ID: 952888904

View in Genome Browser
Species Human (GRCh38)
Location 3:38028550-38028572
Sequence CACTAAAGCCTCCAACCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4471
Summary {0: 1, 1: 0, 2: 12, 3: 299, 4: 4159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952888895_952888904 22 Left 952888895 3:38028505-38028527 CCCATCTATTATGTCCATGAACA 0: 1
1: 0
2: 1
3: 9
4: 156
Right 952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG 0: 1
1: 0
2: 12
3: 299
4: 4159
952888896_952888904 21 Left 952888896 3:38028506-38028528 CCATCTATTATGTCCATGAACAG 0: 1
1: 0
2: 1
3: 9
4: 206
Right 952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG 0: 1
1: 0
2: 12
3: 299
4: 4159
952888898_952888904 8 Left 952888898 3:38028519-38028541 CCATGAACAGTTTAGATGGATGG 0: 1
1: 0
2: 0
3: 11
4: 132
Right 952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG 0: 1
1: 0
2: 12
3: 299
4: 4159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952888904 Original CRISPR CACTAAAGCCTCCAACCCCA AGG Intronic
Too many off-targets to display for this crispr