ID: 952892679 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:38053661-38053683 |
Sequence | CGGGGTGGCCGCTGGGCAGA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 4319 | |||
Summary | {0: 1, 1: 53, 2: 535, 3: 1705, 4: 2025} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
952892679_952892690 | 12 | Left | 952892679 | 3:38053661-38053683 | CCCTCTGCCCAGCGGCCACCCCG | 0: 1 1: 53 2: 535 3: 1705 4: 2025 |
||
Right | 952892690 | 3:38053696-38053718 | ACCCAACAGCTCATTGAGAACGG | 0: 1045 1: 721 2: 149 3: 73 4: 160 |
||||
952892679_952892694 | 28 | Left | 952892679 | 3:38053661-38053683 | CCCTCTGCCCAGCGGCCACCCCG | 0: 1 1: 53 2: 535 3: 1705 4: 2025 |
||
Right | 952892694 | 3:38053712-38053734 | AGAACGGGCCATGATGACGATGG | 0: 414 1: 1018 2: 754 3: 186 4: 228 |
||||
952892679_952892692 | 13 | Left | 952892679 | 3:38053661-38053683 | CCCTCTGCCCAGCGGCCACCCCG | 0: 1 1: 53 2: 535 3: 1705 4: 2025 |
||
Right | 952892692 | 3:38053697-38053719 | CCCAACAGCTCATTGAGAACGGG | 0: 1398 1: 571 2: 139 3: 41 4: 130 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
952892679 | Original CRISPR | CGGGGTGGCCGCTGGGCAGA GGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |