ID: 952889264

View in Genome Browser
Species Human (GRCh38)
Location 3:38029859-38029881
Sequence CCCGTGGGTGGCGGCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952889264_952889285 29 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG No data
Right 952889285 3:38029911-38029933 CGGGCCCCACGCCCTGTTGTGGG No data
952889264_952889276 2 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG No data
Right 952889276 3:38029884-38029906 GCGGGCCCTGTCATTACCGCGGG No data
952889264_952889281 10 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG No data
Right 952889281 3:38029892-38029914 TGTCATTACCGCGGGCGGCCGGG No data
952889264_952889284 28 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG No data
Right 952889284 3:38029910-38029932 CCGGGCCCCACGCCCTGTTGTGG No data
952889264_952889275 1 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG No data
Right 952889275 3:38029883-38029905 CGCGGGCCCTGTCATTACCGCGG No data
952889264_952889280 9 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG No data
Right 952889280 3:38029891-38029913 CTGTCATTACCGCGGGCGGCCGG No data
952889264_952889277 5 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG No data
Right 952889277 3:38029887-38029909 GGCCCTGTCATTACCGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952889264 Original CRISPR CCCGTGGGTGGCGGCGGCGG AGG (reversed) Intergenic