ID: 952889264

View in Genome Browser
Species Human (GRCh38)
Location 3:38029859-38029881
Sequence CCCGTGGGTGGCGGCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1479
Summary {0: 1, 1: 1, 2: 18, 3: 184, 4: 1275}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952889264_952889284 28 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG 0: 1
1: 1
2: 18
3: 184
4: 1275
Right 952889284 3:38029910-38029932 CCGGGCCCCACGCCCTGTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 115
952889264_952889276 2 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG 0: 1
1: 1
2: 18
3: 184
4: 1275
Right 952889276 3:38029884-38029906 GCGGGCCCTGTCATTACCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 29
952889264_952889275 1 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG 0: 1
1: 1
2: 18
3: 184
4: 1275
Right 952889275 3:38029883-38029905 CGCGGGCCCTGTCATTACCGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
952889264_952889281 10 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG 0: 1
1: 1
2: 18
3: 184
4: 1275
Right 952889281 3:38029892-38029914 TGTCATTACCGCGGGCGGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 23
952889264_952889285 29 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG 0: 1
1: 1
2: 18
3: 184
4: 1275
Right 952889285 3:38029911-38029933 CGGGCCCCACGCCCTGTTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 76
952889264_952889280 9 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG 0: 1
1: 1
2: 18
3: 184
4: 1275
Right 952889280 3:38029891-38029913 CTGTCATTACCGCGGGCGGCCGG 0: 1
1: 0
2: 1
3: 2
4: 23
952889264_952889277 5 Left 952889264 3:38029859-38029881 CCTCCGCCGCCGCCACCCACGGG 0: 1
1: 1
2: 18
3: 184
4: 1275
Right 952889277 3:38029887-38029909 GGCCCTGTCATTACCGCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952889264 Original CRISPR CCCGTGGGTGGCGGCGGCGG AGG (reversed) Intergenic
900414670 1:2529499-2529521 CTGGTGCGCGGCGGCGGCGGCGG + Exonic
900414672 1:2529505-2529527 CGCGGCGGCGGCGGCGGCGGTGG + Exonic
900970998 1:5992389-5992411 CCCGCGGGTGGCAGCGGACGGGG - Exonic
901057402 1:6455101-6455123 GCCGTGGGCGGCGGCGGCGCTGG - Intronic
901086215 1:6613797-6613819 GCAGGGGGCGGCGGCGGCGGCGG - Exonic
901551385 1:9997948-9997970 CTCGTGGGAGGCGGCGGTCGGGG - Intronic
901628934 1:10638914-10638936 CCCGCGGGTGGCCCTGGCGGCGG - Exonic
901641342 1:10694603-10694625 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
901704231 1:11061208-11061230 ACTGTGGGAGGCGGAGGCGGAGG + Intergenic
901743820 1:11359552-11359574 CATGTGTGTGGGGGCGGCGGTGG - Intergenic
901805573 1:11736446-11736468 GCCGTGGGAGGTGGCAGCGGAGG + Intronic
902169423 1:14598536-14598558 CCCCGGGGGGGCGGAGGCGGCGG - Intergenic
902476957 1:16693378-16693400 GCCGTGGGCGGCGGCGGCGCTGG + Intergenic
902823238 1:18956232-18956254 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
902823239 1:18956235-18956257 CCTGGCGGGGGCGGCGGCGGCGG - Exonic
902823251 1:18956262-18956284 CCGCCGGGCGGCGGCGGCGGGGG - Exonic
902893334 1:19461082-19461104 CCCCTGGGCGGGGGCGGGGGGGG + Intronic
902950983 1:19882634-19882656 CCGGAGTCTGGCGGCGGCGGCGG + Exonic
903034496 1:20485484-20485506 CCCGCGGGCTGCTGCGGCGGTGG + Exonic
903055491 1:20633497-20633519 GCCGGTGGTGGCGGCAGCGGCGG + Exonic
903115635 1:21176591-21176613 GCCGGCGGCGGCGGCGGCGGAGG - Intronic
903181491 1:21607152-21607174 CCTGTGGGTGGAGGAGACGGTGG + Intronic
903226905 1:21898930-21898952 TCAGCGGGTGGCGGCGGGGGTGG + Intronic
903247740 1:22028543-22028565 GCCGTGGGGGGCGGCGGGGCGGG - Intergenic
903324738 1:22563446-22563468 CCCGCCCGGGGCGGCGGCGGCGG + Intergenic
903324740 1:22563449-22563471 GCCCGGGGCGGCGGCGGCGGCGG + Intergenic
903492878 1:23743219-23743241 AGCGGGGGTGCCGGCGGCGGAGG + Exonic
903514805 1:23903074-23903096 TTCATGGGCGGCGGCGGCGGCGG + Intronic
903829118 1:26164412-26164434 CTCGCAGGCGGCGGCGGCGGCGG - Intergenic
903829121 1:26164415-26164437 CCCCTCGCAGGCGGCGGCGGCGG - Intergenic
903875861 1:26472673-26472695 CACCAGGGAGGCGGCGGCGGCGG - Intronic
903907302 1:26696204-26696226 CTCCGGGCTGGCGGCGGCGGAGG - Exonic
903907390 1:26696449-26696471 TCCGAGGGCGGCGGCGGCGGCGG - Exonic
903907451 1:26696641-26696663 AATGGGGGTGGCGGCGGCGGCGG + Exonic
903907710 1:26697493-26697515 CCCGGGAGCAGCGGCGGCGGGGG + Exonic
904029020 1:27522496-27522518 CAGGGCGGTGGCGGCGGCGGTGG + Intergenic
904039293 1:27575174-27575196 CCCAGAGGCGGCGGCGGCGGCGG - Intronic
904253114 1:29238361-29238383 CCCGCCGGTGGCGAGGGCGGGGG - Intronic
904612892 1:31735149-31735171 CCCCTGGGGGGCGGTGGGGGTGG - Intronic
904641987 1:31938057-31938079 CACCTCGGCGGCGGCGGCGGCGG + Exonic
904641989 1:31938060-31938082 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
904720063 1:32500827-32500849 CCTGGCGGCGGCGGCGGCGGCGG + Intronic
904822729 1:33256164-33256186 CCAGGCGGTGGCGGCGGCGGCGG + Intergenic
905137070 1:35808165-35808187 CCCGTTGGCGGCGGCGGCGGCGG + Exonic
905137121 1:35808338-35808360 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
905414384 1:37794393-37794415 GCGGTGCGGGGCGGCGGCGGCGG - Exonic
905419927 1:37834398-37834420 ACAGAGGGTGGGGGCGGCGGGGG + Intronic
905449248 1:38046499-38046521 CCCACGGGAGGAGGCGGCGGCGG - Exonic
905449284 1:38046641-38046663 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
905553135 1:38859724-38859746 GGCGGTGGTGGCGGCGGCGGCGG - Exonic
905734609 1:40316757-40316779 CCCCTGGGAGGCGGCGGGGGCGG + Intronic
906204396 1:43979336-43979358 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
906321512 1:44820317-44820339 CCCGTGGGCGGCGCCGGGTGCGG + Intronic
906556603 1:46719037-46719059 GGCGTTGGTGGCGGCGGCTGCGG + Exonic
906637013 1:47416488-47416510 GCCCGGGGCGGCGGCGGCGGCGG + Exonic
906640484 1:47438103-47438125 CCGGAGAGTGGCGGCGGCGGCGG + Exonic
906919384 1:50048020-50048042 GCAGGGGGTGGCGGCGGCGACGG + Intronic
906960918 1:50419097-50419119 CCCCCCGGCGGCGGCGGCGGCGG + Exonic
906960922 1:50419100-50419122 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
907010629 1:50959890-50959912 CCCGGCGGCGGCGGCGGCGGTGG - Exonic
907275364 1:53313959-53313981 GCAGTGGGTGGCAGGGGCGGGGG + Intronic
907341233 1:53737928-53737950 ACCGTGAGTGGCGGCGGCTGCGG - Intergenic
907341547 1:53739191-53739213 CCCGCAGGACGCGGCGGCGGCGG - Intergenic
908128126 1:61050444-61050466 CCCGTGAGTGCCGGCGGGGCGGG + Intronic
908581895 1:65525489-65525511 CGCGCAGGTGGCGGGGGCGGCGG - Intronic
909622500 1:77683477-77683499 CTGGCGGGCGGCGGCGGCGGCGG + Intergenic
910448993 1:87328532-87328554 CTCGGAGGCGGCGGCGGCGGCGG - Exonic
910759001 1:90717597-90717619 CCCGGCAGCGGCGGCGGCGGCGG - Intergenic
911133824 1:94418423-94418445 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
913186383 1:116373603-116373625 CCAGCGGGAGGCGGCGGAGGAGG + Intronic
913565560 1:120069427-120069449 CCAGGCGGCGGCGGCGGCGGCGG - Exonic
913632570 1:120724126-120724148 CCAGGCGGCGGCGGCGGCGGCGG + Intergenic
914428600 1:147600195-147600217 CCCGGCGGCGGCAGCGGCGGCGG - Intronic
914619318 1:149390800-149390822 CCAGGCGGCGGCGGCGGCGGCGG + Intergenic
914889754 1:151612250-151612272 AACGGAGGTGGCGGCGGCGGCGG + Exonic
915200114 1:154220995-154221017 GGCGTTGGCGGCGGCGGCGGCGG + Intronic
915214105 1:154328768-154328790 GGCATGGGGGGCGGCGGCGGCGG + Intronic
915246347 1:154558627-154558649 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
915322429 1:155063110-155063132 CCCTCAGGTGGCGGCGGCGGAGG - Intergenic
915325321 1:155078911-155078933 TCGGGGGGCGGCGGCGGCGGCGG + Exonic
915344009 1:155189983-155190005 ACCGTGGGTTGGGGGGGCGGTGG + Intronic
915393362 1:155563179-155563201 CCGGTGGTTGGAGGCCGCGGCGG + Intergenic
915409480 1:155689024-155689046 CCGGTGGTTGGAGGCCGCGGCGG + Intronic
915493680 1:156266237-156266259 TGGGTGGGTGGCGGCGACGGCGG + Exonic
915510742 1:156385727-156385749 CCCTTGGGTGGGGGTCGCGGCGG - Intergenic
915568226 1:156728619-156728641 GGCGTGGGTGGGGGCGGGGGCGG + Exonic
915911891 1:159920511-159920533 CCAATGGGTGGCGGTGGCTGCGG + Exonic
916065504 1:161132640-161132662 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
916651667 1:166839612-166839634 CGCGCGGGCGGGGGCGGCGGCGG + Intronic
916922680 1:169485721-169485743 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
917755400 1:178093805-178093827 CACGGCGGTGGCGGTGGCGGTGG - Intergenic
917869599 1:179229641-179229663 GGCGGCGGTGGCGGCGGCGGCGG - Intronic
918275765 1:182952872-182952894 CACGGGAGAGGCGGCGGCGGCGG - Exonic
919712283 1:200739614-200739636 CCCGGGAGCGGCGGCGGCGGCGG + Exonic
919744609 1:201000550-201000572 CCCGTGAGAGGCTGCGGCGCAGG + Exonic
919926348 1:202193847-202193869 CTATTGGGCGGCGGCGGCGGCGG - Intergenic
919937583 1:202264848-202264870 CCCTGGGGTGGTGGCGGGGGCGG - Intronic
920705007 1:208244296-208244318 TCCCGCGGTGGCGGCGGCGGCGG + Exonic
920705010 1:208244299-208244321 CGCGGTGGCGGCGGCGGCGGCGG + Exonic
920827091 1:209432270-209432292 TACGGTGGTGGCGGCGGCGGTGG - Intergenic
921023737 1:211259313-211259335 CGCGGGGCGGGCGGCGGCGGAGG + Intronic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
922287548 1:224183261-224183283 CTCAGAGGTGGCGGCGGCGGCGG - Exonic
922315077 1:224434676-224434698 CCCGGCAGTGGCTGCGGCGGCGG + Intronic
922504437 1:226118475-226118497 GCTGTGGGTGGCGGGGGTGGTGG + Intergenic
922786108 1:228283052-228283074 CCAGTGGGTGGCGCCAGGGGAGG + Exonic
922958588 1:229625910-229625932 CCCGGAGGCGGCGGCGGCGGGGG - Exonic
923141457 1:231163732-231163754 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
923644821 1:235808423-235808445 TGTGTGGGTGGCGGCGGGGGCGG - Intronic
923744306 1:236686412-236686434 GCCGGGGGCGGTGGCGGCGGGGG + Intergenic
924289721 1:242524713-242524735 TCCCGGGGCGGCGGCGGCGGCGG + Intergenic
924754785 1:246931491-246931513 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1063671529 10:8103383-8103405 CCCGAGGCTGGAGGCGGGGGGGG + Intergenic
1063809898 10:9692862-9692884 CCAAAGGGTGGCGGTGGCGGGGG - Intergenic
1064179187 10:13100180-13100202 CCGGCGGGCGGCGGCGGTGGCGG - Exonic
1064205703 10:13321778-13321800 GCTGTGGGTGGCGGCCTCGGCGG + Intronic
1064209077 10:13348111-13348133 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1064230921 10:13528881-13528903 CCGGGGCGCGGCGGCGGCGGCGG + Intronic
1064274260 10:13891973-13891995 GCGGGCGGTGGCGGCGGCGGTGG - Intronic
1064384763 10:14879616-14879638 CGCGTGGGTGTGGGCGTCGGGGG + Intronic
1064443054 10:15370884-15370906 CGCGGAGGCGGCGGCGGCGGCGG - Intronic
1064443173 10:15371243-15371265 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1064645372 10:17454330-17454352 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1064981871 10:21173844-21173866 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1065024203 10:21526066-21526088 CCCGGGGCTGGCGGCGGGGGCGG - Intergenic
1065342976 10:24723680-24723702 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1065390077 10:25174575-25174597 CCCGCGGGCGGCGGGGGCGCGGG - Intergenic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065712825 10:28533495-28533517 CGCGCAGGCGGCGGCGGCGGCGG - Exonic
1065712871 10:28533651-28533673 GCGGCGGGGGGCGGCGGCGGGGG + Intronic
1065712949 10:28533902-28533924 CCCGCGGGGAGGGGCGGCGGGGG + Intronic
1066220760 10:33335124-33335146 CGCGTGGGTGCGGGCGTCGGAGG + Intronic
1066429330 10:35336850-35336872 GCCATGGGCGGCGGCGGCGGCGG - Intronic
1066460341 10:35607837-35607859 CCCGGGGGTCGGGGCAGCGGCGG - Exonic
1066464214 10:35639478-35639500 CCGGGGGGCGGCGGCGGCGGGGG - Exonic
1066659068 10:37721643-37721665 CCTGGGGGTGGCGGTGGCTGGGG - Intergenic
1067096541 10:43305058-43305080 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1067694201 10:48523733-48523755 CCCGGGGCTGGCCGCGGCGCCGG - Intronic
1068204174 10:53827429-53827451 CCTGGCGGAGGCGGCGGCGGCGG + Exonic
1068690155 10:59906294-59906316 GGCGGGGGAGGCGGCGGCGGTGG - Exonic
1068989116 10:63133252-63133274 GCCGTGCGTGGCCTCGGCGGTGG + Intronic
1070800781 10:79243343-79243365 CTCCTCGGCGGCGGCGGCGGCGG + Intronic
1070800834 10:79243559-79243581 CCCGGCGGCGGCGGCGGCGCGGG - Intronic
1070810765 10:79296661-79296683 CCCGTGGGTGGTGGCGAGGCTGG - Intronic
1070954304 10:80454350-80454372 CCCGCGCGCGGCGGCGGCAGCGG - Exonic
1071507316 10:86240573-86240595 CTCTTGGGTGGGTGCGGCGGGGG + Intronic
1071784086 10:88880161-88880183 CTCCTCTGTGGCGGCGGCGGCGG - Exonic
1072562231 10:96586896-96586918 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1072710791 10:97714469-97714491 CCCGCGCGGGGCGGCGGCGGGGG - Exonic
1072719462 10:97771812-97771834 CATGCGGGCGGCGGCGGCGGGGG - Exonic
1072731574 10:97850212-97850234 CAGGTGGGCGGCGGCGGTGGCGG - Intergenic
1072915542 10:99535512-99535534 CCGGCGGGCGGCGGCGGCGGCGG + Exonic
1072926351 10:99620379-99620401 CCGGGGGGCGGCGGCGGCAGTGG - Intronic
1073122648 10:101131872-101131894 CCCGGTCCTGGCGGCGGCGGCGG + Exonic
1073137376 10:101227439-101227461 GCCGGCGGTGGCGGCGGCTGCGG - Exonic
1074121688 10:110498098-110498120 CCGCTGGCCGGCGGCGGCGGCGG + Exonic
1074503358 10:114045010-114045032 CGGGGCGGTGGCGGCGGCGGCGG - Exonic
1074618592 10:115093820-115093842 CCGGCGGGCGGCGGCGGCGGGGG + Exonic
1074996339 10:118760370-118760392 ACCTGGGCTGGCGGCGGCGGAGG - Intergenic
1075144575 10:119872507-119872529 TCGGTGAGTGGCGGCGCCGGGGG - Exonic
1075629317 10:123991684-123991706 CGGGGCGGTGGCGGCGGCGGCGG + Intergenic
1075645438 10:124093255-124093277 CGCGGTGGTGGCGGTGGCGGTGG - Intronic
1075697483 10:124447619-124447641 GCGGGGGGCGGCGGCGGCGGCGG - Exonic
1075697484 10:124447622-124447644 GCGGCGGGGGGCGGCGGCGGCGG - Exonic
1075802011 10:125159914-125159936 CCGGAGGGCAGCGGCGGCGGCGG - Intronic
1076554207 10:131311517-131311539 ACCCAGGGCGGCGGCGGCGGCGG + Exonic
1076554276 10:131311788-131311810 TCCGGGGGCGGCGGCGGCGCGGG - Intergenic
1076638914 10:131901019-131901041 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1076722086 10:132397162-132397184 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1076792880 10:132786106-132786128 CGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1076868900 10:133183092-133183114 GACGTGGGTGGCGGCAGGGGCGG + Intronic
1077008391 11:369592-369614 CCCGGGGTGGGCGGCGGGGGCGG - Intergenic
1077029144 11:455892-455914 CCCGGGTGTGGCTGGGGCGGGGG + Intronic
1077214547 11:1389999-1390021 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1077318201 11:1928514-1928536 CCTGTGGGTGGGGGCTGTGGTGG + Intronic
1077437512 11:2549910-2549932 GCGCTGGGTGGCGGGGGCGGTGG - Intronic
1077551960 11:3204397-3204419 CCCGTGGGTGGGGGTGCGGGAGG + Intergenic
1077922974 11:6655484-6655506 CCCCTGGGCTGCGGCAGCGGCGG - Intronic
1078057408 11:8019255-8019277 TCCGCGGGCGGCGGCGGCGCTGG - Intronic
1078190843 11:9091613-9091635 GCCGGGGGTGGCAGCGGCAGCGG - Intronic
1078210293 11:9265050-9265072 GCCATGAGTGGCGGCGGCGGCGG - Exonic
1078316054 11:10294111-10294133 CGGGTGGGCGGCGGCGGCGAGGG - Exonic
1078699677 11:13668729-13668751 CGCGACGGCGGCGGCGGCGGCGG + Exonic
1079296726 11:19241328-19241350 CGGGAGGGTGGCGGCGGCGGCGG - Intronic
1079451180 11:20601173-20601195 CCCGGAGGCGGCGGCGGCGCAGG + Exonic
1080036680 11:27719129-27719151 CCCGGGGGTGCAGGCGGGGGCGG + Intronic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080588334 11:33700499-33700521 CCGGGTGGTGGCGGGGGCGGGGG + Exonic
1081646651 11:44795074-44795096 CCCGGGGGTGGGGGTGGGGGTGG - Intronic
1081831512 11:46119973-46119995 CCCGCGGCCGCCGGCGGCGGGGG + Intronic
1081925751 11:46826821-46826843 CCGGCAGGCGGCGGCGGCGGCGG + Intronic
1081932178 11:46879123-46879145 CACCTGGGGGCCGGCGGCGGTGG + Exonic
1082045260 11:47720831-47720853 GCCGGGGGCGGTGGCGGCGGCGG + Intronic
1082843931 11:57712070-57712092 CCCGCAGGAGGCGGTGGCGGGGG + Exonic
1083171091 11:60924493-60924515 CGCGGGGCGGGCGGCGGCGGCGG + Exonic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1083691113 11:64409533-64409555 CCCGGAGGTGGTGGGGGCGGGGG - Intergenic
1083751967 11:64765966-64765988 CCAGGCGGTGGAGGCGGCGGAGG + Intronic
1083752246 11:64767022-64767044 CCACTGGGAGGCGGCGGCGGCGG + Exonic
1083753753 11:64778232-64778254 CCCACGGGCGGGGGCGGCGGCGG + Exonic
1083970304 11:66070405-66070427 CCCCGCGGCGGCGGCGGCGGGGG - Intronic
1084000179 11:66291859-66291881 CCCGAGCGCGGCGGCAGCGGCGG - Exonic
1084129036 11:67119340-67119362 CCCGGCAGCGGCGGCGGCGGCGG + Intronic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1085284630 11:75351734-75351756 ACCGGGGGCGGGGGCGGCGGCGG - Intergenic
1085388982 11:76172586-76172608 GGCCTGGGTGGCGGCGGGGGTGG + Intergenic
1085485666 11:76860950-76860972 CGCCTGGGCGGCGGCGGCGGCGG + Exonic
1086887743 11:92224599-92224621 CGCGCGGGAGGGGGCGGCGGAGG - Intergenic
1087014644 11:93543295-93543317 CCCGGCAGTGGTGGCGGCGGCGG - Exonic
1088172833 11:107017831-107017853 CCCGGCAGTGGCAGCGGCGGCGG + Exonic
1089046330 11:115504343-115504365 CCAGTGTGCGGCGGCAGCGGCGG - Exonic
1089253113 11:117179218-117179240 AGCGGTGGTGGCGGCGGCGGCGG - Exonic
1089432652 11:118436558-118436580 ACCGGGGGCGGCGGCGGCGGGGG + Exonic
1089432709 11:118436683-118436705 CCCGGCTGTGGCGGCCGCGGCGG + Exonic
1089494735 11:118902373-118902395 GCCGTGGGTGGCTGCTGGGGGGG + Exonic
1089533948 11:119149471-119149493 CCCGGGGGTGCCGGCGGGAGGGG + Intronic
1089543667 11:119206288-119206310 GCCGGCGGCGGCGGCGGCGGCGG + Exonic
1089729458 11:120511521-120511543 CGCGGGGGCGGCGGGGGCGGCGG - Intergenic
1090635806 11:128689871-128689893 TACGTGGGAGGCCGCGGCGGCGG - Intronic
1091759457 12:3077382-3077404 TCCGCTGGCGGCGGCGGCGGCGG + Exonic
1092727678 12:11500713-11500735 CCCGGCGGTGGCGGCGGCAGCGG - Intronic
1093894676 12:24562724-24562746 CCCGGGGGGTGCGGCGGGGGCGG + Intergenic
1094653432 12:32399393-32399415 GCCGGAGGAGGCGGCGGCGGCGG + Intergenic
1094703998 12:32896964-32896986 CCCGGGGGCGGGGGCGGGGGCGG + Intergenic
1095752804 12:45729689-45729711 GCCGGCGGTGGCGGCGGCGGCGG - Exonic
1096214737 12:49792798-49792820 CCAGTGTGTGGGCGCGGCGGGGG + Exonic
1096570455 12:52520163-52520185 TCCGGGGGTGGCGGTGGTGGTGG - Exonic
1096593115 12:52675485-52675507 TCTGGAGGTGGCGGCGGCGGCGG - Exonic
1096598672 12:52714392-52714414 AGCCGGGGTGGCGGCGGCGGCGG - Intergenic
1096674518 12:53219391-53219413 CCCCTGCGTGGCTGCGGGGGCGG - Intronic
1096695321 12:53344993-53345015 CCCGGGGGAGGGGGCGGCGGCGG + Intronic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1096784406 12:54009030-54009052 CGAGCGGGCGGCGGCGGCGGCGG - Intronic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096983738 12:55743397-55743419 CCCCGCGGCGGCGGCGGCGGCGG + Exonic
1096983741 12:55743400-55743422 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097107697 12:56635032-56635054 CCCTGGGCCGGCGGCGGCGGAGG + Intronic
1097264422 12:57737515-57737537 CCCGGCGGCGGCGGCGGTGGCGG + Exonic
1097648167 12:62260721-62260743 CCGGGGAGCGGCGGCGGCGGCGG + Intronic
1097664805 12:62466742-62466764 GCCGGGGTTGGCCGCGGCGGTGG + Intergenic
1097990092 12:65825009-65825031 GCCGGTGGCGGCGGCGGCGGTGG - Exonic
1097990093 12:65825012-65825034 GCTGCCGGTGGCGGCGGCGGCGG - Exonic
1098105960 12:67069306-67069328 CCGGGCGGCGGCGGCGGCGGCGG + Intergenic
1098320570 12:69239602-69239624 CCTGCAGGAGGCGGCGGCGGCGG + Exonic
1099413379 12:82358914-82358936 CAGGTGCGTGGCGGCGGAGGCGG + Intronic
1100209757 12:92388749-92388771 CCCAGGGGTGGGGGGGGCGGTGG - Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100423410 12:94459802-94459824 TCCGAGGGCGGCGGCGGCGGCGG + Exonic
1100565557 12:95790682-95790704 CCAGGAGGAGGCGGCGGCGGCGG - Exonic
1101592899 12:106139194-106139216 CACGGCGGCGGCGGCGGCGGCGG + Exonic
1101605884 12:106247622-106247644 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1102136864 12:110582940-110582962 CCCAGGGCCGGCGGCGGCGGCGG - Exonic
1102197153 12:111033965-111033987 CCCGTTGGCGGCGGCGGCGGCGG + Intergenic
1102248342 12:111368990-111369012 CCCGGTGGCGGCGACGGCGGCGG + Exonic
1102370947 12:112382089-112382111 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1102370952 12:112382101-112382123 CTCGTCGGCGGCCGCGGCGGCGG - Intronic
1102371025 12:112382344-112382366 CCTGAGGGCGGCGGCGGCGGCGG - Intronic
1102457141 12:113077861-113077883 CCTCCAGGTGGCGGCGGCGGCGG - Exonic
1102892996 12:116575870-116575892 CCTGGGGGTGGCGGCTGCTGCGG - Exonic
1103074223 12:117969125-117969147 CCCGTCGGAGGAGGCGGAGGAGG + Intergenic
1103363682 12:120368397-120368419 GCGGTGGGGGGCGGCGGCAGTGG - Intronic
1103433066 12:120904243-120904265 CGCTCGGGCGGCGGCGGCGGCGG + Exonic
1103521247 12:121537910-121537932 ACCCTCGGCGGCGGCGGCGGCGG + Intronic
1103764668 12:123271660-123271682 CGCGAGGGCGGCGGCGGCGGCGG + Exonic
1103779528 12:123389455-123389477 CGCGGTGGAGGCGGCGGCGGCGG + Exonic
1103800349 12:123533715-123533737 CGAGTGGGCGGCGGCGGCGGCGG + Exonic
1103899138 12:124294594-124294616 CCTGTGGGTGGGGGCGGCGGGGG - Intronic
1103954252 12:124567589-124567611 CCCGGCGGCCGCGGCGGCGGTGG + Intronic
1103954258 12:124567601-124567623 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1104049564 12:125186489-125186511 CGCGGCGGCGGCGGCGGCGGGGG + Intergenic
1104591613 12:130088477-130088499 CCGGTGGGAGGCGGGGCCGGTGG + Intergenic
1104787304 12:131457870-131457892 GCCCTTGGTGGCGGCGGTGGGGG - Intergenic
1104939851 12:132389998-132390020 CAGGTGGGGGGCGGGGGCGGGGG - Intergenic
1105217513 13:18297715-18297737 CGCGGTGGAGGCGGCGGCGGCGG + Intergenic
1105678068 13:22696592-22696614 GGCGGCGGTGGCGGCGGCGGTGG + Intergenic
1106208404 13:27620499-27620521 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1106242876 13:27924564-27924586 CCTCCGGGGGGCGGCGGCGGCGG - Exonic
1106269363 13:28138711-28138733 CTCCTCGCTGGCGGCGGCGGTGG + Exonic
1106478028 13:30114800-30114822 GCTGCGGGAGGCGGCGGCGGCGG + Intergenic
1106498767 13:30307396-30307418 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
1106517090 13:30465195-30465217 CCCGGTCGCGGCGGCGGCGGCGG - Intronic
1106602653 13:31200535-31200557 AGCGCGAGTGGCGGCGGCGGCGG + Intronic
1106735832 13:32586909-32586931 CCCGGCCGGGGCGGCGGCGGCGG + Intronic
1106810045 13:33350258-33350280 CCCGTGGGTCGCGGCGTCTCCGG + Intronic
1107058544 13:36131365-36131387 CCAGAGGAGGGCGGCGGCGGCGG + Intergenic
1107467831 13:40665898-40665920 CCCCCCGGTGGCGGCCGCGGCGG + Exonic
1107603952 13:42040582-42040604 CCCGTGGGAGGCTGCGGCGGTGG + Intronic
1107605061 13:42048720-42048742 CCCGGCGGGGGCGGCGGCGTTGG - Intronic
1107851499 13:44576828-44576850 CCGGGGCGCGGCGGCGGCGGTGG + Intronic
1108541495 13:51451732-51451754 CCCGGCAGCGGCGGCGGCGGCGG - Intronic
1108689268 13:52847297-52847319 CCCGAGTGCAGCGGCGGCGGCGG + Exonic
1108727792 13:53201120-53201142 CCCGAGGGCAGCGGCGGCGGCGG - Intergenic
1109284857 13:60397595-60397617 CCTGGAGGCGGCGGCGGCGGCGG + Intronic
1110119742 13:71866471-71866493 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1110119759 13:71866531-71866553 ACCGGCGGCGGCGGCGGCGGCGG - Exonic
1110119768 13:71866568-71866590 CGCTTCGGCGGCGGCGGCGGCGG - Exonic
1110318198 13:74134285-74134307 GCCGAGGGCGGGGGCGGCGGCGG + Intergenic
1110443374 13:75549751-75549773 CGCGTGGGCGGAAGCGGCGGCGG + Intronic
1110558469 13:76886096-76886118 CCCAACGGGGGCGGCGGCGGGGG - Exonic
1110558515 13:76886265-76886287 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1110596581 13:77326728-77326750 CCCCGAGGAGGCGGCGGCGGGGG + Intronic
1110705878 13:78602005-78602027 CCCCGGGCTGGTGGCGGCGGCGG - Exonic
1110705932 13:78602166-78602188 CCCGGGGGAGGCGGCGGTGGCGG - Exonic
1111920965 13:94410763-94410785 CCCGGGGGTGGGGGGGGGGGGGG + Intergenic
1112216249 13:97434091-97434113 GCTGGGGGTAGCGGCGGCGGCGG + Intergenic
1112216317 13:97434313-97434335 CCCCTGGGCGCCGGCGGCGGCGG - Exonic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112272057 13:97977007-97977029 CACGTGGGTGCGAGCGGCGGCGG - Intronic
1112290893 13:98143362-98143384 CCCGCGGGCGGCGGCGGCGCGGG - Intronic
1112504916 13:99969809-99969831 CTCCGAGGTGGCGGCGGCGGCGG + Intronic
1112505032 13:99970402-99970424 GCCGGGGGCGGTGGCGGCGGCGG + Exonic
1112505134 13:99970808-99970830 CCTGGGGCTGGCGGCGGCAGCGG - Exonic
1112505213 13:99971034-99971056 CCCGTGCATGGCCGCCGCGGGGG + Exonic
1113378129 13:109782938-109782960 CCCGGGGCCGGCGGCGGTGGCGG + Exonic
1113378406 13:109783948-109783970 CACGGCGGCGGCGGCGGCGGCGG + Exonic
1113473284 13:110561769-110561791 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1113655658 13:112066839-112066861 CCAATGGGAGCCGGCGGCGGCGG - Intergenic
1113655914 13:112067734-112067756 GCCGGGGCGGGCGGCGGCGGGGG + Exonic
1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1113656041 13:112068237-112068259 CGGCTCGGTGGCGGCGGCGGCGG + Exonic
1113656042 13:112068240-112068262 CTCGGTGGCGGCGGCGGCGGCGG + Exonic
1113656113 13:112068540-112068562 CTCGGCCGTGGCGGCGGCGGCGG + Exonic
1113878202 13:113607749-113607771 CCAGTGGGTGGCGGTGACGGGGG + Intronic
1113914855 13:113864029-113864051 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1115028434 14:28767595-28767617 GCCGGTGGTGGCGGTGGCGGCGG - Exonic
1115851783 14:37595136-37595158 GGCGTGCGCGGCGGCGGCGGCGG + Intronic
1117954368 14:61111284-61111306 CCCGTGGTGGGCGGAGGCGGTGG + Intergenic
1118339098 14:64879825-64879847 CCCGGGGGTGGCGGCGGCGGCGG + Exonic
1118607702 14:67515406-67515428 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
1118676051 14:68185660-68185682 TCCGTGGATGGGGGCGGGGGTGG + Intronic
1118849480 14:69573086-69573108 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1118971548 14:70642067-70642089 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1119410342 14:74426249-74426271 CGAGAGGGAGGCGGCGGCGGCGG - Intergenic
1119742890 14:77025982-77026004 CCCAGAGGTGGGGGCGGCGGAGG + Exonic
1120168027 14:81220933-81220955 CTCGGCGGCGGCGGCGGCGGCGG - Intronic
1120809887 14:88792657-88792679 CCTGTGGGCTGAGGCGGCGGCGG - Exonic
1121279387 14:92688184-92688206 GACGGTGGTGGCGGCGGCGGCGG + Exonic
1121283858 14:92719264-92719286 GGCGGCGGTGGCGGCGGCGGCGG - Intronic
1121283866 14:92719288-92719310 GGCGGCGGTGGCGGCGGCGGCGG - Intronic
1121415904 14:93779202-93779224 GGCGGGGGTGGGGGCGGCGGGGG + Exonic
1121437165 14:93927536-93927558 GCCGTGGGTGGCGGCCGAGGAGG + Intronic
1121521220 14:94587416-94587438 CCCGGGGGTGGTGGCGGTGAAGG - Exonic
1122066138 14:99175559-99175581 CTCTTGGCTGGCGGCTGCGGGGG + Exonic
1122108763 14:99480800-99480822 CCAGGCGGTGGCGGCGGTGGCGG + Exonic
1122108766 14:99480809-99480831 GGCGGCGGTGGCGGCGGCGGCGG + Exonic
1122183499 14:99971992-99972014 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1122194364 14:100074000-100074022 CCCGGGGGCGGTGGGGGCGGGGG + Intronic
1122444990 14:101761695-101761717 CACGGCGGCGGCGGCGGCGGCGG - Intergenic
1122445012 14:101761776-101761798 TCCCCGGGCGGCGGCGGCGGCGG + Exonic
1122445016 14:101761779-101761801 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
1122517621 14:102319799-102319821 AGCGAGGATGGCGGCGGCGGCGG + Exonic
1122558017 14:102592024-102592046 CGCGGGGCTGGCGGGGGCGGGGG - Intergenic
1122900583 14:104780719-104780741 CTGGTGGGTGGCGGCGGGGCGGG - Intronic
1122943103 14:104991914-104991936 CATGTGCGTGGCGGCGGCAGTGG - Intronic
1122975373 14:105168677-105168699 CCCGGCGGCGACGGCGGCGGCGG + Exonic
1123024888 14:105419882-105419904 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1123396644 15:19944001-19944023 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1123630672 15:22258012-22258034 CCGGTGAGCGGCAGCGGCGGCGG - Intergenic
1124109480 15:26773042-26773064 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1124291309 15:28455930-28455952 ATCGAGGGTGGCGGCTGCGGGGG + Intergenic
1124364123 15:29060195-29060217 TCCGTGGGTGCCGGTGGAGGTGG + Intronic
1124957020 15:34366616-34366638 GCCGGGGGTGGGGGCGGGGGCGG - Intronic
1124971144 15:34490540-34490562 CACGGAGGCGGCGGCGGCGGCGG - Intergenic
1125522937 15:40358258-40358280 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1126113287 15:45187758-45187780 CGCGGGGGGGGCGGCGGCGGAGG - Intronic
1126113384 15:45187987-45188009 CGGGTGGGGGGCGGGGGCGGGGG + Intronic
1126767005 15:52019443-52019465 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
1127144085 15:56007193-56007215 CCGGGCGGCGGCGGCGGCGGTGG + Intergenic
1127144110 15:56007288-56007310 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144118 15:56007306-56007328 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144126 15:56007324-56007346 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144134 15:56007342-56007364 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144142 15:56007360-56007382 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127293678 15:57591880-57591902 CCCGGGGGTGGGGCCGGGGGCGG - Intergenic
1127515514 15:59689371-59689393 GCCGGCGGTGGAGGCGGCGGGGG + Exonic
1127515520 15:59689388-59689410 CGGGGGCGTGGCGGCGGCGGAGG + Exonic
1128529156 15:68432090-68432112 CCGGTGTGCAGCGGCGGCGGGGG + Exonic
1128841477 15:70854252-70854274 CGGGGTGGTGGCGGCGGCGGCGG - Intronic
1128877606 15:71215065-71215087 CCCGAGGACGACGGCGGCGGCGG + Exonic
1129016719 15:72474865-72474887 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
1129189177 15:73927564-73927586 TCGGGGGGCGGCGGCGGCGGCGG - Exonic
1129189178 15:73927567-73927589 CCGTCGGGGGGCGGCGGCGGCGG - Exonic
1129339242 15:74874025-74874047 CCTGTGGGGGGCGGGGGCGGGGG - Intergenic
1129348282 15:74938167-74938189 CGCGCGGCCGGCGGCGGCGGGGG + Exonic
1129676556 15:77634899-77634921 CCGCTGGGGGGCGGGGGCGGGGG + Intronic
1129706225 15:77796037-77796059 CCTGTGGGTGCCGGAGGCTGTGG + Intronic
1130076521 15:80695057-80695079 CCCGGAAGTGGCGGCGGCGGCGG + Intronic
1130335283 15:82952701-82952723 CCCGCGCCTGGCGGCGGTGGCGG - Exonic
1130362962 15:83207686-83207708 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1130908600 15:88256346-88256368 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1131263744 15:90903443-90903465 CCCGAGGGCGGTGGCGGCGGGGG + Intronic
1131466096 15:92655812-92655834 CGTGTTGGTGGTGGCGGCGGCGG - Exonic
1131572169 15:93550171-93550193 CCTTTGGGAGGCGGAGGCGGAGG - Intergenic
1131827013 15:96330396-96330418 CCTCTCGGCGGCGGCGGCGGCGG + Intronic
1131827014 15:96330399-96330421 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1131827204 15:96331273-96331295 CCCGGGGCAGGCGGCGGCGGCGG + Exonic
1131827380 15:96332052-96332074 CCCCTGGCTGCGGGCGGCGGCGG - Exonic
1131859487 15:96637246-96637268 CAGGTGGGTGGGGGCGGTGGCGG + Intergenic
1131874174 15:96787209-96787231 CCGGTGGGAGGCGGCGGGTGGGG - Intergenic
1132055556 15:98648537-98648559 CCAGTGTGTGGCAGCGGCGGCGG + Intergenic
1132398290 15:101489760-101489782 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1132553164 16:561439-561461 CACATGGGTGGGGGGGGCGGCGG + Intronic
1132580085 16:680698-680720 CGCGGGGAGGGCGGCGGCGGTGG + Intronic
1132641877 16:981781-981803 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1132641992 16:982181-982203 CCGGTGCGCGGCGGCGGCGGCGG + Exonic
1132656568 16:1044046-1044068 CCCTGGGCCGGCGGCGGCGGGGG + Intergenic
1132666391 16:1083054-1083076 CCTGTGGGTGGCAGGGGCCGCGG + Intergenic
1132683532 16:1153246-1153268 CCCGGCGGAGGCGACGGCGGCGG - Exonic
1132719709 16:1309707-1309729 ACCGAGCGGGGCGGCGGCGGCGG - Intronic
1132815898 16:1826462-1826484 CCCGAGCGTGGAGGCCGCGGCGG + Intronic
1132851507 16:2026937-2026959 CTCGGGGGCGGCGGCGGCGCTGG - Exonic
1132877957 16:2148663-2148685 CCTGGCGGCGGCGGCGGCGGCGG - Exonic
1132885100 16:2179036-2179058 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1132885535 16:2180513-2180535 CGCTTGGGTGGGGGCGGCGGGGG + Exonic
1133021603 16:2969362-2969384 CGCGGCGGCGGCGGCGGCGGTGG - Exonic
1133051603 16:3120271-3120293 GCTGGGGGCGGCGGCGGCGGGGG + Exonic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1133212871 16:4272860-4272882 CCAGATGCTGGCGGCGGCGGCGG + Exonic
1133784383 16:8963443-8963465 CCCGCGGCGGGCGGCGGCGGCGG + Exonic
1133784412 16:8963568-8963590 CCCCGCGGCGGCGGCGGCGGCGG - Intronic
1134163988 16:11915692-11915714 CCGGGCAGTGGCGGCGGCGGCGG - Exonic
1134588653 16:15434505-15434527 CCGGGCGCTGGCGGCGGCGGAGG + Exonic
1134696985 16:16232533-16232555 GCGGCGGCTGGCGGCGGCGGTGG + Exonic
1135158477 16:20073681-20073703 CTCGGTGGTGGCGGCGGCGGAGG + Exonic
1135821883 16:25692381-25692403 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1136110889 16:28063194-28063216 CGAGGCGGTGGCGGCGGCGGCGG + Exonic
1136226503 16:28863898-28863920 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1136365174 16:29806408-29806430 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1136365677 16:29808040-29808062 CGCGTGGGAGGAGGCGGCGGCGG + Intronic
1136611963 16:31371800-31371822 AACGTGGGTGGCGGCCGCGCTGG + Intronic
1136683655 16:31981958-31981980 GCCCGGGCTGGCGGCGGCGGGGG + Intergenic
1137019884 16:35414703-35414725 CCCGTGGGTGGACGGGGCGGGGG - Intergenic
1137444991 16:48526251-48526273 CCAGTGGGTGGGGGCAGCGTGGG - Intergenic
1137617702 16:49856948-49856970 CTCCTGGGCAGCGGCGGCGGCGG + Intronic
1137683270 16:50368965-50368987 CCCGAGAGCGGCGGCGGGGGGGG + Intergenic
1137988647 16:53131072-53131094 GCGGTGGGTGGCAGCGGCGGCGG - Intronic
1138105319 16:54284693-54284715 TCTGTGAGCGGCGGCGGCGGCGG + Exonic
1138179793 16:54933382-54933404 ACCGCAGGAGGCGGCGGCGGAGG - Exonic
1138450775 16:57092569-57092591 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
1138465399 16:57186408-57186430 CCGGAGGGAGGGGGCGGCGGCGG - Exonic
1138619190 16:58198016-58198038 CCCCCAGGAGGCGGCGGCGGCGG + Intergenic
1139473746 16:67192243-67192265 CCCGGGGGCGGCGGCGCCTGTGG - Exonic
1139584502 16:67893269-67893291 CCCGAGAATGGCGGCGGCGGCGG + Exonic
1139631842 16:68236011-68236033 CCCGGGGGAGGGGGCGGCGGCGG + Exonic
1139806002 16:69565971-69565993 CCTGTCAGCGGCGGCGGCGGTGG + Intronic
1140091939 16:71846026-71846048 GCCGGGGATGGCGGCGGCCGCGG + Exonic
1140187413 16:72787705-72787727 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1140187426 16:72787741-72787763 CCCACCGGCGGCGGCGGCGGTGG - Exonic
1140223130 16:73058232-73058254 CCCGGGCTCGGCGGCGGCGGCGG + Intronic
1140223248 16:73058688-73058710 CGCGCTGCTGGCGGCGGCGGCGG + Intronic
1140442620 16:74999256-74999278 CCCGCGGGAGGAGGCGGAGGAGG - Exonic
1140927587 16:79599211-79599233 GCTGGGGGCGGCGGCGGCGGCGG - Exonic
1141079181 16:81035879-81035901 CTCGGAGGCGGCGGCGGCGGCGG + Exonic
1141608586 16:85169266-85169288 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1141682600 16:85553298-85553320 CCCGCCGGCAGCGGCGGCGGCGG - Intergenic
1141703418 16:85652543-85652565 CCAGGCGGCGGCGGCGGCGGCGG + Intronic
1141831161 16:86510603-86510625 CACGGCGGCGGCGGCGGCGGCGG + Exonic
1141959021 16:87392352-87392374 CCCGGGGGCGGCGGCTGCTGCGG - Exonic
1141972393 16:87492569-87492591 CCGGTGCGCGGCGGCGGCGGCGG + Intergenic
1142109233 16:88322458-88322480 GCCATGGGTGGCTGCGGCTGTGG - Intergenic
1142377073 16:89711783-89711805 CCCGTGGGGGGCGGAGCCAGAGG - Intronic
1142518068 17:446300-446322 CCCGTGGGGGCCGGGTGCGGTGG - Intergenic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142656689 17:1399521-1399543 CCCGTGTGGGGCGGCGGCCGTGG - Intronic
1142764327 17:2057102-2057124 CACCTGCGGGGCGGCGGCGGCGG + Exonic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1142854865 17:2723962-2723984 CGCGGGGGTGGGGGAGGCGGGGG + Intergenic
1143181690 17:4987603-4987625 CCCGCGGGTGACGGCGGCAGCGG + Intronic
1143223653 17:5282371-5282393 TCTCTGGGCGGCGGCGGCGGCGG + Exonic
1143446831 17:7014808-7014830 CTCGCGTGTAGCGGCGGCGGCGG + Exonic
1143494969 17:7307637-7307659 CCCGTGTGCAGCAGCGGCGGCGG + Intronic
1143517310 17:7426369-7426391 AACGGCGGTGGCGGCGGCGGCGG - Exonic
1143527260 17:7479692-7479714 CCTCTCGGCGGCGGCGGCGGCGG - Intronic
1143590781 17:7885056-7885078 GGCGGGGGCGGCGGCGGCGGGGG - Exonic
1143590888 17:7885332-7885354 AGCCGGGGTGGCGGCGGCGGCGG - Intronic
1143750072 17:9021516-9021538 AGCGCGAGTGGCGGCGGCGGCGG + Intergenic
1144021163 17:11241065-11241087 CCGGGCGGCGGCGGCGGCGGCGG - Intergenic
1144500955 17:15786471-15786493 CCTGCGGCTGACGGCGGCGGGGG + Intergenic
1144608332 17:16687349-16687371 CCTGCGGGGGGCGGCGGGGGAGG - Intergenic
1144666298 17:17104685-17104707 CTCGTGGGTGGCTGAGGGGGAGG - Intronic
1144696196 17:17305400-17305422 CACGTGTGTGGGGGCGGGGGGGG - Intronic
1144910056 17:18673037-18673059 CCAGGCGGCGGCGGCGGCGGCGG - Exonic
1145214708 17:21042855-21042877 CGCGCGGGGGGCGGCGGCGAGGG + Exonic
1145925653 17:28644948-28644970 GCCGGCGGCGGCGGCGGCGGCGG - Intronic
1145925654 17:28644951-28644973 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1146132630 17:30291953-30291975 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1146371135 17:32266154-32266176 TCCGGGGGCGGCGGCGGCTGCGG - Exonic
1146492351 17:33292124-33292146 CCCGCGGCTGGCGGCAGCGGCGG + Exonic
1146836878 17:36118222-36118244 CCTGGGGGTGGGGGCGGTGGGGG - Intergenic
1147138958 17:38451078-38451100 CCAGAGGGTGGTGGCGGAGGGGG - Intronic
1147162981 17:38578704-38578726 ACCCTGGGGGGCGGGGGCGGCGG - Exonic
1147200645 17:38799425-38799447 GCCCGGGGCGGCGGCGGCGGCGG + Exonic
1147285911 17:39402285-39402307 GGCGGGGGAGGCGGCGGCGGCGG - Intronic
1147307402 17:39573631-39573653 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1147393044 17:40121980-40122002 CCGGTTGGCGGCGGCTGCGGCGG + Intergenic
1147400403 17:40177500-40177522 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1147429561 17:40363076-40363098 GGCGGAGGTGGCGGCGGCGGCGG + Exonic
1147591850 17:41688984-41689006 CCTGCGGAAGGCGGCGGCGGCGG - Exonic
1147719827 17:42532209-42532231 CACCTGGGCGGCGGCGGCGGCGG - Intergenic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1148111121 17:45145013-45145035 CCAGGTGGTGGCAGCGGCGGGGG - Intergenic
1148126953 17:45242026-45242048 CCCGGAGGTGGTGGCGGTGGCGG - Exonic
1148126969 17:45242077-45242099 CCGGGAGGCGGCGGCGGCGGCGG - Exonic
1148126971 17:45242080-45242102 CCTCCGGGAGGCGGCGGCGGCGG - Exonic
1148180663 17:45602318-45602340 TCTGCGGGTGGCGGCGGCGCGGG - Intergenic
1148437479 17:47694874-47694896 CCTGTGGGTGGCGGAGGGGGGGG + Intronic
1148440412 17:47709015-47709037 CCCGGCGGGGGCGGCGGCGGTGG - Exonic
1148493443 17:48037723-48037745 CCCGGGGGAGGGGGCCGCGGCGG - Exonic
1148550026 17:48544649-48544671 GCGGGGAGTGGCGGCGGCGGTGG + Exonic
1148551083 17:48551142-48551164 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1148555832 17:48578057-48578079 CCGGGCGGTGGCGGGGGCGGCGG + Exonic
1148698625 17:49575652-49575674 ACCGGCGGCGGCGGCGGCGGCGG - Intergenic
1148698627 17:49575655-49575677 CCCACCGGCGGCGGCGGCGGCGG - Intergenic
1149430519 17:56593367-56593389 AGCGGCGGTGGCGGCGGCGGTGG - Intergenic
1149994699 17:61400338-61400360 CCCGGGCCTGGCGGGGGCGGCGG + Exonic
1150060590 17:62065380-62065402 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1150128440 17:62653365-62653387 CCCGGGGGTGGGGGCGGGGGTGG - Intronic
1150317149 17:64178547-64178569 CCTGTGTGTGGCGGTGGGGGTGG + Intronic
1150373508 17:64661884-64661906 CCCGGCGGCGGGGGCGGCGGGGG + Exonic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150562056 17:66302776-66302798 CGGGTGGGCGGGGGCGGCGGGGG - Intronic
1150643453 17:66964576-66964598 CCGGAGCGCGGCGGCGGCGGGGG + Intergenic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150791895 17:68205762-68205784 GACTTGGGCGGCGGCGGCGGCGG - Intergenic
1150791966 17:68205968-68205990 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1151166171 17:72205655-72205677 CCCGTGGGAGGGGGTGGTGGTGG - Intergenic
1151370871 17:73645325-73645347 GCCGGGAGGGGCGGCGGCGGCGG + Intergenic
1151386363 17:73757764-73757786 CCCGTGGGTGGTGGGGTGGGAGG - Intergenic
1151557182 17:74852438-74852460 CACGTGGCTGGCGTCGGCGACGG + Exonic
1151570501 17:74923266-74923288 CCCGGGGGCGGGGGCGGAGGGGG + Intergenic
1151657430 17:75502450-75502472 CGCTTGGGGGGCGGGGGCGGGGG + Exonic
1151755333 17:76072448-76072470 CCAGGCGGCGGCGGCGGCGGCGG - Exonic
1151768987 17:76147398-76147420 GCTGGTGGTGGCGGCGGCGGTGG - Intronic
1151973120 17:77469248-77469270 TCCGTGGGTGAGGGCGGAGGAGG + Intronic
1152049188 17:77959098-77959120 CCCGGCGCGGGCGGCGGCGGCGG - Intergenic
1152049219 17:77959198-77959220 CGCGGGCCTGGCGGCGGCGGCGG - Intergenic
1152276734 17:79362439-79362461 CCAGGGGGTGGGGGTGGCGGTGG + Intronic
1152353637 17:79796796-79796818 CGCGGCCGTGGCGGCGGCGGCGG - Intronic
1152433103 17:80260507-80260529 CGCGGGGCCGGCGGCGGCGGCGG + Intergenic
1152606644 17:81294895-81294917 CCAGTTGGAGGCGGCGGCCGCGG + Exonic
1152696786 17:81801609-81801631 CCTGGGGGTGGCGGAGGCTGAGG + Intergenic
1152696820 17:81801765-81801787 CCTGGGGGTGGCGGAGGCTGAGG + Intergenic
1152834398 17:82519931-82519953 CCCGCGGGCGGCGGGGCCGGGGG + Exonic
1153040817 18:812016-812038 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1153308974 18:3659447-3659469 ACCGGGGGTGGGGGCGGCGGGGG - Intronic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1153794398 18:8609485-8609507 CCCGGCGGCGGCGGCGGCAGCGG + Exonic
1153842900 18:9022998-9023020 ACAGTGGGTGGGGGCGGGGGTGG - Intergenic
1154268211 18:12897116-12897138 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1154503666 18:15010462-15010484 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1155007509 18:21741526-21741548 CCCGGCGGCAGCGGCGGCGGCGG + Exonic
1155392494 18:25351148-25351170 CACGACGGCGGCGGCGGCGGCGG + Intronic
1155392729 18:25352326-25352348 CGCGTGGGAGGCGGCGGCGGCGG - Intergenic
1155654333 18:28177049-28177071 GCCGGAGGAGGCGGCGGCGGCGG + Exonic
1155654572 18:28178002-28178024 GGCGAGGGCGGCGGCGGCGGCGG - Intergenic
1156099673 18:33578486-33578508 GCGGGCGGTGGCGGCGGCGGCGG - Intergenic
1156099674 18:33578489-33578511 CGCGCGGGCGGTGGCGGCGGCGG - Intergenic
1156262489 18:35458547-35458569 CCTGTGGGTGGTGGCAGTGGTGG + Intronic
1157095236 18:44680664-44680686 CTCGTTGGTGGCGGCGATGGTGG + Intronic
1157294640 18:46433598-46433620 CCCGGGTGTGGCGGAGACGGGGG + Intronic
1157383934 18:47247073-47247095 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1157384295 18:47248303-47248325 GGCGGCGGTGGCGGCGGCGGCGG + Intronic
1157849132 18:51030704-51030726 CCCGACGACGGCGGCGGCGGCGG + Intronic
1157867192 18:51197211-51197233 CCCGAGGGCGGCGGCAGAGGCGG + Exonic
1157867199 18:51197229-51197251 GGCGGCGGTGGCGGCGGCGGCGG + Exonic
1157907542 18:51583148-51583170 CCGCTGGGTGGCGGCTGCTGTGG + Intergenic
1158435949 18:57435680-57435702 CCCGGGGGCGGCGGGGGCGGCGG - Exonic
1158505607 18:58044196-58044218 CCGGTGGGAGGAGGCGGAGGAGG + Intergenic
1158524240 18:58197922-58197944 CCAGTGGGTGGGGGTGGGGGTGG + Intronic
1158601939 18:58863506-58863528 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1158954160 18:62523599-62523621 CCCCGGGGCGGCGGCGGCGGCGG - Exonic
1158954698 18:62526614-62526636 CGGGTGCGCGGCGGCGGCGGCGG - Intronic
1159511287 18:69400912-69400934 CCCGTGGGTGCTGCCGGGGGCGG + Intergenic
1160453342 18:78979744-78979766 CCCGGCGGCGGCGGCGGGGGGGG + Intergenic
1160597682 18:79988472-79988494 CCCGGGGGCGGCGGGGGCCGGGG - Exonic
1160688159 19:446927-446949 CCGGTGGCTGGCGTGGGCGGTGG - Intronic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160719130 19:589891-589913 CCGGCCGGCGGCGGCGGCGGCGG + Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719185 19:590060-590082 CCCGGGGGGGGCGCGGGCGGCGG - Exonic
1160873104 19:1285889-1285911 CCCGGCGGGTGCGGCGGCGGCGG + Intergenic
1160873170 19:1286080-1286102 CCGCTCGGCGGCGGCGGCGGCGG + Intergenic
1160873171 19:1286083-1286105 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1160887053 19:1354975-1354997 CCCGCGGGGAGCGGCGGCGGCGG + Intronic
1160895820 19:1401401-1401423 CGCGTGGGGGGCGGCGCCCGCGG - Exonic
1160930589 19:1568000-1568022 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1160930595 19:1568015-1568037 CCCGACGGCGGCGGGGGCGGGGG - Exonic
1160967298 19:1752383-1752405 CCCGGGGGTGGGGGGGGCAGAGG + Exonic
1160967827 19:1754311-1754333 GGCGGGGGTGGTGGCGGCGGCGG - Exonic
1160990172 19:1857170-1857192 CACGTGGGTGGCGGGGCAGGGGG + Intronic
1161022139 19:2015536-2015558 CCCAGGGGCGGCGGCGGCGGCGG + Exonic
1161028615 19:2047934-2047956 CTGGTGGGTGGCGGGGGCGTAGG - Intronic
1161050979 19:2164024-2164046 CCGGAGCGCGGCGGCGGCGGCGG + Intronic
1161050981 19:2164030-2164052 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1161080593 19:2308159-2308181 CCGGGAGGCGGCGGCGGCGGCGG - Intronic
1161124204 19:2546786-2546808 CCCGGCGGTGGGGTCGGCGGGGG + Intronic
1161301803 19:3546362-3546384 CGCCTGGGTGGCGCTGGCGGAGG - Exonic
1161343280 19:3754105-3754127 CCTGTGGGTGGCGGCGTGGGAGG + Exonic
1161396914 19:4049540-4049562 CTCGAGGCTGGCGGCGGCCGAGG + Intronic
1161400419 19:4064715-4064737 CCCATGGGTGGCGGGCTCGGTGG - Intronic
1161400707 19:4065463-4065485 CCCGGCGGCGGCGGTGGCGGCGG + Intronic
1161430417 19:4229289-4229311 CCCGAGGGTGGGGGCGGGGGAGG - Intergenic
1161589829 19:5124325-5124347 CCCACAGGTGGCAGCGGCGGCGG - Intronic
1161800703 19:6415581-6415603 CCGGTGGGTGGGGGCTGAGGGGG + Exonic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162030877 19:7916763-7916785 CCCGGGCTCGGCGGCGGCGGTGG - Exonic
1162030915 19:7916919-7916941 CGCGATGGCGGCGGCGGCGGCGG - Exonic
1162128522 19:8511856-8511878 GCCGGGGGTGGCGGCGGGGCTGG + Exonic
1162176165 19:8832138-8832160 CCCGTGGCTGGCGGTGTCCGCGG + Intronic
1162402138 19:10453010-10453032 GCAGTGGGTGGAGGCGGTGGGGG - Intronic
1162470874 19:10871488-10871510 GGCGACGGTGGCGGCGGCGGCGG + Intergenic
1162470923 19:10871657-10871679 CCCGGGCGCAGCGGCGGCGGCGG + Exonic
1162486020 19:10961050-10961072 CCCTCGTTTGGCGGCGGCGGCGG + Exonic
1162535842 19:11262480-11262502 CCGGGAGGCGGCGGCGGCGGCGG - Intronic
1162733787 19:12734584-12734606 CCCGCGGGCGGTGGCGGTGGCGG - Exonic
1162744748 19:12792108-12792130 CGCGGGGGTGGCAGCGGTGGAGG + Exonic
1162751758 19:12833851-12833873 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1162954450 19:14090512-14090534 CCCGGGGGGGGAGGCGGAGGAGG - Exonic
1162954503 19:14090784-14090806 CGCGCGTGCGGCGGCGGCGGCGG - Intronic
1162959494 19:14117623-14117645 GCGCTGGGCGGCGGCGGCGGCGG + Exonic
1163118286 19:15200832-15200854 CGCACGGGTGGCGGTGGCGGTGG + Exonic
1163154492 19:15432532-15432554 GGCGGGGGTGGGGGCGGCGGCGG + Intronic
1163551176 19:17967168-17967190 CCCGGGGGCGGCGGGGCCGGGGG - Intronic
1163606977 19:18280981-18281003 CCCCCCGGCGGCGGCGGCGGCGG + Exonic
1163606981 19:18280984-18281006 CCCGGCGGCGGCGGCGGCGGCGG + Exonic
1163773256 19:19203327-19203349 CCCGCGGGTTTCGGGGGCGGTGG + Exonic
1163807250 19:19406448-19406470 CCCCGCGGCGGCGGCGGCGGCGG + Intronic
1163807253 19:19406451-19406473 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1164498809 19:28794068-28794090 CGAGTGGGCGGCGCCGGCGGCGG + Intergenic
1164658544 19:29942330-29942352 CCGCTGCGGGGCGGCGGCGGCGG + Exonic
1164834535 19:31349245-31349267 CCCGGCAGCGGCGGCGGCGGCGG - Exonic
1165080046 19:33301843-33301865 TGCGAGGGCGGCGGCGGCGGCGG + Exonic
1165080114 19:33302104-33302126 CCCACGGGCGGCGGCGGCGGCGG - Exonic
1165204517 19:34172448-34172470 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1165349520 19:35268516-35268538 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1165479624 19:36054903-36054925 CCAGTGGGTCGTGGCGGTGGCGG + Intronic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165696917 19:37907466-37907488 GCCGTGGGGGGCGGCGGCGCCGG + Intronic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1165928608 19:39342438-39342460 CGCGACGGCGGCGGCGGCGGCGG + Intronic
1165952313 19:39481174-39481196 CACGTGGGTGCCGGAGGAGGAGG + Intronic
1166307084 19:41941028-41941050 CCCGGGGCTGGCTGCAGCGGGGG - Intergenic
1166358676 19:42242525-42242547 CCCGGGGGAGGCGGCGGCAGCGG - Exonic
1166361251 19:42253867-42253889 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1166367440 19:42284553-42284575 CCGGAGGGGGGCGGCGGGGGGGG + Intronic
1166802814 19:45468693-45468715 TACCTGGGAGGCGGCGGCGGTGG - Exonic
1166807695 19:45496979-45497001 CACCAGGGCGGCGGCGGCGGCGG - Exonic
1166883008 19:45940361-45940383 CAGGAGGTTGGCGGCGGCGGCGG + Exonic
1166983887 19:46648741-46648763 CCTGCGGGAGGCGTCGGCGGGGG - Exonic
1167072766 19:47230525-47230547 CCCGCTGGGGGCGGCGACGGGGG - Intronic
1167081040 19:47276140-47276162 AGAGTGGATGGCGGCGGCGGTGG + Intergenic
1167149715 19:47701780-47701802 CCCGTGGGCGGCGGTGGTGGTGG - Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167455886 19:49596625-49596647 GCCGTGGGAGGTGGGGGCGGAGG - Exonic
1167463827 19:49639977-49639999 GTCGTGGGCGGCGGCGGCGTGGG - Exonic
1167557472 19:50205305-50205327 CAGGTGGGCGGCGGCGGCGGCGG - Intronic
1167593278 19:50415668-50415690 CAGGTGGGTGGCGGGGGTGGGGG - Intronic
1167638583 19:50668379-50668401 CCCACGGGAGGCGGCGGCGGCGG - Exonic
1167643704 19:50695087-50695109 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1167738682 19:51311713-51311735 CCGGGGGGCGGCGGGGGCGGGGG - Intergenic
1168076347 19:53982598-53982620 GCCGGGGGCGGCGGCGGAGGCGG + Exonic
1168272664 19:55258528-55258550 CCGGTGAGTGGGGGCGGGGGCGG + Exonic
1168281573 19:55308757-55308779 GGCGTGGGTGGCGGGGGCCGTGG + Intronic
1168281581 19:55308773-55308795 GCCGTGGGTGGCGGGGGGCGTGG + Intronic
1168281606 19:55308821-55308843 GGCGTGGGTGGCGGGGGCGGTGG + Intronic
1168309351 19:55452702-55452724 GCCGGGGGTGGCGGCGTGGGGGG + Intergenic
1202710973 1_KI270714v1_random:19204-19226 GCCGTGGGCGGCGGCGGCGCTGG + Intergenic
925156548 2:1652593-1652615 CTCGTGGCTGGGGGCGGGGGTGG - Intronic
925927207 2:8679002-8679024 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
926035174 2:9630693-9630715 CCCGCGGCTGGAGGAGGCGGGGG + Intronic
926077325 2:9951748-9951770 CCGGGGGGAGGAGGCGGCGGCGG - Exonic
926090027 2:10043623-10043645 GCTGCGGGCGGCGGCGGCGGCGG - Exonic
926095783 2:10080097-10080119 CCGGCGGGTGCCGGTGGCGGCGG - Exonic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
927215829 2:20667357-20667379 CCAGGGGGCGGCGGCGGCGGCGG + Exonic
927472121 2:23384930-23384952 ACCGCGGGGGGCGGGGGCGGCGG + Intergenic
927472319 2:23385560-23385582 CCGGGAGGCGGCGGCGGCGGAGG + Exonic
927672749 2:25082678-25082700 CCCATGGGTGGTGGTGGCAGGGG - Intronic
927800521 2:26094801-26094823 ACCTTGGGTGGCTGAGGCGGGGG - Intronic
927881458 2:26692710-26692732 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
927982145 2:27380781-27380803 CCCGTGCGTCTCTGCGGCGGCGG - Intronic
927982153 2:27380812-27380834 TCCGTGGGAAGCGGCCGCGGCGG + Intergenic
927988341 2:27429031-27429053 CCGGCGGGTGGGGGCGGGGGCGG + Intronic
928606108 2:32946758-32946780 CCCGTGGGTCGCCGAGGCGGAGG - Intergenic
928606358 2:32947622-32947644 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
928983219 2:37156919-37156941 GCCGGCGGCGGCGGCGGCGGCGG - Exonic
928983220 2:37156922-37156944 CCGGCCGGCGGCGGCGGCGGCGG - Exonic
929174234 2:38960557-38960579 GCCGCGGGCGGCGACGGCGGCGG - Exonic
929450362 2:42032877-42032899 CCCGGGGGTGGGGGCGGGGGCGG + Intergenic
929949293 2:46393934-46393956 TCCGGGGGTGGCGGGGGGGGGGG + Intergenic
930011422 2:46941035-46941057 CGCGGCGGGGGCGGCGGCGGGGG + Intronic
930136091 2:47905530-47905552 GGCGGCGGTGGCGGCGGCGGAGG + Exonic
930136231 2:47906066-47906088 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
930189210 2:48440812-48440834 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
930358224 2:50346885-50346907 CCCGGGGGCGGCGGCGGCGGCGG - Intronic
930872703 2:56184474-56184496 CCGCTGGGTTGGGGCGGCGGGGG - Exonic
931235727 2:60410919-60410941 CCTGTGGGTGGGGGGGGGGGGGG + Intergenic
931253391 2:60551852-60551874 CCCGGAGCAGGCGGCGGCGGCGG - Intronic
931253506 2:60552417-60552439 CCCTTCGGCGGCGGCGGCGGCGG + Intronic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
931730826 2:65151896-65151918 CAGGTGGGTGGCGGGGGCAGGGG + Intergenic
931740463 2:65237902-65237924 CCCGTGGGCGGGGGCGGTGGAGG + Intronic
932345866 2:70994830-70994852 CGCGGCGGCGGCGGCGGCGGTGG - Exonic
932396907 2:71454693-71454715 CCAGTGGGTGGAGGGAGCGGGGG + Intronic
932699857 2:73985080-73985102 CGCGACGGTGGTGGCGGCGGCGG + Intergenic
932765311 2:74465384-74465406 CCGGCGGGAGGCGGAGGCGGAGG - Exonic
932776356 2:74530318-74530340 CGCGTGGCTGGCGGTGGCGCTGG + Exonic
933666859 2:84971282-84971304 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
933684713 2:85133700-85133722 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
933772712 2:85754344-85754366 CCCGTTGGTGGCTACGGCGCGGG - Exonic
933907961 2:86914016-86914038 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933907986 2:86914080-86914102 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908006 2:86914129-86914151 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908045 2:86914234-86914256 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908062 2:86914281-86914303 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908080 2:86914330-86914352 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908096 2:86914376-86914398 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908110 2:86914416-86914438 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908154 2:86914541-86914563 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908177 2:86914608-86914630 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908189 2:86914642-86914664 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908202 2:86914679-86914701 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908216 2:86914719-86914741 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908260 2:86914845-86914867 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
933908290 2:86914931-86914953 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
934011432 2:87824750-87824772 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934011548 2:87825378-87825400 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934011565 2:87825424-87825446 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
934031885 2:88055671-88055693 CCCCTGGCTGGCGGCGTTGGCGG - Exonic
934079050 2:88452276-88452298 GCCCCGGGGGGCGGCGGCGGCGG + Exonic
934079054 2:88452279-88452301 CCGGGGGGCGGCGGCGGCGGCGG + Exonic
934248170 2:90324633-90324655 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248185 2:90324694-90324716 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248359 2:90325307-90325329 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248370 2:90325345-90325367 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248381 2:90325383-90325405 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934248397 2:90325447-90325469 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934261194 2:91478107-91478129 CACCGGGGCGGCGGCGGCGGCGG - Intergenic
934296792 2:91748935-91748957 CGCGCTGGAGGCGGCGGCGGCGG - Intergenic
934304464 2:91809921-91809943 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
934328793 2:92042829-92042851 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
934567042 2:95346837-95346859 CCCGTGGAGGGCGGCGGCGGCGG - Intronic
935112317 2:100104803-100104825 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
935137715 2:100322053-100322075 CACTGGGGCGGCGGCGGCGGCGG + Exonic
935196647 2:100820246-100820268 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
935360922 2:102245666-102245688 CCCGTGGGGAGGGGTGGCGGTGG + Intergenic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935592442 2:104855293-104855315 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
935592501 2:104855420-104855442 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
935592549 2:104855589-104855611 GCAGGGGCTGGCGGCGGCGGGGG + Exonic
935592554 2:104855604-104855626 GGCGGGGGTGGCGGCGGCGGCGG + Exonic
935592671 2:104856033-104856055 CCCTGGTGTGGGGGCGGCGGCGG - Exonic
935592697 2:104856100-104856122 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
936122683 2:109760395-109760417 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936126698 2:109794579-109794601 CCGGGGGGCGGCGGCGGCGGCGG + Intronic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
936221995 2:110611037-110611059 GCCGGGGGCGGTGGCGGCGGCGG - Intergenic
936222010 2:110611078-110611100 GGCGGGGGCGGCGGCGGCGGCGG - Intergenic
936433182 2:112482009-112482031 CCCGGGGGCGGCGGCGGCGCAGG - Intergenic
937044991 2:118846555-118846577 CCCGGCTGCGGCGGCGGCGGCGG - Exonic
937083890 2:119158306-119158328 CCCGGCTGTGGCAGCGGCGGCGG - Exonic
937988858 2:127651197-127651219 CCTGTGGGTGGTGGTGGCTGTGG + Exonic
938073180 2:128318902-128318924 CCGGGGCGGGGCGGCGGCGGCGG - Intergenic
938406244 2:131034875-131034897 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
939693238 2:145292156-145292178 CATGGGGGTGGGGGCGGCGGAGG - Intergenic
940035743 2:149310578-149310600 CCAGTGGGCTGCGGCGGCCGGGG - Intergenic
941119108 2:161507854-161507876 CGCGGCGGCGGCGGCGGCGGGGG - Intronic
941686841 2:168456304-168456326 CGCGGAGGAGGCGGCGGCGGCGG + Exonic
941906051 2:170716709-170716731 CAGGTGGGCGGCGGGGGCGGTGG - Exonic
941951494 2:171160833-171160855 CGCCCGGGAGGCGGCGGCGGCGG + Exonic
941951503 2:171160856-171160878 GCTGTGGGTGGCGGCTGAGGCGG + Intronic
942046517 2:172102300-172102322 CCGGCGGGCGGCGGCGGCGGCGG - Exonic
942241038 2:173964475-173964497 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
942241043 2:173964490-173964512 GACGTGGATAGCGGCGGCGGCGG - Exonic
942241113 2:173964680-173964702 CCCCCCGGCGGCGGCGGCGGCGG + Intronic
942241117 2:173964683-173964705 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
942278055 2:174336804-174336826 CAGGTGGGAGGCGGCGGCGGCGG - Exonic
942446160 2:176080285-176080307 TCCCGGGGTGGCGGTGGCGGCGG - Exonic
942448374 2:176092974-176092996 CTCATCGGTGGCGGCGGCGGCGG + Exonic
942451027 2:176107998-176108020 ACCGGGGCTGGTGGCGGCGGGGG + Exonic
942890487 2:180980997-180981019 CGCGTGGGGGGCGGCCGGGGCGG + Intronic
943571505 2:189580770-189580792 CACGGCGGCGGCGGCGGCGGCGG - Exonic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
944412442 2:199457721-199457743 CCCGGAGGCGGCGGCGGCGGCGG + Exonic
944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG + Intergenic
944743684 2:202635413-202635435 CCCGCAGGCGGCGGCGGCGGCGG + Exonic
944831217 2:203535340-203535362 CCCCGCGGCGGCGGCGGCGGCGG + Exonic
944831220 2:203535343-203535365 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
944933632 2:204545556-204545578 GGAGTGGGCGGCGGCGGCGGCGG - Intergenic
945296392 2:208175209-208175231 CCCGGGGGGGGGGGGGGCGGAGG + Intronic
945466016 2:210171321-210171343 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
946019855 2:216633599-216633621 GGCGCGAGTGGCGGCGGCGGCGG + Exonic
946322126 2:218960283-218960305 GCTGGGGGAGGCGGCGGCGGAGG - Exonic
946325282 2:218981754-218981776 CGCGGCGGTGGCGGCGGCAGCGG + Exonic
946412836 2:219523504-219523526 CTCATGGGTGGCGGTGGAGGTGG + Intronic
946431020 2:219627526-219627548 CCCGGCGGCGGCGGCGGCGGCGG + Intronic
946921422 2:224585150-224585172 CCCCTGGGCAGCCGCGGCGGCGG + Exonic
946921434 2:224585171-224585193 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947187989 2:227472171-227472193 CGGGAAGGTGGCGGCGGCGGCGG + Exonic
947549784 2:231037838-231037860 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947635964 2:231680948-231680970 GCCGGGGGTGGCAGCGGGGGAGG + Intergenic
947860530 2:233354564-233354586 TCCTCGGGCGGCGGCGGCGGAGG - Exonic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
948991761 2:241559161-241559183 TGCGTGGGCGGCGGGGGCGGAGG - Intronic
1169065563 20:2692798-2692820 CCCGGGAGCGGCGGCGGCGGCGG + Intergenic
1169129701 20:3159746-3159768 CAGGTGAGTGGCGGCGGCCGGGG - Exonic
1169164122 20:3407692-3407714 CCCGGCGGGGGCGGGGGCGGGGG + Intergenic
1170612137 20:17923371-17923393 GCAGTGGGGGGCGGGGGCGGGGG - Intergenic
1170756917 20:19212878-19212900 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1170756919 20:19212881-19212903 CCCTCCGGCGGCGGCGGCGGCGG - Exonic
1170890036 20:20368679-20368701 CTCGGAGGGGGCGGCGGCGGCGG + Exonic
1171218292 20:23369648-23369670 CCCCTGTGTGGATGCGGCGGTGG - Exonic
1171233995 20:23509744-23509766 CCCGTGGGAGGAGGCAGCGGAGG - Intergenic
1171444780 20:25195748-25195770 CCCGCGGGTGGAGGCCGGGGTGG + Exonic
1171972507 20:31573124-31573146 CCCAGGTGTGGCCGCGGCGGGGG - Intronic
1172037335 20:32019227-32019249 CACGGAGGCGGCGGCGGCGGCGG + Exonic
1172109151 20:32535488-32535510 CTCGGTGGTGGCGGTGGCGGCGG - Intronic
1172474492 20:35226778-35226800 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1172587287 20:36093512-36093534 GCGGTGGGTGGCGGCGGCGGGGG + Intronic
1172883730 20:38217836-38217858 CCAGTGGGGAGCGGGGGCGGGGG - Intronic
1172951200 20:38724433-38724455 GCGGAGGGCGGCGGCGGCGGCGG - Intergenic
1173454157 20:43189990-43190012 CGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1173479803 20:43390011-43390033 CCTGTGGGTGGCTGTGGCTGTGG - Intergenic
1173672876 20:44810299-44810321 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1173672940 20:44810508-44810530 GGCGGCGGTGGCGGCGGCGGTGG + Intergenic
1174054586 20:47789035-47789057 CGTGTGGGTGGAGGCGGCAGGGG - Intergenic
1174386666 20:50191526-50191548 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
1175108277 20:56629422-56629444 CCCGCGCGCGGCGGGGGCGGCGG + Exonic
1175338100 20:58209657-58209679 CCCGGTGGGGGCGGGGGCGGGGG - Intergenic
1175715513 20:61252441-61252463 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
1175847055 20:62064893-62064915 CCCGTTCTGGGCGGCGGCGGGGG + Exonic
1175872799 20:62216451-62216473 CTCGGGGGTGGCGGTGGGGGCGG - Exonic
1175877772 20:62238606-62238628 CCTTCGCGTGGCGGCGGCGGGGG - Intronic
1175911401 20:62407002-62407024 CCGGTGGGGGGCTCCGGCGGCGG + Exonic
1175938704 20:62527235-62527257 ACCGTAGGGGGCGGGGGCGGGGG - Intergenic
1175975507 20:62708645-62708667 GCAGTGGGGGGTGGCGGCGGAGG - Intergenic
1176157007 20:63626984-63627006 CCCGGCGGGGGCGGCGGCGTCGG + Intronic
1176185011 20:63773625-63773647 CCCGTGGGTGCCGTCGGAGGGGG - Intronic
1176185041 20:63773725-63773747 CCCGTGGGTGCGGTCGGAGGGGG - Intronic
1176207107 20:63895196-63895218 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1176207111 20:63895199-63895221 ACCCCGGGCGGCGGCGGCGGCGG - Exonic
1176274455 20:64255880-64255902 CCGAGGGGCGGCGGCGGCGGCGG - Intronic
1176549310 21:8214513-8214535 GCCGGGGGTGGGGTCGGCGGGGG + Intergenic
1176549391 21:8214723-8214745 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176549397 21:8214741-8214763 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1176549732 21:8216028-8216050 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176549934 21:8216836-8216858 CCCGGGCGTGGGGGGGGCGGCGG - Intergenic
1176557203 21:8258736-8258758 GCCGGGGGTGGGGTCGGCGGGGG + Intergenic
1176557284 21:8258946-8258968 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176557292 21:8258970-8258992 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1176557623 21:8260257-8260279 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176568242 21:8397551-8397573 GCCGGGGGTGGGGTCGGCGGGGG + Intergenic
1176568319 21:8397757-8397779 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176568325 21:8397775-8397797 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1176568657 21:8399062-8399084 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176568860 21:8399870-8399892 CCCGGGCGTGGGGGGGGCGGCGG - Intergenic
1176576145 21:8441771-8441793 GCCGGGGGTGGGGTCGGCGGGGG + Intergenic
1176576226 21:8441981-8442003 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1176576234 21:8442005-8442027 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1176576568 21:8443291-8443313 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176576774 21:8444105-8444127 CCCGGGCGTGGGGGGGGCGGCGG - Intergenic
1177011052 21:15730365-15730387 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1177011055 21:15730368-15730390 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1178438267 21:32578385-32578407 TCCGTGGGTGCAGGCTGCGGAGG - Intronic
1178487401 21:33027673-33027695 CCGCTGGGGGGCGGGGGCGGCGG + Exonic
1178948435 21:36966745-36966767 CGCGGGGGTGGGGACGGCGGGGG + Intronic
1178961911 21:37073288-37073310 GCCGGAGGTGGCGGCGGCGGCGG + Intronic
1178981662 21:37269675-37269697 CCCGGTGCTGACGGCGGCGGGGG - Intergenic
1179048714 21:37870211-37870233 CCGGGGGGTGGGGGCGGGGGTGG - Intronic
1179561593 21:42219238-42219260 CCCGGGGGCGGCGGCGGCGGCGG - Exonic
1179605619 21:42513744-42513766 GCCGGGGGTCGCGGCGGCCGGGG + Intronic
1180707470 22:17818264-17818286 CCCGGGGGTGGCGGTGGGGGCGG + Exonic
1180950664 22:19719139-19719161 CGCGGGGGCGGCGGCAGCGGCGG - Intronic
1180961936 22:19766182-19766204 TCTGCGGGCGGCGGCGGCGGCGG - Intronic
1180962036 22:19766499-19766521 CCCGGGGCCGGCGGCGCCGGCGG + Exonic
1181026852 22:20131824-20131846 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1181179169 22:21055244-21055266 CCCCTGGGTGGGGGCTGTGGGGG - Intronic
1181528197 22:23502003-23502025 GCAGTGGGTGGCGGAGGTGGAGG - Intergenic
1181934618 22:26429606-26429628 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
1181934619 22:26429609-26429631 CTCGGCGGGGGCGGCGGCGGCGG - Intronic
1182295885 22:29311111-29311133 CCCGTGGGTGGGGGCGGGCCTGG + Intronic
1182374727 22:29838214-29838236 ACCGTGGTCGGCGGCGGCGGCGG - Exonic
1182487269 22:30646985-30647007 CCCGTCGGGGGCTGTGGCGGAGG + Exonic
1182550491 22:31098435-31098457 CTCGTGGGTGGGGGAGGGGGAGG + Intronic
1182663980 22:31944329-31944351 CCGGGCGGCGGCGGCGGCGGTGG + Intronic
1183055015 22:35299898-35299920 CCCGGGGTTGGTGGCAGCGGCGG + Exonic
1183427204 22:37746304-37746326 GCCGAGAGGGGCGGCGGCGGCGG + Intronic
1183466711 22:37983808-37983830 CCCGGGGGAGGCGGCCGAGGCGG - Exonic
1183474357 22:38027693-38027715 GCCTGGGGTGGCGGAGGCGGGGG - Intronic
1183524932 22:38317287-38317309 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1183540710 22:38427841-38427863 CCCAGGGGTGCCTGCGGCGGGGG - Exonic
1183744792 22:39686148-39686170 CCGGGGGCTGGCGGCGGGGGCGG - Exonic
1183788495 22:40045495-40045517 CCCCTGGCTGGCGGTGGCAGAGG + Intronic
1183831114 22:40418722-40418744 GCCGAGGGGGGCGGGGGCGGGGG + Exonic
1184236737 22:43187101-43187123 ACGGCGGGCGGCGGCGGCGGTGG - Exonic
1184523808 22:45009883-45009905 CGCGCGGGAGGAGGCGGCGGCGG - Intronic
1184557412 22:45240844-45240866 GCGGGTGGTGGCGGCGGCGGCGG - Intergenic
1184766874 22:46576868-46576890 CGCGTGGGTGCGAGCGGCGGGGG + Intronic
1184767033 22:46577397-46577419 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1185037934 22:48489463-48489485 CCCGGGCGCGGCGGCGGCGGCGG + Exonic
1185037937 22:48489469-48489491 CGCGGCGGCGGCGGCGGCGGAGG + Exonic
1185255058 22:49827371-49827393 GCCATGTTTGGCGGCGGCGGCGG - Intronic
1185374292 22:50474965-50474987 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1185409412 22:50674362-50674384 CCCGGGGGCGGGGGCGGCGGGGG - Intergenic
1185409438 22:50674437-50674459 CGCAGGGGCGGCGGCGGCGGCGG - Intergenic
1185409600 22:50674817-50674839 CCCGGCGGAGGCGGCGGGGGAGG - Intergenic
1203238465 22_KI270732v1_random:30912-30934 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1203254195 22_KI270733v1_random:130829-130851 GCCGGGGGTGGGGTCGGCGGGGG + Intergenic
1203254276 22_KI270733v1_random:131039-131061 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203254284 22_KI270733v1_random:131063-131085 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1203254618 22_KI270733v1_random:132349-132371 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203254824 22_KI270733v1_random:133162-133184 CCCGGGCGTGGGGGGGGCGGCGG - Intergenic
1203255059 22_KI270733v1_random:133695-133717 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1203262251 22_KI270733v1_random:175908-175930 GCCGGGGGTGGGGTCGGCGGGGG + Intergenic
1203262332 22_KI270733v1_random:176118-176140 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203262340 22_KI270733v1_random:176142-176164 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1203262674 22_KI270733v1_random:177428-177450 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203262880 22_KI270733v1_random:178241-178263 CCCGGGCGTGGGGGGGGCGGCGG - Intergenic
1203263115 22_KI270733v1_random:178774-178796 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
949970240 3:9397671-9397693 CCCGGCAGCGGCGGCGGCGGCGG - Intronic
950316308 3:12004651-12004673 CCGGGGGGCGGCGGCGGCGGCGG - Exonic
950487807 3:13283115-13283137 CCCGGGGGCGGCGCCGGCGGAGG - Intergenic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
950829412 3:15859590-15859612 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
950829413 3:15859593-15859615 CCTCTCGGCGGCGGCGGCGGCGG - Exonic
950902968 3:16513557-16513579 CCGGTGGGTGGAGGCGTGGGCGG + Exonic
951208323 3:19947265-19947287 GCCGGCGGCGGCGGCGGCGGCGG + Exonic
951485285 3:23203232-23203254 GCCGGGGGCGGCGGCAGCGGCGG + Intronic
951611381 3:24495301-24495323 GCGATGGCTGGCGGCGGCGGCGG - Intergenic
951907897 3:27721914-27721936 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
951981970 3:28575978-28576000 CCCGGCGGCGGCGGCGGCGGCGG - Intergenic
952744449 3:36764220-36764242 GCCGGGGGCGGCGGCGGCTGCGG + Intergenic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
953399476 3:42600571-42600593 ACCGAAGGTGGCGGCAGCGGGGG - Intronic
953672696 3:44976126-44976148 CCCGGCAGTGGCGGCGGCCGCGG + Exonic
953705208 3:45225817-45225839 CCCGGAGGAGGCGGCGGCGGCGG - Exonic
953909138 3:46883083-46883105 CCAGTGGGGGGAGGGGGCGGGGG - Intronic
953947774 3:47164012-47164034 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
954176233 3:48847814-48847836 CCCGTCGGTCCCCGCGGCGGCGG - Exonic
954256577 3:49411716-49411738 CCGGTGGGGCGCGGCCGCGGCGG + Intronic
954371378 3:50171145-50171167 CCCCTGGGTGGAGGTGGGGGTGG - Intronic
954402876 3:50328194-50328216 CCTGCGGAAGGCGGCGGCGGCGG - Exonic
954540761 3:51391745-51391767 CCAGGCGGTGGCGGAGGCGGCGG - Exonic
954632925 3:52056654-52056676 CCCGTGGGGAGGGGCGGTGGAGG - Intergenic
954864736 3:53718720-53718742 CCTCTGGGTGTCGGCGGTGGGGG + Exonic
955331331 3:58049932-58049954 CCCGTGGATGGGGGCAGAGGAGG + Intronic
955387611 3:58492064-58492086 CCCGGCGACGGCGGCGGCGGCGG - Intergenic
955768564 3:62369044-62369066 CCAGGAGGCGGCGGCGGCGGCGG + Intergenic
955769238 3:62372525-62372547 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
955911537 3:63863791-63863813 GGCGTGCGCGGCGGCGGCGGCGG + Exonic
955911539 3:63863797-63863819 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
955911548 3:63863834-63863856 GCGGCGGTTGGCGGCGGCGGAGG + Exonic
955911572 3:63863957-63863979 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
956659153 3:71582370-71582392 CACGGCGGTGGCGGCGGCGCCGG - Intronic
956659486 3:71583799-71583821 AGCGCCGGTGGCGGCGGCGGCGG + Intronic
956659487 3:71583802-71583824 GCCGGTGGCGGCGGCGGCGGCGG + Intronic
956675020 3:71725281-71725303 CTCGGGGGCGGCGGCAGCGGCGG + Exonic
956678017 3:71753647-71753669 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
956978925 3:74614451-74614473 GGCGGCGGTGGCGGCGGCGGCGG - Intergenic
958638545 3:96776893-96776915 CGGGTGGGTGGAGCCGGCGGCGG - Intergenic
959560056 3:107768996-107769018 CGGGTGGGGGGCGGCGGGGGGGG + Intronic
960664219 3:120094382-120094404 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
961359151 3:126356684-126356706 GCCGTGGGTGCCGGCGGGTGAGG + Intronic
961551667 3:127673234-127673256 CCGCTGGGGGGCTGCGGCGGGGG - Intronic
961743239 3:129046806-129046828 CCTGGGGGAGGCGGCGGGGGAGG + Intergenic
961827175 3:129605300-129605322 CCGGGCGGTGGCGGCGGCGGCGG - Intronic
962301892 3:134250657-134250679 CTCTTCGGCGGCGGCGGCGGCGG - Exonic
962793989 3:138835004-138835026 CCCCGCGGTGGCGGCGGCGGCGG + Intergenic
962793992 3:138835007-138835029 CGCGGTGGCGGCGGCGGCGGCGG + Intergenic
963236738 3:142963696-142963718 TCCGGGGGCGGCGGCGGCGGAGG - Intergenic
963939795 3:151086661-151086683 CGCTCCGGTGGCGGCGGCGGAGG - Intronic
964219124 3:154324289-154324311 TCCGGAGGAGGCGGCGGCGGCGG - Exonic
964252723 3:154737744-154737766 GGGGTGGGGGGCGGCGGCGGGGG + Intergenic
964570786 3:158105828-158105850 GCCGGCGGAGGCGGCGGCGGAGG - Exonic
966182201 3:177197563-177197585 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
966246045 3:177809010-177809032 CACGGGGGTGGGGGCGGGGGCGG + Intergenic
966866544 3:184261519-184261541 GGCGGGGGTGGCGGCGGCGGCGG + Intronic
966911421 3:184562257-184562279 CCCGGCGGCGGCGACGGCGGCGG - Exonic
967930430 3:194686784-194686806 CAGCTGGGCGGCGGCGGCGGCGG - Exonic
968434124 4:576242-576264 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
968474252 4:795628-795650 CCCGTGAGAGGTGGAGGCGGTGG + Intronic
968479187 4:826261-826283 CCCGGGGGCGGGGGCGGAGGCGG + Intergenic
968479331 4:826487-826509 CCCGGGGGCGGGGGCGGGGGTGG + Intergenic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
968659639 4:1793709-1793731 GCCCTGGGCGGCGGCGGCGGCGG + Intronic
968661807 4:1801762-1801784 CGCGGGGGTGGGGGCGGCAGTGG + Intronic
968674715 4:1871347-1871369 CCCGGCTGCGGCGGCGGCGGCGG + Intergenic
968701298 4:2059399-2059421 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
968874054 4:3255967-3255989 CCAGCAGGCGGCGGCGGCGGCGG + Exonic
968965364 4:3766615-3766637 CCCGGCGCTGGCGGCGGCGCTGG + Exonic
969413354 4:7043477-7043499 CTCGTGCGCGGCGGCGGCGGCGG + Exonic
969868810 4:10092473-10092495 CCTGTGGGAGGCGTCGGCAGAGG - Intronic
970333007 4:15003718-15003740 CACCCGGGCGGCGGCGGCGGCGG + Exonic
970333010 4:15003721-15003743 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
970456225 4:16226561-16226583 GCCGCGGATGGCGGCGGCGGCGG - Intronic
971018948 4:22515684-22515706 CTGCTGGGAGGCGGCGGCGGCGG - Exonic
971272160 4:25160212-25160234 CCCCGGGGTCGCGGCGGCTGGGG + Intronic
971757561 4:30721978-30722000 CCCGGAGGCGGCGGCAGCGGCGG + Exonic
972265342 4:37454012-37454034 CCAGACGGCGGCGGCGGCGGCGG - Intronic
972321551 4:37977359-37977381 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
972533050 4:39977566-39977588 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
972960546 4:44447925-44447947 CACGGTGGTGGCGGCGGCGGCGG - Exonic
974047137 4:56907864-56907886 CCCGCGGGCGGTGGCGGCGGCGG + Intronic
974047139 4:56907867-56907889 GCGGGCGGTGGCGGCGGCGGCGG + Intronic
975342579 4:73258587-73258609 CCCGGCGGTGGCGGCTGTGGCGG - Exonic
975778963 4:77819611-77819633 CCGGGCGGCGGCGGCGGCGGCGG + Intronic
975778980 4:77819664-77819686 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
975985958 4:80202066-80202088 CACGGGGGCGGCGGCGGCGGTGG + Exonic
976246472 4:83010801-83010823 ACTGGTGGTGGCGGCGGCGGCGG - Exonic
977257544 4:94757910-94757932 TCCCGCGGTGGCGGCGGCGGCGG + Intergenic
977257547 4:94757913-94757935 CGCGGTGGCGGCGGCGGCGGCGG + Intergenic
977536579 4:98261433-98261455 CCCGCGGGGGGCGGCCGCCGGGG - Intronic
977809919 4:101346883-101346905 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
977810071 4:101347541-101347563 CGCGGTGTTGGCGGCGGCGGCGG - Intronic
978030628 4:103937064-103937086 CCCGTGGGGGGCGGGGTGGGGGG - Intergenic
978072535 4:104491318-104491340 GCCGGCGGTGGCGGCGGCGGCGG - Exonic
978072537 4:104491321-104491343 CCCGCCGGCGGTGGCGGCGGCGG - Exonic
978072579 4:104491438-104491460 GGGGGGGGTGGCGGCGGCGGCGG - Exonic
978072611 4:104491494-104491516 CATGGCGGTGGCGGCGGCGGCGG + Exonic
978576698 4:110196726-110196748 GGCGTGGCTGGTGGCGGCGGTGG - Intronic
979349667 4:119628965-119628987 CCAGGAGGCGGCGGCGGCGGCGG + Exonic
979565713 4:122152378-122152400 CCCTTGGGTGTCGGTGGCTGCGG + Exonic
979785575 4:124712431-124712453 CCGGGGGGCGGCGGCGGCGGTGG - Intronic
979785645 4:124712701-124712723 CCTGACGGCGGCGGCGGCGGCGG - Exonic
980354542 4:131724912-131724934 CCTGGAGGTTGCGGCGGCGGCGG - Intergenic
981270746 4:142845727-142845749 GCCGGCGGCGGCGGCGGCGGCGG + Intronic
981315445 4:143336352-143336374 CCCCGGGGTGGGGGAGGCGGCGG + Intergenic
981615440 4:146639297-146639319 GCTGGTGGTGGCGGCGGCGGCGG + Exonic
982042404 4:151409126-151409148 CGCGGGGGGGGCGGGGGCGGGGG - Intergenic
982157216 4:152535276-152535298 CCCGAGGGCGGCGGGGCCGGGGG - Exonic
982712253 4:158769133-158769155 GCCGGGGGCGGCGGCCGCGGTGG - Exonic
983077495 4:163343909-163343931 CCCGGCGGTGGCGGCAGCAGCGG - Intronic
983249285 4:165326892-165326914 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
983537968 4:168878153-168878175 ACCGGGGGTGGCGGGGGCGGGGG - Intronic
983577007 4:169271021-169271043 AAAGTGGGAGGCGGCGGCGGCGG - Exonic
983940161 4:173529185-173529207 GCAGCGGCTGGCGGCGGCGGCGG + Exonic
983940285 4:173529558-173529580 ACCGGAGGCGGCGGCGGCGGCGG - Exonic
983941620 4:173538842-173538864 CGCGCGGGGGGAGGCGGCGGAGG + Intergenic
984206288 4:176792213-176792235 CTCGAAGGCGGCGGCGGCGGCGG + Exonic
984668096 4:182449186-182449208 CGCGGCGGTGGCGGTGGCGGTGG + Intronic
984668101 4:182449201-182449223 GGCGGTGGTGGCGGCGGCGGCGG + Intronic
984917009 4:184734033-184734055 CGCGGGGGCGGCGGCGGCCGCGG - Exonic
985057923 4:186051248-186051270 CCCGGGGGTGGTGGAGGAGGTGG + Intergenic
985532685 5:443224-443246 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
985782463 5:1878374-1878396 CAGGGAGGTGGCGGCGGCGGCGG + Exonic
985791696 5:1931584-1931606 CCCGCGGGTGGCGGCGGCTGTGG - Intergenic
985896294 5:2751562-2751584 CCCGCGGGCCGGGGCGGCGGCGG + Exonic
986297119 5:6448809-6448831 CCCGGCGGTGGCGGCGGCGGCGG + Exonic
986330518 5:6713649-6713671 CGCGGGGGCCGCGGCGGCGGCGG - Intergenic
986330558 5:6713773-6713795 CCGGCGTGGGGCGGCGGCGGCGG - Intergenic
986330586 5:6713852-6713874 GCCGGTGGCGGCGGCGGCGGCGG - Intergenic
986721648 5:10564525-10564547 CCCCGGGGTGGGGACGGCGGTGG - Exonic
986813661 5:11385162-11385184 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
987050403 5:14143567-14143589 GCGGCGGGGGGCGGCGGCGGCGG - Intergenic
987087975 5:14487499-14487521 AGCGGGGGCGGCGGCGGCGGCGG + Exonic
987132391 5:14871814-14871836 CCGGGCGGCGGCGGCGGCGGCGG - Intergenic
987132393 5:14871817-14871839 CCTCCGGGCGGCGGCGGCGGCGG - Intergenic
987258263 5:16179466-16179488 CCCGGCGGCGGCGTCGGCGGCGG + Exonic
987258269 5:16179475-16179497 GGCGTCGGCGGCGGCGGCGGGGG + Exonic
988437532 5:31193808-31193830 CGCGGCGGCGGCGGCGGCGGAGG + Exonic
988609539 5:32711858-32711880 GGCGTTGGCGGCGGCGGCGGTGG + Exonic
988825300 5:34929660-34929682 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
989103326 5:37839693-37839715 CCTGTTGGCGGCGGCGGCGGCGG - Intergenic
989229993 5:39074480-39074502 CCCCTCGGCGGCGACGGCGGCGG + Intergenic
989812573 5:45695879-45695901 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
989812673 5:45696213-45696235 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
989998735 5:50867305-50867327 CCTGTGGGTGGTGGTTGCGGGGG - Intergenic
990545249 5:56815637-56815659 CCTGAGGCAGGCGGCGGCGGAGG + Exonic
990607145 5:57422570-57422592 CCCCGCGGTGTCGGCGGCGGGGG + Intergenic
990825460 5:59893429-59893451 GGCGAGGGTGGCGGCGGCGGGGG + Exonic
990954875 5:61331782-61331804 CTCGTGGGTCGCAGCGGGGGAGG - Intergenic
990955026 5:61332324-61332346 CCGGGCGGCGGCGGCGGCGGCGG + Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
990955143 5:61332802-61332824 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
990955146 5:61332805-61332827 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
990955167 5:61332836-61332858 CCCGTCGGTGGGGGCTGCCGGGG + Exonic
991435908 5:66596842-66596864 CCCAACGGCGGCGGCGGCGGCGG - Exonic
992105597 5:73447445-73447467 CGGGTGGAAGGCGGCGGCGGCGG + Exonic
992105726 5:73448043-73448065 GCCGGTGGGGGCGGCGGCGGCGG - Exonic
992550155 5:77852032-77852054 CCCGGCGGTGCCCGCGGCGGCGG - Intronic
993726948 5:91380223-91380245 CGCGCGGGCGGCAGCGGCGGCGG - Intronic
994043625 5:95284671-95284693 GCTGGCGGTGGCGGCGGCGGCGG + Intergenic
994072826 5:95620849-95620871 GACGTTGGCGGCGGCGGCGGCGG - Exonic
994367108 5:98928809-98928831 CGCGACGGCGGCGGCGGCGGCGG - Exonic
995574376 5:113513935-113513957 CCTGGCGGTGGCGGAGGCGGCGG + Exonic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
997259198 5:132452992-132453014 CCTGGAGGTGGCAGCGGCGGTGG + Intronic
997470199 5:134113300-134113322 CCCGGAGGTGGCGGGGGAGGGGG + Intergenic
997500728 5:134371472-134371494 CTCGGCGGCGGCGGCGGCGGCGG + Exonic
997560968 5:134846015-134846037 ACCGTGCGCGGCGGCCGCGGCGG + Exonic
997583906 5:135033805-135033827 TCATGGGGTGGCGGCGGCGGCGG + Exonic
997899830 5:137754315-137754337 AGCGGAGGTGGCGGCGGCGGCGG - Exonic
997955362 5:138274629-138274651 CGCGGGGGTGGGGGCGGGGGAGG + Exonic
998143228 5:139711328-139711350 CTCGGCGGCGGCGGCGGCGGCGG - Intergenic
998148603 5:139744588-139744610 CACGATGGTGGCAGCGGCGGGGG + Intergenic
998199414 5:140107825-140107847 GCCGTCTGCGGCGGCGGCGGCGG + Intronic
998331667 5:141332760-141332782 CCTGGTGGTGGCGGCGGCCGCGG + Exonic
999956590 5:156709836-156709858 CGGGAGGGTGGCGGCGTCGGGGG - Intronic
1000319029 5:160119162-160119184 CCCGGCGGCGGCGGTGGCGGCGG + Exonic
1002058068 5:176610052-176610074 CGCTCGGGCGGCGGCGGCGGCGG - Exonic
1002058220 5:176610570-176610592 GCCGGGGGTGGGGGGGGCGGAGG - Intergenic
1002184227 5:177446862-177446884 CCTGCGGGGGGAGGCGGCGGCGG - Exonic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002621971 5:180494453-180494475 GGCGTCGGTGGCGGCGGCGACGG + Exonic
1002666774 5:180831186-180831208 CCCCGAGGCGGCGGCGGCGGCGG - Intergenic
1002897961 6:1390054-1390076 CTCCGGGGCGGCGGCGGCGGCGG - Exonic
1002927305 6:1611781-1611803 CACGGCGGCGGCGGCGGCGGCGG + Exonic
1003261016 6:4516156-4516178 CCTGCGGGTGGGGGAGGCGGTGG + Intergenic
1003421091 6:5959192-5959214 GCAGTGGGTGGCGGGGGAGGGGG + Intergenic
1003551832 6:7107682-7107704 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1003645529 6:7910641-7910663 CCAGGAGGCGGCGGCGGCGGCGG - Exonic
1003870383 6:10398269-10398291 CCCAAGGGCAGCGGCGGCGGCGG + Exonic
1004043934 6:12009112-12009134 CGTGGCGGTGGCGGCGGCGGCGG + Intronic
1004044691 6:12012450-12012472 CCCCCGCGCGGCGGCGGCGGCGG - Exonic
1004193976 6:13487714-13487736 CCCGGAGCTGGCGGCGGCGGGGG - Intergenic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1004396123 6:15248128-15248150 CCCGTGGCTGGCGGCGGCTGCGG + Intronic
1004663344 6:17729029-17729051 GCCGGCGGTGGTGGCGGCGGGGG - Intergenic
1004690342 6:17987683-17987705 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1005040307 6:21595030-21595052 CATGGGGGCGGCGGCGGCGGCGG + Exonic
1005040413 6:21595456-21595478 CCCGTGGGCGGCGTGGGCGCGGG + Exonic
1005076135 6:21909868-21909890 CCCGGGGGGTGGGGCGGCGGAGG - Intergenic
1006076281 6:31534690-31534712 GCGGTGGATGGCGGCAGCGGAGG - Intronic
1006337545 6:33428238-33428260 CGCGGTGGCGGCGGCGGCGGCGG + Intronic
1006472656 6:34237328-34237350 CCCGGGGCCCGCGGCGGCGGCGG + Intronic
1006491606 6:34392605-34392627 GTCGGGGGTGGCGGCGGCAGAGG - Exonic
1006642816 6:35497377-35497399 CCCGTCGGTGCCGGGGGCCGTGG + Intergenic
1007095000 6:39207634-39207656 CAGGTGGGTGGCGGGGGTGGGGG + Intronic
1007429942 6:41770903-41770925 CCCTTGGGGAGCCGCGGCGGCGG + Exonic
1007584258 6:42979048-42979070 CCCGTGGCCGGCGGCGGAGCTGG - Exonic
1007637665 6:43308856-43308878 GCCGTGGGTGGAGCCTGCGGAGG - Intronic
1007739635 6:44002766-44002788 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1007784200 6:44270776-44270798 GCCGCCGGCGGCGGCGGCGGCGG + Exonic
1007784202 6:44270779-44270801 GCCGGCGGCGGCGGCGGCGGTGG + Exonic
1008092751 6:47309377-47309399 ACCGGGGGTGGCGGCGGCGCCGG - Intronic
1008369183 6:50714132-50714154 CGTGTGTGTGGCGGCGGCGGCGG + Intronic
1008369191 6:50714156-50714178 GGCGGCGGTGGCGGCGGCGGTGG + Intronic
1010141959 6:72622388-72622410 ACGCTCGGTGGCGGCGGCGGTGG + Exonic
1011128764 6:84033788-84033810 GCGGTGGGAGGCGGCGGCGGCGG + Exonic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1011931792 6:92723601-92723623 CCCGGGGCTGGCGGCGACGGAGG - Intergenic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1012475776 6:99613749-99613771 CCAGGCGGCGGCGGCGGCGGCGG - Exonic
1012475913 6:99614301-99614323 ACCGGGGGCGGCGGCAGCGGAGG + Exonic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013575850 6:111483137-111483159 CCCGGCGGTGGCGGCAGTGGCGG - Exonic
1013836550 6:114342202-114342224 CCCGGCGGTGGCGGCGCGGGCGG + Exonic
1013836601 6:114342415-114342437 CACGCAGGCGGCGGCGGCGGCGG + Exonic
1014029115 6:116681124-116681146 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1014137541 6:117907191-117907213 GCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1014137622 6:117907476-117907498 GCCGGGGCGGGCGGCGGCGGCGG + Intergenic
1014137710 6:117907817-117907839 GCCGAGGGCAGCGGCGGCGGCGG + Exonic
1014272188 6:119348484-119348506 CTCGCGGATGGCGGCGTCGGCGG + Exonic
1014947489 6:127515666-127515688 CCCAATGGCGGCGGCGGCGGAGG - Exonic
1014947583 6:127516031-127516053 CCCCTGGGCGGCGGCGGCTGCGG + Exonic
1015148927 6:130018508-130018530 CCCGGCAGCGGCGGCGGCGGCGG + Exonic
1015220628 6:130801465-130801487 AGCCGGGGTGGCGGCGGCGGTGG + Intergenic
1017164160 6:151391557-151391579 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1017672240 6:156778732-156778754 CCCGGCGGCGGCGGCGGAGGCGG - Exonic
1017672280 6:156778839-156778861 CCCGGCGCGGGCGGCGGCGGCGG + Exonic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017793624 6:157823033-157823055 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1017842351 6:158232212-158232234 GCGGGGGGAGGCGGCGGCGGCGG + Intergenic
1018156651 6:160991704-160991726 GGCGGCGGTGGCGGCGGCGGCGG - Intergenic
1018156731 6:160992013-160992035 GGCGGTGGTGGCGGCGGCGGCGG - Exonic
1018400493 6:163415142-163415164 TCCGGCGGCGGCGGCGGCGGCGG + Exonic
1018686128 6:166306748-166306770 CAGGTGGGTGGCCGCGACGGTGG - Exonic
1018696699 6:166396573-166396595 CCAGTGGCTGGGGGCGGGGGTGG + Intergenic
1019111923 6:169724003-169724025 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1019308308 7:346825-346847 GCCCCGGGTGGCGGCGGTGGTGG - Intergenic
1019343661 7:519755-519777 CCCGGCGGCGGCTGCGGCGGAGG - Intronic
1019404547 7:876835-876857 CCAATGGGAGGCGGCGGGGGCGG - Intronic
1019474248 7:1236433-1236455 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1019498642 7:1353127-1353149 CCAGTGGGTGGGGAAGGCGGTGG - Intergenic
1019530141 7:1499210-1499232 CCAGTTGGGGGCGGCGGGGGCGG - Intronic
1019562632 7:1666079-1666101 CCCGAGCGCGGCGGCGGCGGCGG - Intergenic
1019701581 7:2476968-2476990 CCAGTGGGGGCAGGCGGCGGGGG - Intergenic
1019732107 7:2634156-2634178 GCCGGGAGTGGAGGCGGCGGGGG - Intronic
1019828225 7:3301269-3301291 CCGGGCGGGGGCGGCGGCGGCGG + Intergenic
1019828226 7:3301272-3301294 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1019828331 7:3301611-3301633 GCGGCCGGTGGCGGCGGCGGCGG + Exonic
1019989585 7:4682394-4682416 CGCGGGGAAGGCGGCGGCGGCGG - Exonic
1019989615 7:4682465-4682487 AGCGGCGGTGGCGGCGGCGGCGG - Exonic
1020099878 7:5388793-5388815 CCCTTGGGGGGCGCGGGCGGCGG + Exonic
1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG + Exonic
1020278291 7:6637467-6637489 CCGGTGGGCGGCGGCGCGGGCGG + Intronic
1020278308 7:6637515-6637537 CTCGGGGGCGGCGGCGGCGGCGG + Intronic
1020727339 7:11832144-11832166 CCCGCCAGAGGCGGCGGCGGCGG - Exonic
1020999623 7:15312526-15312548 CCAGTGCATGGCGGGGGCGGTGG + Intronic
1021231101 7:18086897-18086919 CCCCCGCGCGGCGGCGGCGGCGG + Intergenic
1021231106 7:18086903-18086925 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1021313171 7:19117137-19117159 GCCGCGGGTGGGGGCGTCGGAGG - Exonic
1021451255 7:20785341-20785363 TCCGGGGGCAGCGGCGGCGGCGG - Exonic
1021614393 7:22487554-22487576 GCCGAGGATGGCGGGGGCGGGGG + Intronic
1022090048 7:27102141-27102163 TGCGGCGGTGGCGGCGGCGGCGG + Exonic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022106158 7:27199457-27199479 CGCGAAGGCGGCGGCGGCGGCGG + Exonic
1022230532 7:28409144-28409166 CCCGGGAGCGGCAGCGGCGGGGG - Intronic
1022698067 7:32728898-32728920 CCTGAGGATGGCGGCGGCGGCGG + Intergenic
1022714993 7:32891406-32891428 CGGGTGGGAGGCGGCGGCCGCGG - Intronic
1022739725 7:33109416-33109438 TCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1022960183 7:35418902-35418924 GGCGGTGGTGGCGGCGGCGGCGG + Intergenic
1024043861 7:45574559-45574581 CGCGGCGGAGGCGGCGGCGGAGG + Exonic
1024579953 7:50793348-50793370 CCCCTGGGTGGCGGCAGCGCCGG - Intronic
1025069682 7:55887600-55887622 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025615710 7:63114427-63114449 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1025916885 7:65873228-65873250 CCAATGGGGCGCGGCGGCGGCGG + Intergenic
1025916888 7:65873237-65873259 CGCGGCGGCGGCGGCGGCGGTGG + Intergenic
1025916893 7:65873252-65873274 GGCGGTGGTGGCGGCGGCGGCGG + Intronic
1025916924 7:65873339-65873361 GCGGAGGGAGGCGGCGGCGGCGG + Intronic
1026198461 7:68193514-68193536 CCAGGTGGTGGTGGCGGCGGGGG + Intergenic
1026850338 7:73719635-73719657 CCCGGGAGTGGCAGCGGCGCCGG + Exonic
1027126408 7:75559705-75559727 GCGGTGGGTGGGGGCGGGGGCGG - Intronic
1027138195 7:75639190-75639212 ACCGGGGCAGGCGGCGGCGGCGG + Intronic
1027177789 7:75915501-75915523 CCCGTGGGGGGCGGCGGCGCGGG - Intronic
1027374505 7:77537093-77537115 CCCGTGGGGAGAGGCGGCTGCGG + Intergenic
1027539888 7:79453606-79453628 GGCGTCGGCGGCGGCGGCGGCGG + Intergenic
1028160106 7:87475725-87475747 CGCGTGGGGGGCGGGGGCGGGGG - Exonic
1028173722 7:87628860-87628882 CGCGGCGGTGGCGGCGGAGGCGG + Exonic
1028762257 7:94509686-94509708 CCGGCGGGCGGCGGCGGCTGCGG - Intronic
1028922340 7:96322037-96322059 CCCGGCGGCGGCGGCGGTGGGGG + Exonic
1029281560 7:99438948-99438970 CCCTCGGGCGGCGGCGGCGGCGG + Intronic
1029456215 7:100673839-100673861 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1029461137 7:100694370-100694392 GCGGAGGGAGGCGGCGGCGGCGG - Intergenic
1029537110 7:101163335-101163357 GACGTGGGTGGGGGCGGGGGCGG + Exonic
1029640257 7:101815901-101815923 GTCCTCGGTGGCGGCGGCGGCGG + Intronic
1029896401 7:103989361-103989383 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1029996753 7:105014153-105014175 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1030033309 7:105388474-105388496 CCCGGGGGGAGGGGCGGCGGCGG - Intronic
1030138739 7:106284676-106284698 CCCGGGGGAGGCGCGGGCGGCGG - Intronic
1030176499 7:106660421-106660443 TCCTCGGGGGGCGGCGGCGGTGG + Exonic
1031886857 7:127252862-127252884 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1031910657 7:127513504-127513526 GCAGTGTGCGGCGGCGGCGGCGG - Intergenic
1032119315 7:129144954-129144976 CCCGGGGGCGGTGGCGGCGGCGG + Exonic
1032174358 7:129611696-129611718 CTCCTCGGCGGCGGCGGCGGCGG + Exonic
1032194370 7:129780819-129780841 CCCGGCGGCGGCGGCAGCGGTGG - Intergenic
1032215280 7:129952690-129952712 CGTGCGGGGGGCGGCGGCGGCGG - Exonic
1032306231 7:130734190-130734212 CGCGCGGGCGGCGGCGGCAGCGG - Intergenic
1033253175 7:139777773-139777795 CCCGTGGCCGGCGCCGGGGGAGG + Intronic
1033300075 7:140177280-140177302 CGCGGTGGTGGCGGTGGCGGCGG + Intergenic
1033477198 7:141702228-141702250 CCGGCGGGCGGCGGCGGCGTTGG - Intergenic
1033654139 7:143362098-143362120 CCAGATGGAGGCGGCGGCGGGGG + Intronic
1033654349 7:143362777-143362799 CCAGGCGGCGGCGGCGGCGGCGG - Intergenic
1034222780 7:149459501-149459523 CCCGTCGGGGGCGGCGGGGGAGG - Intronic
1034306281 7:150047667-150047689 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1034441152 7:151086680-151086702 CGCGGCGGAGGCGGCGGCGGCGG - Intronic
1034441217 7:151086862-151086884 CCCGGGGCCGGGGGCGGCGGCGG + Exonic
1034469721 7:151248755-151248777 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1035167541 7:157000461-157000483 CGCGTGGGGCGCGGCGGCGAAGG - Intronic
1035169540 7:157009946-157009968 CCCAGCGGCGGCGGCGGCGGCGG + Exonic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035169609 7:157010208-157010230 ACCGGAGGTGGCGGCGGCGGCGG - Exonic
1035273996 7:157736545-157736567 GCTGTGGGGGGCGGCGGGGGTGG - Intronic
1035363350 7:158328794-158328816 TCCCTGGGTGGCGGGGGGGGGGG - Intronic
1035553014 8:544653-544675 CGCCTGGGCGGCGGCGGCGGCGG + Exonic
1035602142 8:902937-902959 CAGGTGGGTGGGGGCGGGGGCGG + Intergenic
1035629795 8:1098607-1098629 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629808 8:1098644-1098666 GGCGTGGGTGGCGGCGTCCGTGG - Intergenic
1035629822 8:1098681-1098703 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629836 8:1098718-1098740 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035629850 8:1098755-1098777 GGCGTGGGTGGCGGCGCCCGTGG - Intergenic
1035828297 8:2668198-2668220 CCAGAGGGTGGCAGGGGCGGGGG + Intergenic
1036663876 8:10726339-10726361 CCGGCTGGTGGTGGCGGCGGCGG - Exonic
1036723757 8:11201218-11201240 CCCGGGGGAGGCGGCTGCGGCGG - Exonic
1037273727 8:17156505-17156527 CCCGGCGGAGGCGGAGGCGGCGG - Exonic
1037273793 8:17156680-17156702 CCCGCGGGCGGCGGCGGAGCTGG + Exonic
1037535226 8:19817435-19817457 CCCCGCGGTGGCGGCGGCGGCGG + Exonic
1037535229 8:19817438-19817460 CGCGGTGGCGGCGGCGGCGGCGG + Exonic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037901765 8:22692960-22692982 GGCGGCGGTGGCGGCGGCGGCGG - Exonic
1038012140 8:23483641-23483663 ACCCTGGGTGGCGGCCGCAGCGG + Intergenic
1038266764 8:26044225-26044247 CCAGAGGGTGGCGGCGGCGAGGG - Intronic
1038304031 8:26383280-26383302 CGCGCCGGTGGCGGCGGCCGGGG - Intronic
1038490550 8:27967501-27967523 TCACTGGGTGGGGGCGGCGGGGG + Intronic
1038575641 8:28701612-28701634 CGCGCAGGCGGCGGCGGCGGCGG + Exonic
1038789786 8:30658135-30658157 ACTGGCGGTGGCGGCGGCGGCGG + Exonic
1038828532 8:31033119-31033141 GCTGGCGGTGGCGGCGGCGGTGG - Exonic
1039453884 8:37695807-37695829 AGCGGCGGTGGCGGCGGCGGCGG + Exonic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1039454624 8:37698469-37698491 CCCGGGGCTGCCGGGGGCGGCGG - Exonic
1039595452 8:38787124-38787146 CGCGGGGGCGGCGGCGGCGCCGG - Intronic
1040038832 8:42896739-42896761 CCCGGCGGCAGCGGCGGCGGCGG + Intronic
1040065590 8:43141293-43141315 CCAGGCGGCGGCGGCGGCGGCGG - Intronic
1040279540 8:46031967-46031989 TCCGAGGGTGGGGGCGGGGGCGG + Intergenic
1041059502 8:54022276-54022298 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1041167208 8:55102141-55102163 CCTGCTGCTGGCGGCGGCGGCGG + Intergenic
1041280997 8:56211311-56211333 GACGTCGGCGGCGGCGGCGGCGG - Intronic
1041552681 8:59119260-59119282 CCCGGCGGCGGCGGCAGCGGCGG - Intergenic
1041689917 8:60678764-60678786 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1041690003 8:60679109-60679131 CCCGGGAGGGGCGGCGGCGGCGG + Intronic
1041690396 8:60680409-60680431 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1042040218 8:64581385-64581407 GGCCTGGGCGGCGGCGGCGGCGG + Exonic
1042155692 8:65841974-65841996 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1042532865 8:69833001-69833023 CCCAGCGGCGGCGGCGGCGGCGG - Exonic
1042611665 8:70607787-70607809 CCTGCGGGAGGGGGCGGCGGCGG + Intronic
1043388252 8:79768308-79768330 CGCGCTGGCGGCGGCGGCGGCGG + Intergenic
1043388551 8:79769757-79769779 CCCGTTGGGGGCGGTGGTGGAGG - Intergenic
1043502955 8:80874322-80874344 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1043502958 8:80874325-80874347 CTCCCGGGCGGCGGCGGCGGCGG - Intronic
1044115268 8:88327583-88327605 GCTGGGGGCGGCGGCGGCGGCGG - Intronic
1044685658 8:94823405-94823427 CCTGGTGGTAGCGGCGGCGGGGG + Exonic
1045107348 8:98905682-98905704 CCTCTGGGTGGCAGCGGCGGAGG + Intronic
1045516295 8:102863627-102863649 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1045564362 8:103298789-103298811 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1045575471 8:103415373-103415395 CCTGTGGGAGGAGGTGGCGGTGG + Exonic
1045674064 8:104588979-104589001 CTCGGCGGCGGCGGCGGCGGCGG - Exonic
1045851063 8:106698015-106698037 CCAATGGGTGGCGGTGGCTGCGG + Intronic
1046547420 8:115669079-115669101 GCCGGGCGGGGCGGCGGCGGCGG - Intronic
1046770367 8:118111689-118111711 CCGGCTGGAGGCGGCGGCGGCGG + Exonic
1047732289 8:127737377-127737399 CCCGAGGGCGGCCGCGGCAGGGG - Intronic
1048214266 8:132480869-132480891 CTCCGGGGCGGCGGCGGCGGCGG + Exonic
1049024794 8:139980871-139980893 TCCGTGGGTGGCTTCTGCGGTGG - Intronic
1049220768 8:141427822-141427844 CCAGTGAGTGGCCGCGGTGGTGG + Exonic
1049396409 8:142403086-142403108 CCCAGGTGAGGCGGCGGCGGTGG - Exonic
1049462897 8:142738394-142738416 TCCGGGGGTGGGGGCGGCTGGGG - Intergenic
1049614644 8:143570834-143570856 CCAGGGGGTGGGGGCGGGGGTGG - Intronic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049694251 8:143975933-143975955 CCGGTGAGTGGAGGGGGCGGTGG - Intronic
1050437928 9:5629198-5629220 CGAGTCGGCGGCGGCGGCGGCGG - Exonic
1052160685 9:25255132-25255154 CCTGGTGGTGGTGGCGGCGGGGG - Intergenic
1052243871 9:26309762-26309784 CCCTGGGGTGGCGGTGGCTGAGG - Intergenic
1052362158 9:27573214-27573236 CCCGGCGGCGGCGGCGGCGGCGG - Intronic
1052765379 9:32635092-32635114 CCCGGGGGTGGAGGTGGAGGAGG + Exonic
1052888824 9:33676951-33676973 CACGGGGGGTGCGGCGGCGGCGG + Intergenic
1052888837 9:33677017-33677039 CACGGCGGCGGCGGCGGCGGCGG - Intergenic
1052903987 9:33817735-33817757 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1053114609 9:35490119-35490141 GCCGGCGGCGGCGGCGGCGGCGG - Intronic
1053114610 9:35490122-35490144 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1053151202 9:35744385-35744407 CCCTTGGGTGGCATCGGGGGAGG - Exonic
1053152004 9:35749314-35749336 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1053397022 9:37784752-37784774 CCCGGCAGTGGCAGCGGCGGCGG - Exonic
1053697502 9:40651087-40651109 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054308791 9:63450487-63450509 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054762323 9:69014122-69014144 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1054835571 9:69672287-69672309 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1055091116 9:72365282-72365304 CCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1055266310 9:74498815-74498837 GCAGGCGGTGGCGGCGGCGGCGG + Intronic
1055514160 9:77020147-77020169 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1055514166 9:77020162-77020184 ACCATGTGCGGCGGCGGCGGGGG - Exonic
1055611781 9:78031593-78031615 CTCGCAGGCGGCGGCGGCGGCGG - Intergenic
1055722698 9:79193685-79193707 CCCGCAGGTGAGGGCGGCGGCGG + Intergenic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1056154050 9:83817559-83817581 CGCGGGAGAGGCGGCGGCGGGGG - Exonic
1056356447 9:85805534-85805556 CGCGGGAGAGGCGGCGGCGGGGG + Intergenic
1056799500 9:89681412-89681434 CCCGGGGGGGGCGGGGGGGGCGG - Intergenic
1056799530 9:89681465-89681487 GCGGCGGGGGGCGGCGGCGGTGG - Intergenic
1057245478 9:93451526-93451548 CCCGGAGGCGGCGGCGGAGGCGG - Intronic
1057259667 9:93576674-93576696 CGCGGGGGCGGCGGGGGCGGCGG - Exonic
1057489143 9:95508366-95508388 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1057489146 9:95508369-95508391 CCCCGCGGCGGCGGCGGCGGCGG - Exonic
1057801233 9:98192571-98192593 CGCGCAGGTGGCGGTGGCGGCGG + Intronic
1057869706 9:98708673-98708695 CGCGCGGGCGGCGGTGGCGGCGG + Exonic
1057869708 9:98708679-98708701 GGCGGCGGTGGCGGCGGCGGCGG + Exonic
1057881586 9:98796488-98796510 GCCGCGCGTGGCGGCGGCGATGG - Exonic
1057996128 9:99822744-99822766 CTCGGCGGCGGCGGCGGCGGCGG + Intronic
1058053285 9:100427253-100427275 CCGGGCGGCGGCGGCGGCGGCGG - Intronic
1058058672 9:100473674-100473696 CCGGGTGGTGGCGGCGGCAGCGG + Exonic
1058843664 9:108934459-108934481 GGCGGGGGTGGCGGCGCCGGAGG + Exonic
1058885943 9:109321022-109321044 CCCGGCGGCAGCGGCGGCGGCGG - Intergenic
1059283044 9:113150982-113151004 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1059470934 9:114504716-114504738 GCCGGGGCGGGCGGCGGCGGGGG - Exonic
1059483710 9:114611525-114611547 TCCCGGGGTGGCGGCGGCGGCGG + Exonic
1059633938 9:116154347-116154369 CCCGGCGGCGGCGGCGGCGGCGG - Exonic
1059668604 9:116472768-116472790 CATGTTGGTGGTGGCGGCGGCGG + Intronic
1059769885 9:117414957-117414979 GCTGCGGGCGGCGGCGGCGGTGG + Exonic
1060087328 9:120714426-120714448 CCCGGTGGCGGTGGCGGCGGCGG - Exonic
1060263139 9:122093091-122093113 CCGGTGGGAGGCGGAGGCGGTGG - Exonic
1060280804 9:122214248-122214270 GCAGTGGGCGGCGGGGGCGGGGG - Intronic
1060301338 9:122376131-122376153 CCTGTGGCTGGGGGAGGCGGGGG + Intronic
1060514585 9:124257945-124257967 GCAGGCGGTGGCGGCGGCGGCGG + Exonic
1060549369 9:124477805-124477827 CCCGCGGGTGGGGGCGGGGCAGG - Intronic
1060700476 9:125746547-125746569 CCCGGGGGCGGTGCCGGCGGCGG + Intergenic
1060700610 9:125746960-125746982 CCCGGGGGAGGCAGCGGCGGCGG - Intergenic
1060700681 9:125747180-125747202 CGCGGCGGTGGCGGAGGCGGAGG - Intergenic
1060770182 9:126326830-126326852 ACCGAGAGCGGCGGCGGCGGCGG - Exonic
1060770223 9:126326981-126327003 CGCTGGGGCGGCGGCGGCGGTGG - Exonic
1060814071 9:126625708-126625730 GACGAGGGTGGCGGCGGCGGCGG - Intronic
1060979646 9:127785177-127785199 ACCGGGGGAGGCGGAGGCGGGGG + Intergenic
1061033408 9:128100328-128100350 CTCCTGGGAGGCGGGGGCGGGGG + Intronic
1061144119 9:128787268-128787290 TCCCTGGGGGGCGGCGGCGGCGG + Exonic
1061144122 9:128787271-128787293 CTGGGGGGCGGCGGCGGCGGCGG + Exonic
1061256091 9:129454625-129454647 GCGGTGGGTGGCGGAGGTGGAGG + Intergenic
1061293624 9:129665922-129665944 AGCGCGGGTGGAGGCGGCGGCGG - Exonic
1061453500 9:130681620-130681642 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1061541079 9:131278037-131278059 TCCGCAGGCGGCGGCGGCGGCGG + Intergenic
1061975826 9:134067714-134067736 GGCGGCGGTGGCGGCGGCGGTGG - Intronic
1061975832 9:134067726-134067748 GCCCGGGGTCGCGGCGGCGGTGG - Intronic
1062150938 9:135018697-135018719 CCCGTGGGTGACTGTGGTGGTGG - Intergenic
1062272140 9:135714459-135714481 CCGGTGGGTCGCGGTGGCCGCGG + Intronic
1062305765 9:135906707-135906729 CCCGTTGGCGGCGGCGGCGGCGG - Intronic
1062305958 9:135907313-135907335 CGCGGGGGCGGCGACGGCGGCGG - Intergenic
1062511760 9:136910057-136910079 CCCGTGGGTGGGGGTGGGGCAGG + Intronic
1062567531 9:137169954-137169976 ACCGCGGGTGCCGGGGGCGGGGG - Exonic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062718448 9:138022801-138022823 ACCGTGGGGGGGGGGGGCGGCGG + Intronic
1202779847 9_KI270717v1_random:24375-24397 CGCGGCGGCGGCGGCGGCGGCGG + Intergenic
1203771685 EBV:52919-52941 CCAGTAGGAGTCGGCGGCGGCGG + Intergenic
1203441790 Un_GL000219v1:16062-16084 CCCGTGGGTGGGCGCGGGAGTGG - Intergenic
1203470596 Un_GL000220v1:113973-113995 GCCGGGGGTGGGGTCGGCGGGGG + Intergenic
1203470677 Un_GL000220v1:114183-114205 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203470685 Un_GL000220v1:114207-114229 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1203471019 Un_GL000220v1:115493-115515 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203471225 Un_GL000220v1:116307-116329 CCCGGGCGTGGGGGGGGCGGCGG - Intergenic
1203478417 Un_GL000220v1:157945-157967 GCCGGGGGTGGGGTCGGCGGGGG + Intergenic
1203478498 Un_GL000220v1:158155-158177 CGCGCGGGTCGGGGCGGCGGCGG + Intergenic
1203478506 Un_GL000220v1:158179-158201 GGCGGCGGTGGCGGCGGCGGCGG + Intergenic
1203478840 Un_GL000220v1:159465-159487 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203479046 Un_GL000220v1:160279-160301 CCCGGGCGTGGGGGGGGCGGCGG - Intergenic
1185457758 X:319238-319260 CTCGGCGGCGGCGGCGGCGGCGG + Intergenic
1185505467 X:630131-630153 CGCTTGGGAGGCGGCGGCGGCGG - Intronic
1185603827 X:1355644-1355666 CCCCTGGGGGGCGGAGGTGGGGG + Intronic
1187181402 X:16946745-16946767 GGCGGTGGTGGCGGCGGCGGCGG + Exonic
1187363693 X:18649978-18650000 CCTGAGCGGGGCGGCGGCGGCGG - Intronic
1187518155 X:19990953-19990975 GCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1187547393 X:20267071-20267093 CCCCTGGGTGCGCGCGGCGGTGG - Intronic
1187648295 X:21374031-21374053 CCCGGCGGTGGCGGCCACGGCGG - Intergenic
1187648323 X:21374140-21374162 CGCGTGCGCGGCGGCGGAGGCGG - Intergenic
1188005517 X:25013594-25013616 CGCGCGGTTGGCGGTGGCGGCGG + Exonic
1188542642 X:31266914-31266936 AGCTTGGGCGGCGGCGGCGGCGG - Intronic
1188565643 X:31523334-31523356 CCCGGGGGTGGAGGTGGAGGTGG - Intronic
1189137120 X:38561514-38561536 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1189293867 X:39905054-39905076 GACGTGAGTGGCGGCGGTGGGGG + Intergenic
1189332317 X:40151719-40151741 CGCAGCGGTGGCGGCGGCGGCGG + Intronic
1189473629 X:41333199-41333221 ACCGCGGGGGGCGGGGGCGGAGG + Intergenic
1189491258 X:41473311-41473333 CCCGTGTGAGGCCGCGGAGGTGG + Intronic
1190220399 X:48509037-48509059 CCCGGAGGAGGCAGCGGCGGCGG + Intronic
1190337105 X:49269414-49269436 CCCGCGGGTTGCGTAGGCGGTGG - Intergenic
1190440472 X:50470566-50470588 GCCGGTGGTGGTGGCGGCGGCGG + Exonic
1190474404 X:50813134-50813156 CCTGGCGGCGGCGGCGGCGGCGG + Intronic
1190726399 X:53193267-53193289 CCCTGGAGAGGCGGCGGCGGCGG - Exonic
1190984427 X:55488527-55488549 GGCGGGGGTGGCGGCGGGGGCGG + Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192211132 X:69128755-69128777 GGCGGTGGTGGCGGCGGCGGCGG + Intergenic
1192361753 X:70445112-70445134 CCCGGCGGCGGCGGCGGCGGTGG + Exonic
1192363279 X:70452459-70452481 CCCGCTGGCGGCAGCGGCGGCGG + Intronic
1192468440 X:71375223-71375245 CCCGGGGGTGGAGGTGGAGGAGG - Exonic
1192924998 X:75747076-75747098 GGCGGCGGTGGCGGCGGCGGCGG - Intergenic
1192925023 X:75747169-75747191 GCCGGAGGTGGCGGCGGCGGCGG - Intergenic
1193654990 X:84187988-84188010 CGCGGCGGCGGCGGCGGCGGCGG - Intergenic
1193654993 X:84187997-84188019 GCTGGGGGTCGCGGCGGCGGCGG - Intergenic
1193743279 X:85244118-85244140 CACGGAGGCGGCGGCGGCGGCGG + Exonic
1194421055 X:93673372-93673394 TGCTTGAGTGGCGGCGGCGGAGG + Exonic
1194977592 X:100409719-100409741 CGCGGCGGCGGCGGCGGCGGCGG - Exonic
1195107820 X:101617452-101617474 ACCATGGGTGGGGGTGGCGGAGG - Intronic
1195108657 X:101623921-101623943 GACGGGGGTGGCGGCGGGGGTGG + Intronic
1195954797 X:110317833-110317855 CCCCAGGGCTGCGGCGGCGGCGG - Exonic
1197769711 X:130082334-130082356 CTGGTGGGTGGCGGCGGTAGTGG - Intronic
1197962867 X:132024091-132024113 ACCAGGGGTGGCGGCGGCGGCGG + Intergenic
1198424067 X:136497338-136497360 CCGGTCGGCGGCGGCGGCGGTGG + Exonic
1198683332 X:139204256-139204278 CTCGTAGGCAGCGGCGGCGGCGG - Intronic
1199445106 X:147912049-147912071 CGCGGCGGCGGCGGCGGCGGCGG + Exonic
1199612731 X:149631762-149631784 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1199736865 X:150693539-150693561 GCCGGCGGCGGCGGCGGCGGCGG + Exonic
1199772772 X:150984524-150984546 GCCGGGGGCGGCGGCGGTGGCGG - Intronic
1200000275 X:153056556-153056578 CGCGGCGGCGGCGGCGGCGGCGG - Intronic
1200094363 X:153650330-153650352 CCCGTGGGTGGGGGTGGGGCAGG - Exonic
1200100663 X:153688036-153688058 GGCGGCGGTGGCGGCGGCGGCGG - Intronic
1200100668 X:153688051-153688073 GGCGGTGGTGGCGGCGGCGGCGG - Intronic
1200100743 X:153688275-153688297 CCGGGCGGCGGCGGCGGCGGCGG - Exonic
1200155579 X:153972933-153972955 CCCGGGCGCGGCGGCGGCGGCGG + Intronic
1200155582 X:153972939-153972961 CGCGGCGGCGGCGGCGGCGGCGG + Intronic
1200227808 X:154428782-154428804 GTCGTTGGCGGCGGCGGCGGCGG + Exonic
1200233652 X:154458283-154458305 TGTGTGGGCGGCGGCGGCGGCGG + Exonic