACTAAAGCCTCCAACCCCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4471 | |||
Summary | {0: 1, 1: 0, 2: 12, 3: 299, 4: 4159} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
952888895_952888904 | 22 | Left | 952888895 | 3:38028505-38028527 | CCCATCTATTATGTCCATGAACA | 0: 1 1: 0 2: 1 3: 9 4: 156 |
||
Right | 952888904 | 3:38028550-38028572 | CACTAAAGCCTCCAACCCCAAGG | 0: 1 1: 0 2: 12 3: 299 4: 4159 |
||||
952888898_952888904 | 8 | Left | 952888898 | 3:38028519-38028541 | CCATGAACAGTTTAGATGGATGG | 0: 1 1: 0 2: 0 3: 11 4: 132 |
||
Right | 952888904 | 3:38028550-38028572 | CACTAAAGCCTCCAACCCCAAGG | 0: 1 1: 0 2: 12 3: 299 4: 4159 |
||||
952888896_952888904 | 21 | Left | 952888896 | 3:38028506-38028528 | CCATCTATTATGTCCATGAACAG | 0: 1 1: 0 2: 1 3: 9 4: 206 |
||
Right | 952888904 | 3:38028550-38028572 | CACTAAAGCCTCCAACCCCAAGG | 0: 1 1: 0 2: 12 3: 299 4: 4159 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
952888904 | Original CRISPR | CACTAAAGCCTCCAACCCCA AGG | Intronic | ||