ID: 952892679

View in Genome Browser
Species Human (GRCh38)
Location 3:38053661-38053683
Sequence CGGGGTGGCCGCTGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4319
Summary {0: 1, 1: 53, 2: 535, 3: 1705, 4: 2025}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952892679_952892690 12 Left 952892679 3:38053661-38053683 CCCTCTGCCCAGCGGCCACCCCG 0: 1
1: 53
2: 535
3: 1705
4: 2025
Right 952892690 3:38053696-38053718 ACCCAACAGCTCATTGAGAACGG 0: 1045
1: 721
2: 149
3: 73
4: 160
952892679_952892694 28 Left 952892679 3:38053661-38053683 CCCTCTGCCCAGCGGCCACCCCG 0: 1
1: 53
2: 535
3: 1705
4: 2025
Right 952892694 3:38053712-38053734 AGAACGGGCCATGATGACGATGG 0: 414
1: 1018
2: 754
3: 186
4: 228
952892679_952892692 13 Left 952892679 3:38053661-38053683 CCCTCTGCCCAGCGGCCACCCCG 0: 1
1: 53
2: 535
3: 1705
4: 2025
Right 952892692 3:38053697-38053719 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952892679 Original CRISPR CGGGGTGGCCGCTGGGCAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr