ID: 952893266

View in Genome Browser
Species Human (GRCh38)
Location 3:38058779-38058801
Sequence CTAGTGGGGGACGTTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 4, 2: 94, 3: 231, 4: 394}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952893266 Original CRISPR CTAGTGGGGGACGTTGATAA TGG Intronic
900079677 1:846499-846521 CTGGTGGGGGATGTTGATAATGG + Intergenic
901374712 1:8829592-8829614 TGAGAGGGGGAGGTTGATAAAGG - Intergenic
901406692 1:9052609-9052631 CTGGTGAGAGATGTTGATAAAGG + Intronic
902424926 1:16312720-16312742 CTGGTGGGGGATGTTGATAATGG + Intronic
902908247 1:19575322-19575344 CTGGTGGCGGATATTGATAATGG - Intergenic
903643722 1:24877824-24877846 CTGGTGGGGGATGTTAATGATGG - Intergenic
903727729 1:25463941-25463963 CTGGTGGGGGATGCTGACAATGG - Intronic
905288478 1:36904022-36904044 CTGGTGGCAGATGTTGATAATGG + Intronic
905351626 1:37350680-37350702 CTAGTGGGGGGCATTGATAATGG - Intergenic
905352002 1:37353840-37353862 CTAGTTGGGGATGTTTATAGGGG + Intergenic
907817005 1:57928388-57928410 CTGGTGGGAGATATTGATAATGG - Intronic
908238109 1:62166805-62166827 CTGGTGGAGGATGTTGATAATGG - Intergenic
908279229 1:62513026-62513048 CTGATGGGGGATGTTAATAATGG + Intronic
908562596 1:65321617-65321639 CTGGTGGGGGATGTTGATAATGG - Intronic
908674775 1:66591541-66591563 CTAATGGGGGATGTTGATAATGG - Intronic
908846921 1:68334131-68334153 CTGGTGGGGGATGTTGATGATGG - Intergenic
908917291 1:69143477-69143499 CTGGTGGGGGATGTTGATAATGG + Intergenic
909069397 1:70976395-70976417 CTGGTAGGGGACATTGATAATGG + Intronic
909186319 1:72491075-72491097 CTGATGAGGGATGTTGATAATGG + Intergenic
909256976 1:73436995-73437017 CTGGTAGGGGATGCTGATAATGG + Intergenic
909471086 1:76028892-76028914 CTCGTGGAGGATGTTGGTAATGG + Intergenic
909510365 1:76446271-76446293 CTAGTAATGGATGTTGATAATGG - Intronic
909664123 1:78114852-78114874 CTGGTGTTGGAGGTTGATAATGG + Intronic
909976562 1:82052529-82052551 CTTGTGGGGGACGTAAATACAGG - Intergenic
910136125 1:83972049-83972071 CTGGTGGTGGATGTTGATAATGG - Intronic
910224282 1:84920345-84920367 CTGGTGTGGGATGTTGATAATGG + Intergenic
910489859 1:87756872-87756894 TTAGTGGGGGATGTTGATAATGG + Intergenic
910804031 1:91172938-91172960 CTGGTGAGGAATGTTGATAATGG + Intergenic
910903342 1:92146394-92146416 CCAGTGTGGGACGTTGATAATGG - Intronic
910978412 1:92932987-92933009 CTGGTGAGGGATGTTGATAGTGG + Intronic
911351158 1:96756983-96757005 CTGGTGGGAGATGTTGATAAAGG + Intronic
911664344 1:100537146-100537168 CTGGTGGGGGATTTTGATAATGG - Intergenic
911712734 1:101094268-101094290 CTGATGAGGGATGTTGATAATGG - Intergenic
911809605 1:102258593-102258615 CTGGTGGAGGATGTTGATAATGG + Intergenic
911813742 1:102315822-102315844 CTTGTGAGGGAGGTTGATAATGG + Intergenic
911999609 1:104814808-104814830 CTGGTGGGGGATGTTGTTAATGG + Intergenic
912010913 1:104961195-104961217 CTGGTGGAGGATGTTGATAATGG + Intergenic
912367581 1:109147665-109147687 CTGGTGGGGGATGTTGGTGATGG + Intronic
912970840 1:114281587-114281609 CTGGTGGGGGATGTTGATAATGG + Intergenic
913204548 1:116525002-116525024 CTGGTGAGGGATATTGATAATGG - Intronic
913235473 1:116777463-116777485 TTGGTTGGGGATGTTGATAATGG + Intergenic
914395196 1:147260094-147260116 CTGGTGGGGTATGTTGATAATGG - Intronic
914730073 1:150362398-150362420 CTGGTGCGTGACATTGATAATGG + Intergenic
915257109 1:154642026-154642048 CTGGTGGGGGATGTTAATAGGGG - Intergenic
915982787 1:160431932-160431954 CTGGTGGGGGATGTAGATAATGG + Intergenic
917063148 1:171062901-171062923 CTGGTGGGGGATGTCGATAATGG - Intronic
917322018 1:173792470-173792492 CTGGTGGGGAATGTTGATAATGG + Intergenic
917554335 1:176068030-176068052 CTGGTGGGGAATGTTGGTAATGG + Intronic
918321777 1:183371518-183371540 CTGGTGGGGGATGTTGATAATGG + Intronic
918534825 1:185562255-185562277 CTGGTGGGGGATATTGACAATGG + Intergenic
918557616 1:185822261-185822283 CTGGTGGGGGATGTTGATAATGG + Intronic
918833935 1:189435279-189435301 CCAGTGAGGGATGTTGATAATGG + Intergenic
918950994 1:191137299-191137321 CTGGTGGGGGGTGTTGATAATGG + Intergenic
918979735 1:191540653-191540675 CTGGTGGGGGATGTTGATAATGG - Intergenic
919633471 1:199981620-199981642 CTGGTGGGGGATATTGATAATGG - Intergenic
919740498 1:200978473-200978495 CTGGTGGGGGGTGTTGATAATGG - Intronic
920743777 1:208606361-208606383 CTGGTGGGGAATGTTGATAATGG - Intergenic
920822025 1:209390187-209390209 TCTGTGGGGGATGTTGATAATGG + Intergenic
920985169 1:210882084-210882106 CAGGTGGGGGATATTGATAATGG + Intronic
921172841 1:212564578-212564600 CTGGTGGGGGCTATTGATAAAGG + Intergenic
921289505 1:213644306-213644328 CTGGTGGGGGATGTTGATAATGG - Intergenic
921582497 1:216911648-216911670 CTGGTAGGGGAAGCTGATAATGG + Intronic
921790855 1:219288709-219288731 CTGGTGGGAGATGTTGACAATGG + Intergenic
922272632 1:224048235-224048257 CTGGTGGGGAATGTTGACAATGG + Intergenic
923940758 1:238823127-238823149 CTAGTGGGGGATGTTGGTAGTGG + Intergenic
924240851 1:242038878-242038900 CTGGTGGGGCACTTTGATAGTGG - Intergenic
924836741 1:247656458-247656480 GTGGTGTGGGATGTTGATAAGGG - Intergenic
1063035861 10:2286132-2286154 CAAGTTGGGGACATTGATAGTGG - Intergenic
1063498629 10:6533112-6533134 CTGGTGGGGGATGTTGATAATGG - Intronic
1063547639 10:6997944-6997966 CTGGTGGGGGATGTTAATACTGG - Intergenic
1063650991 10:7936618-7936640 CTGGTGGGGGATGTTGATAGTGG - Intronic
1064789929 10:18946007-18946029 CTAGTGGGGGATGTTGATATTGG - Intergenic
1065148112 10:22793410-22793432 CTGGTGAGAGATGTTGATAATGG - Intergenic
1066552797 10:36577995-36578017 TTGGTGGGGAACGTTGATAATGG - Intergenic
1066626761 10:37415091-37415113 CTGGTGGGGGATGTTGATAATGG + Intergenic
1067218351 10:44322528-44322550 GTGGTGGGGGATGTTGATAATGG - Intergenic
1067397453 10:45935433-45935455 CCGGTGGGGGATGTTGATAATGG + Intergenic
1067490453 10:46695050-46695072 GTAGTGGGAGACGTTACTAAAGG - Intergenic
1067506003 10:46849375-46849397 GTAGTGGGAGACGTTACTAAAGG - Intergenic
1067529160 10:47057993-47058015 CTGGCGGGAGATGTTGATAATGG + Intergenic
1067604210 10:47645315-47645337 GTAGTGGGAGACGTTACTAAAGG + Intergenic
1067761469 10:49050988-49051010 CTAGTGCAGGATGTTGATCATGG - Intronic
1067865771 10:49904519-49904541 CTGGTGGGGGATGTTGATAATGG + Intronic
1068590917 10:58852222-58852244 CTGGTGAGGGATATTGATAATGG + Intergenic
1069098883 10:64293364-64293386 CTGGTGGGGACTGTTGATAATGG - Intergenic
1069240112 10:66128833-66128855 CTGGTGGAGGATGTTGATAACGG + Intronic
1069691014 10:70352629-70352651 CTGGTGGGGGATGTTGATCATGG + Intronic
1070159565 10:73858001-73858023 CTAGTGGGAGATGTTGATGGTGG - Intronic
1070204297 10:74241312-74241334 CTGGTGGGGGATGCTGAAAATGG - Intronic
1070262910 10:74874963-74874985 CTGGTGGGGGAGGTTGATAATGG - Intronic
1070412867 10:76160079-76160101 CTGGTGGGGGATGTTGATAAGGG + Intronic
1071093605 10:81948290-81948312 CTGGTGAGGAATGTTGATAATGG - Intronic
1071585117 10:86812740-86812762 CTAGTGGGGGATGTTGAGAGTGG - Intronic
1072528118 10:96292744-96292766 CTGGTGGGGGACGCTGGGAATGG - Intergenic
1073638514 10:105224022-105224044 CTGGTGGAGGATGTTGATAATGG - Intronic
1074146624 10:110722355-110722377 CTGCTGGGGGATGCTGATAATGG - Intronic
1074562941 10:114550492-114550514 CTGGTGGGGGATGTTGCTAATGG - Intronic
1074821256 10:117180586-117180608 CAAGTGTGGGATGTTGATAGTGG - Intergenic
1075447434 10:122523492-122523514 CTGGTGAGGGATGTTGATAATGG + Intergenic
1076082088 10:127591437-127591459 CTGGTGGAGGATGTTGATAATGG + Intergenic
1078116462 11:8456874-8456896 CTAGTGGGGGATTTTGACAGTGG + Intronic
1079958552 11:26894210-26894232 CTGGTGGGGGATGTTGATAATGG + Intergenic
1080395219 11:31883656-31883678 CTGGTGGGGCATGTTGATGATGG + Intronic
1080397755 11:31905543-31905565 CTGGTGCAGGACGTTGATAGTGG - Intronic
1080798433 11:35587520-35587542 CCAGTGGGGGATGTTGATAGTGG - Intergenic
1081459540 11:43259216-43259238 CTAGTTGGGGATGTTGATAATGG + Intergenic
1082721927 11:56688791-56688813 CTGGTGGGGGATGTTTGTAAAGG + Intergenic
1082771760 11:57213394-57213416 GTAGTGGGGGAGGTAGCTAAAGG - Intergenic
1084283447 11:68115445-68115467 CTGGTGGGGGAAGTTGAGAAAGG + Intronic
1084646011 11:70458518-70458540 CTGGTGGGGAACGTTGACATTGG - Intergenic
1084924198 11:72498841-72498863 CTGGTGGGGGATGTTGATAATGG - Intergenic
1084991263 11:72927443-72927465 CTGATGGGGGATGTTGATAGTGG + Intronic
1085001203 11:73037221-73037243 GTGGTGGGGGATGTTGTTAATGG - Intronic
1085017518 11:73185220-73185242 CTGGTGGGGGAGGTGGATACTGG + Intergenic
1085799339 11:79574196-79574218 ACAGTGGGGGACATTGATATTGG + Intergenic
1086066740 11:82753683-82753705 CTGGTGGGGGATGTTGATAATGG + Intergenic
1086478251 11:87203142-87203164 CTGGTGCGGGATGTTAATAATGG - Intronic
1086663155 11:89446930-89446952 CTGGCAGGGGATGTTGATAATGG + Intronic
1087017946 11:93572963-93572985 CCGGTGGGGGATGTTGATAATGG + Intergenic
1087073131 11:94101541-94101563 CTGGTGGGGGATGTTGACAATGG - Intronic
1087289590 11:96305406-96305428 CTGGTGGAGGATGGTGATAATGG + Intronic
1087365651 11:97215289-97215311 GTGGTGAGGGATGTTGATAATGG + Intergenic
1087472745 11:98598186-98598208 CTGGTAAGGGACATTGATAATGG - Intergenic
1087610474 11:100428199-100428221 TGATTGGGGGATGTTGATAATGG + Intergenic
1087803802 11:102533886-102533908 CTGGTGAGGGATGTTGATAATGG + Intergenic
1087955531 11:104282237-104282259 CTGGTGGAGGATGTTGATAATGG - Intergenic
1087987556 11:104703466-104703488 CTGGTGGGGGATATTGATAATGG - Intergenic
1088025342 11:105174098-105174120 CTAGTGAAGGATCTTGATAACGG + Intergenic
1088110537 11:106256052-106256074 CTGGTGAGGGATGTCGATAATGG + Intergenic
1088336221 11:108707057-108707079 CTGGTGGGGGACGTTGATAATGG - Intronic
1088397572 11:109385389-109385411 GTGGTGGGGGATGTTGATAATGG - Intergenic
1088929754 11:114339808-114339830 CTGGTGGGGGATGTTGATAATGG + Intergenic
1089438976 11:118498662-118498684 CTGGTGGGGGATGCTGATCATGG - Intronic
1089576221 11:119446289-119446311 CTGGTGGGGGATGTTGATGATGG + Intergenic
1090768407 11:129896610-129896632 CTGGTAGAGGATGTTGATAAAGG - Intergenic
1090921727 11:131212472-131212494 CTGGTGGGGGGTGTTGATAATGG - Intergenic
1091454458 12:596423-596445 CTGCTGGGGGATGTTGATAATGG + Intronic
1091462866 12:658892-658914 TTGGTGGAGGAAGTTGATAATGG + Intronic
1093176903 12:15922884-15922906 CTGGTGGGGGATGTTGATAATGG + Intronic
1093460883 12:19405741-19405763 CTGGTGAGGGATGTTCATAATGG - Intronic
1093540952 12:20284305-20284327 CTGGTGGGGGATGTTGATAATGG - Intergenic
1093591623 12:20908317-20908339 CTGATGGGAGATGTTGATAATGG - Intronic
1093605502 12:21083719-21083741 CTGATGGGAGATGTTGATAACGG - Intronic
1093698108 12:22185917-22185939 CTGGTGGGAGATGTTGATAATGG + Intronic
1093900694 12:24628114-24628136 ATGGTGGGGTATGTTGATAATGG - Intergenic
1094091060 12:26650497-26650519 CTAGTGGAGGATGTTGATATGGG + Intronic
1094215338 12:27935015-27935037 CTGGTGGGGGATGTTGATAATGG + Intergenic
1095681353 12:44980145-44980167 CTGTTGGGGGATGTTGATACTGG - Intergenic
1096902159 12:54895495-54895517 CTAGTGGGAAATATTGATAATGG + Intergenic
1097644503 12:62220646-62220668 CTGGTGGGAGATGTTGATAGTGG + Intronic
1097912391 12:64984469-64984491 CTGGTGGGGGATGTTGATAATGG + Intergenic
1098069360 12:66655416-66655438 CTGGTGTGGGATGTTGATAGTGG - Intronic
1098083953 12:66821060-66821082 TTGGTGGAGGATGTTGATAATGG + Intergenic
1098285286 12:68901008-68901030 CTGGTGGGGGATATTGATCATGG + Intronic
1098656396 12:73035695-73035717 CTAGTGGAGGATGTTGATACTGG - Intergenic
1099127945 12:78789481-78789503 TTAGCGGGGGATGTTTATAATGG - Intergenic
1099610708 12:84865394-84865416 CTCGTGGGGGTTGCTGATAATGG - Intronic
1100141749 12:91627311-91627333 CTGGTGAGGGATGTTGACAATGG - Intergenic
1100205427 12:92343624-92343646 CTGGTGGGAGATGTTGATGATGG - Intergenic
1100258780 12:92911689-92911711 CTAGTGGGGAATGTTGATAATGG + Intronic
1100911760 12:99372184-99372206 CTAGTGGGGGATGTTCATGATGG + Intronic
1101278999 12:103231243-103231265 CTGGTGGGGGATACTGATAATGG - Intergenic
1101649439 12:106661480-106661502 CTGGTGAGGGATGTTGTTAATGG - Intronic
1102203029 12:111070548-111070570 CTGGTGGGAGATGCTGATAATGG - Intronic
1103178312 12:118884573-118884595 CTAGTGGTGAAAGTTGAAAAAGG + Intergenic
1103275628 12:119709354-119709376 CTGGTGGGGGATGTTGGTAGTGG + Intronic
1103364806 12:120374080-120374102 CTGGTGGGGGATGTTGACAGTGG - Intergenic
1103371101 12:120420176-120420198 CATGTAGGGTACGTTGATAATGG + Intergenic
1104148951 12:126063445-126063467 CTGGTGAGGGATGTTGATATTGG - Intergenic
1105654262 13:22418478-22418500 CTGATGGAGGAGGTTGATAATGG + Intergenic
1107160276 13:37217648-37217670 CTGGTGGGGGATGATGATGATGG - Intergenic
1108097214 13:46915708-46915730 CTGGTGGGGGATGTTGCTAATGG - Intergenic
1108103378 13:46982464-46982486 CGGGTGGGGGGTGTTGATAATGG - Intergenic
1108177375 13:47806898-47806920 CTTGTGGGGGGTGTTGATAATGG + Intergenic
1108457169 13:50628047-50628069 CTCGTGGGGGATGTTGATGGTGG + Intronic
1108840724 13:54611292-54611314 CTGGGGGTGGAAGTTGATAATGG + Intergenic
1109501520 13:63241950-63241972 CTGGTGGGGGATGTTGATAATGG + Intergenic
1109563556 13:64080659-64080681 CTGGTGGAGGATGTTGATAATGG - Intergenic
1109568257 13:64149046-64149068 CTGGTGGGGGATGTTGATAATGG - Intergenic
1110179906 13:72604269-72604291 CTGGTAGTGGATGTTGATAATGG + Intergenic
1110183522 13:72645592-72645614 CAGGTGGGGGACGTAGAGAAAGG - Intergenic
1110305239 13:73979224-73979246 CTGGTGGGGTATGTTGATAATGG + Intronic
1110458598 13:75718577-75718599 CTGGTGGGGGACGTTGATAATGG - Intronic
1110542933 13:76726419-76726441 CTGGTGGGGAATGTTGATAATGG - Intergenic
1110782286 13:79480715-79480737 CTGAGGGGGGATGTTGATAATGG + Intergenic
1110903319 13:80852849-80852871 GTAGTGGGGGATGTTGATAAAGG - Intergenic
1111599961 13:90460388-90460410 CTGGTGGGGGATGCTGATAATGG - Intergenic
1111751623 13:92338939-92338961 TTAGTGTGTGATGTTGATAATGG + Intronic
1112240987 13:97680725-97680747 GTGGTGGGAGATGTTGATAATGG - Intergenic
1112679414 13:101745290-101745312 CTAGTGCAGGACGCTGATAATGG - Intronic
1113237592 13:108297751-108297773 CTGGTGGGGGATTTTGATAATGG - Intronic
1113237629 13:108298171-108298193 CTGGTGGGGGATTTTGATAATGG + Intronic
1113971286 13:114192283-114192305 CTGGAGGGGCATGTTGATAATGG + Intergenic
1114358602 14:21943500-21943522 CTGGTGGTGGATGTTGATAATGG - Intergenic
1114763763 14:25347633-25347655 ATGGTGGGGGATGTTGATAGTGG + Intergenic
1115169558 14:30489033-30489055 TTGGTGATGGACGTTGATAATGG + Intergenic
1115733021 14:36292461-36292483 CTGATGAGGGATGTTGATAACGG - Intergenic
1115776637 14:36722487-36722509 CTGATGGGGGATGTTGATCATGG + Intronic
1116218041 14:42045511-42045533 CTGGTGGGGGATGTTGATAATGG - Intergenic
1116276219 14:42836135-42836157 CTGATGGGGAATGTTGATAATGG + Intergenic
1116469633 14:45272020-45272042 CCAGTGGGGGATGCTGATAATGG - Intergenic
1116723340 14:48528904-48528926 TTTGTGGGGGATGTTGAAAATGG - Intergenic
1117389767 14:55251582-55251604 GTAGTGTGGGATGTTGATAGTGG + Intergenic
1117625421 14:57632582-57632604 GTGGTGGGGAATGTTGATAATGG - Intronic
1118066162 14:62193065-62193087 CTGCTGGGGGATGTTGGTAATGG - Intergenic
1118608400 14:67520122-67520144 CTGGTGGGGGATTCTGATAATGG - Intronic
1119028945 14:71176421-71176443 CTGGTGGGGGATGTGGATAATGG - Intergenic
1119197739 14:72729977-72729999 CTAGTGGAGGATGTTGATCATGG + Intronic
1119303437 14:73589023-73589045 CTGGTGGGGGATGTTGATAGTGG - Intergenic
1119537591 14:75415387-75415409 GTGGTGGGGGATGTTGGTAATGG + Intergenic
1119737071 14:76989553-76989575 CTGGTCAGGGATGTTGATAATGG - Intergenic
1120554637 14:85914609-85914631 CTGATGGGGGATGTTGATAACGG - Intergenic
1120658503 14:87224823-87224845 CTGGTGGGGGAAGTTAGTAATGG + Intergenic
1120837515 14:89054757-89054779 CTGGCGGGGGATGTTGATAATGG + Intergenic
1121555996 14:94837780-94837802 CTGGAGGTGGATGTTGATAATGG - Intergenic
1123972777 15:25524464-25524486 CTGGTAGGGGATGTTGATGATGG + Intergenic
1124174319 15:27408000-27408022 CTGGTGTGGGATGTTGGTAATGG + Intronic
1124723961 15:32138469-32138491 CTGGTGGGGGATGTTGATGATGG - Intronic
1125060342 15:35413039-35413061 CTAGCAGGGGAGGTTGATAATGG + Intronic
1125278213 15:38016116-38016138 ATGGTGGGGGGTGTTGATAATGG + Intergenic
1125278517 15:38019567-38019589 CTAGTGGGGGATGCTGACAGTGG - Intergenic
1125278816 15:38022712-38022734 TTGGTGGGAGATGTTGATAATGG + Intergenic
1126408338 15:48345933-48345955 CTGGTGGGGGATGCTGATAATGG - Intergenic
1127163117 15:56212558-56212580 CTAATGTAGGATGTTGATAATGG + Intronic
1127492891 15:59482052-59482074 CTGGTGTGGGATGTTGATAGTGG - Intronic
1128779815 15:70351969-70351991 CTAGTGGGGGAGGCAAATAATGG - Intergenic
1129094205 15:73185335-73185357 TTAGTGGGGGATGTTGATAATGG + Intronic
1129647097 15:77446284-77446306 CTAGTAGGGGACGTGGAAAAAGG - Intronic
1130449836 15:84040262-84040284 CTGGTGGGGGATGCTGATAATGG - Intergenic
1131235645 15:90694493-90694515 CTGGTGGGGGATGTTGTTAATGG - Intergenic
1131313358 15:91310703-91310725 CTGTTGGGGGATGTTGATAATGG - Intergenic
1131611219 15:93966232-93966254 CTAGTGGAGATCGTTGATCATGG - Intergenic
1132401760 15:101513484-101513506 ATGGTGGGGGCTGTTGATAATGG - Intronic
1133734500 16:8603875-8603897 ATGGTGGGGGATGCTGATAATGG - Intergenic
1135433625 16:22409036-22409058 CTGGTGGGGGATGTTGACAATGG - Intronic
1135778215 16:25275788-25275810 CTGGTGGGGGATGTCGATCATGG + Intergenic
1135847890 16:25935254-25935276 CTGGTGGGGGATGTTGATCATGG - Intronic
1136108083 16:28045271-28045293 CTGGTGGGAGATGTTGATAATGG + Intronic
1137238643 16:46636266-46636288 CTGGTGGGGGCTGTTGATAATGG + Intergenic
1137473162 16:48780990-48781012 TTGGTGGGGGATGTTGATAATGG - Intergenic
1138223356 16:55271878-55271900 CTAGTGGGGGATGTGGATAATGG + Intergenic
1138356120 16:56381876-56381898 CTGCTGAGGGATGTTGATAATGG + Intronic
1138423620 16:56916069-56916091 ATGCTGGGGGACTTTGATAAAGG - Intergenic
1138904951 16:61320126-61320148 TTGGTGGGGAATGTTGATAATGG + Intergenic
1139041888 16:63007219-63007241 CTGGTGGAGGCTGTTGATAATGG - Intergenic
1139054796 16:63169872-63169894 TTGGTGGGAGATGTTGATAATGG - Intergenic
1139837478 16:69850899-69850921 CTGGTGGGGGATGTTGATAGTGG - Intronic
1140709272 16:77661361-77661383 CTAGTGTGGGACATTGATAATGG - Intergenic
1140998772 16:80288199-80288221 TTGGTGGGGGACGTTGATACTGG + Intergenic
1142821627 17:2473049-2473071 CTGTTGGGGGATGCTGATAATGG + Intronic
1143626866 17:8115297-8115319 TTAGTGGGGGAGGCTGAGAAAGG + Intronic
1144048166 17:11471878-11471900 ACAGTGGGGGATGTTGGTAATGG - Intronic
1144102804 17:11958623-11958645 CTGGTGGGGAATGTTGATAGTGG + Intronic
1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG + Intronic
1145108256 17:20138325-20138347 CTGGTGGGGGATGTTGATAATGG - Intronic
1146069182 17:29663902-29663924 CTGGTGGAGGATGTTGACAATGG + Intronic
1146597327 17:34181564-34181586 CTGGTGGGGGATGTTGATAATGG + Intergenic
1146759673 17:35466087-35466109 CTAATGGGAGATGTTGCTAATGG - Intronic
1146887512 17:36482629-36482651 TTAGAGGCGGAGGTTGATAAGGG - Intergenic
1147506509 17:41022989-41023011 CTAGTGGGGGATGCTGATAATGG - Intergenic
1148023169 17:44567009-44567031 CTGGTGAGGGATGTTGATAATGG - Intergenic
1149457325 17:56798420-56798442 CTGGTGGGGGATGTTGGTAGTGG - Intronic
1149938502 17:60836119-60836141 CTAGTGGGGACTGTTGATAATGG - Intronic
1149999372 17:61423919-61423941 CTGGTTGGGGATGTTGAAAATGG + Intergenic
1150433315 17:65136235-65136257 CCAGTGGAGGATGTTGATCATGG + Intergenic
1150865852 17:68849359-68849381 CTGGTGGGGGATGTGGATGATGG + Intergenic
1151087425 17:71396952-71396974 CTGGTGGAGGATTTTGATAATGG + Intergenic
1151516035 17:74596519-74596541 CTGGTGGGGGATGTTGATAATGG - Intergenic
1151574864 17:74947796-74947818 CTAGAGGAAGATGTTGATAATGG + Intronic
1153169472 18:2299299-2299321 CTGGTGAGGGATGTTGATAATGG + Intergenic
1153404995 18:4727846-4727868 CTGGTGTGGGATGTTGCTAATGG + Intergenic
1154398663 18:14013695-14013717 CTGGTAGGGGATGTTGATAGTGG - Intergenic
1154404890 18:14081213-14081235 CTTGTGGGGGTTGTTGTTAATGG + Intronic
1154951115 18:21210769-21210791 CTGGTGGGGGATGTTAAAAATGG - Intergenic
1155417044 18:25610106-25610128 GTGGTGGGGGATATTGATAATGG + Intergenic
1156248553 18:35328214-35328236 CTGGTGGGGGATGTTGACAATGG - Intergenic
1156717567 18:40029420-40029442 CCAGTAGGGGACCTTCATAAAGG + Intergenic
1157091743 18:44644704-44644726 CTAGTGGGAGATGTTCATGAGGG - Intergenic
1158730960 18:60022042-60022064 CTGGTGGGGGATGTTGGTAATGG - Intergenic
1158815483 18:61090047-61090069 TTGGTTGGGGATGTTGATAATGG - Intergenic
1159675599 18:71281476-71281498 CTAGTTGAGGCCGTTGATACAGG + Intergenic
1159818290 18:73105599-73105621 GTGGTAGGGGATGTTGATAATGG - Intergenic
1163728172 19:18934217-18934239 ATATTGGGGGACCTTGATATTGG - Intronic
1164817198 19:31213619-31213641 CTGGTGGGGGATGTTGGTAACGG + Intergenic
1164817668 19:31217587-31217609 CTGGTGGGGGCTGTCGATAATGG - Intergenic
1165618748 19:37226291-37226313 CTGGTGGAGGATGTTGATGATGG - Intronic
1165877171 19:39016332-39016354 CTGGTGGGGGATGTTGATAGCGG + Intronic
924971835 2:135577-135599 CTAGTGGGTGATGTTGATAATGG + Intergenic
925244543 2:2369360-2369382 TTGGTGGGACACGTTGATAATGG - Intergenic
926266185 2:11323777-11323799 CTGGTGAGGGATGTTGATAGTGG - Intronic
926657278 2:15421923-15421945 CTGGTGGGGAATGTTGATAGTGG - Intronic
926780870 2:16470764-16470786 CTGGTGGGGGATGTTGATAATGG + Intergenic
927044265 2:19261644-19261666 CTGGTGGGGGATGTTGATGATGG + Intergenic
927580080 2:24235532-24235554 CTGGTGGGGGTTGTTGTTAATGG + Intronic
928020770 2:27703042-27703064 CTGGTGGGGAATGTTGATAATGG - Intergenic
928478881 2:31660581-31660603 TTGGTGGGGGATGTTGATAACGG + Intergenic
929095327 2:38258184-38258206 CTTGTGGGGGATGTTGATAGTGG - Intergenic
929344846 2:40869432-40869454 CTTGTGCGGGATGTTGATAATGG - Intergenic
930341049 2:50115065-50115087 CTAGTGAGGGATGTTGATGGTGG + Intronic
931024272 2:58091266-58091288 CTAGTGAGGGATGTTGATAGCGG + Intronic
931063367 2:58556199-58556221 TCAGTGGGGAATGTTGATAATGG - Intergenic
931522290 2:63112056-63112078 CTGGTGGGGGATGTTGATGGGGG - Intergenic
931694427 2:64860910-64860932 CTGGTGGGGAATGTTGATAGTGG + Intergenic
933057981 2:77697757-77697779 CTAGTGGGAGATATTGATAATGG + Intergenic
933382002 2:81559991-81560013 TTGGTGGGGAAAGTTGATAATGG + Intergenic
934100632 2:88649938-88649960 CTGGTGTGGGATGTTGATAGTGG - Intergenic
935051317 2:99527363-99527385 CTGGGGAGGGACTTTGATAATGG + Intergenic
935209249 2:100924185-100924207 CTGGTGGGGGATGCTGATAATGG - Intronic
935633314 2:105230383-105230405 CTGGTGGGAGATGTTGATAATGG + Intergenic
935853642 2:107250032-107250054 CTGGTGGTGGATGATGATAATGG - Intergenic
936919410 2:117672206-117672228 CTGGTGGGGGATGTTGATAATGG + Intergenic
937408906 2:121655618-121655640 CCGGTGAGGGATGTTGATAATGG + Intergenic
937598071 2:123694238-123694260 CTAGTGGGGGATGTTTATAGTGG + Intergenic
938705518 2:133921246-133921268 GTGGTGGGGGATGTTGATAATGG - Intergenic
939154631 2:138509703-138509725 CTGGTGGGGAATGGTGATAATGG - Intronic
941508629 2:166377493-166377515 CTGGTGGGGAATGTTGATAATGG - Intergenic
941603608 2:167567671-167567693 CTGGTGGGGGATGTTGATAACGG - Intergenic
941668391 2:168264070-168264092 CAGGTGGGAGATGTTGATAATGG - Intergenic
941717425 2:168778828-168778850 CTAGTGGGTGATGTTGATAATGG + Intergenic
941733396 2:168945173-168945195 CTGGTGGGAGATGTTGATAATGG + Intronic
941837004 2:170034116-170034138 CTGGTGGTGGATATTGATAATGG - Intronic
942530888 2:176909123-176909145 CTGATGGGGGATGTTGATAATGG + Intergenic
942573782 2:177341009-177341031 CTGGTGGGAGATATTGATAATGG + Intronic
942806477 2:179936860-179936882 CTGGTGGGGGTTGTTGATAATGG + Intergenic
942919024 2:181348294-181348316 CTGGTGGGGGATGTTGATAATGG + Intergenic
942991268 2:182206339-182206361 CTTGTTGGGGATGTTGACAATGG - Intronic
943301521 2:186208382-186208404 CTGGTGGGGGATGTTTATATGGG - Intergenic
943509656 2:188808762-188808784 CTGGTGGAGGACGTTGATAATGG + Intergenic
943816121 2:192258045-192258067 CTGGTAGGGGATGTTAATAATGG - Intergenic
943822318 2:192341162-192341184 CTGGTGGAAGATGTTGATAATGG - Intergenic
943861763 2:192874392-192874414 CTAGTGGGGAATGTTGATAGAGG + Intergenic
944194498 2:197038208-197038230 CTGGTGGAGGATGATGATAATGG + Intronic
945061975 2:205917105-205917127 CTCATGGGGGATGTGGATAAGGG + Intergenic
945238445 2:207654318-207654340 CTGGTGCAGGATGTTGATAATGG + Intergenic
945536872 2:211028068-211028090 TTGGTGGGGGATGTTGTTAATGG - Intergenic
945710323 2:213286886-213286908 CTTGTGGGGGACATTAATGAAGG + Intronic
946329099 2:218999939-218999961 GTAGTGGGGGAAGTGGAAAAGGG - Intergenic
946574807 2:221063445-221063467 CTAGTGGGGAATGTTGATAGTGG - Intergenic
946671744 2:222112131-222112153 CTGGTGGAGGATGTTGATAATGG + Intergenic
946837397 2:223786013-223786035 CTGGTAGGGGACGTTGATAATGG + Intronic
947232815 2:227905010-227905032 GTAGTGTGGGACGCTGATACTGG + Exonic
947921219 2:233876065-233876087 CTTCTTGGGGATGTTGATAATGG - Intergenic
1169292753 20:4366645-4366667 CTGGTAGGGGATGTGGATAATGG - Intergenic
1169435653 20:5587000-5587022 TTAGTAGGGGAGCTTGATAATGG - Intronic
1169833959 20:9856817-9856839 CTGGTGAGGGATGTTGATAATGG + Intergenic
1170417038 20:16155669-16155691 CTAGTGGAGGATGTTCATAATGG + Intergenic
1170487529 20:16834398-16834420 CTAGTGGGGGATGTTGACAATGG + Intergenic
1170651480 20:18246499-18246521 CTGGTGGGGGATGTTAATAATGG - Intergenic
1170880298 20:20291100-20291122 CTGGTGGGGGATGTTGATAGTGG - Intronic
1171140914 20:22741776-22741798 TTGGTGGGGGATGTTGATAGTGG + Intergenic
1171151789 20:22834146-22834168 CTGGCGGGGGACGTAGATAATGG + Intergenic
1171384519 20:24761150-24761172 CTAGTGTGGGATGTTGATAATGG + Intergenic
1173234359 20:41230804-41230826 CTGGTGGGGAATGTTGATAATGG - Intronic
1175247883 20:57592420-57592442 CCAGTGGGGGACTTTGAACAAGG - Intergenic
1175477595 20:59288006-59288028 CTAGGGGGGGCCGTTTACAATGG - Intergenic
1175511600 20:59531523-59531545 CCAGTGGGCGATGTTGATAATGG + Intergenic
1177001120 21:15614487-15614509 CTCATGGGGGATGTTGATAATGG + Intergenic
1177325581 21:19584187-19584209 CTGGTGGGGGATGTTGATAATGG - Intergenic
1177389426 21:20447935-20447957 CTCGTGGAGGATGTTGATAACGG - Intergenic
1177468869 21:21528401-21528423 CTGGTGGGAGATGTTGCTAATGG + Intronic
1177484460 21:21738932-21738954 CTAGTGGGGGATATTGATCATGG + Intergenic
1177680190 21:24357696-24357718 CTAGTAAGGGATGTTGATAAGGG - Intergenic
1178381154 21:32110034-32110056 CTGATGGGGGATGTTGATAATGG + Intergenic
1178594980 21:33945214-33945236 CTGGTGGGGGACGTCCATAGTGG + Intergenic
1179057537 21:37949947-37949969 CTGGTGGGGGATGTTGATAGTGG + Intergenic
1179192624 21:39136347-39136369 CTGGTGGAGGATGTTGATAATGG + Intergenic
1184215685 22:43065767-43065789 CTGGTAGGGGATGCTGATAAGGG + Intronic
950823276 3:15786235-15786257 CTAATGGGAAATGTTGATAATGG + Intronic
950845681 3:16013564-16013586 CTGGTGTGGGATGTTGATGATGG - Intergenic
951164625 3:19470096-19470118 CTAGTGTGGGACATTGCAAAAGG + Intronic
951344587 3:21531945-21531967 CTAGAGGGGAATATTGATAATGG + Intronic
951357616 3:21687510-21687532 CTGGTGGGGGATGTTGATAATGG - Intronic
951367217 3:21798084-21798106 CTGGTGGGGGATTTTGATAATGG + Intronic
952893266 3:38058779-38058801 CTAGTGGGGGACGTTGATAATGG + Intronic
953367829 3:42361850-42361872 CTGGTGTGGGAGGTTGATAGTGG - Intergenic
955877066 3:63502330-63502352 CTGGTGGGGGATATTGATAAAGG - Intronic
956115858 3:65917980-65918002 TTGGTGGGGGACGTTGATAATGG + Intronic
956281295 3:67559929-67559951 CTGGTGGGGGATGTTGGTATTGG + Intronic
956508137 3:69964606-69964628 CTGGTAGGGAATGTTGATAATGG - Intronic
956676393 3:71736860-71736882 CTGGTGTGGCATGTTGATAATGG + Intronic
957081052 3:75635885-75635907 ATAGTGGGGGATGTGGAGAAAGG - Intergenic
957670784 3:83299678-83299700 CTGATGGGGGAAGTTGAAAATGG + Intergenic
957725200 3:84055568-84055590 GTTGTGGGGGATGTTAATAATGG - Intergenic
958017138 3:87951592-87951614 CTTGTGGGGGATGTTGATAATGG - Intergenic
958591407 3:96162999-96163021 CTGGTGGGAGATGTTGATAATGG + Intergenic
959485126 3:106919860-106919882 TTGGTGGGGGACTTTGTTAATGG + Intergenic
959497128 3:107064645-107064667 CTAGTGGTGCACGGTGATATAGG + Intergenic
959771150 3:110098224-110098246 CTGGTGGGGGATGTTGATAATGG - Intergenic
959778016 3:110192566-110192588 CTGGTAGGGGATATTGATAATGG - Intergenic
959933515 3:112007190-112007212 TTCGTAGGGGATGTTGATAATGG - Intronic
960020557 3:112947339-112947361 CTAGTCAGGTATGTTGATAATGG + Intronic
960220673 3:115104914-115104936 CTGGTGGGGGATATTGATGATGG + Intronic
960361282 3:116714772-116714794 CTAGTGGGGCCCATTGATAAGGG - Intronic
960717361 3:120590023-120590045 CTGGTGGAGGATGTCGATAACGG + Intergenic
961026038 3:123558462-123558484 CTGGTTGGGGATGTTGATAATGG + Intronic
961370752 3:126428570-126428592 CTGGAGGGGGATGTTGATAGTGG + Intronic
962690181 3:137888084-137888106 CTGGTGGGGAATGTTGATATTGG - Intergenic
962699908 3:137987793-137987815 TCTGTGGGGGATGTTGATAATGG - Intergenic
963465267 3:145671867-145671889 CTCGTGGCGGATGTTGATAGTGG + Intergenic
963698463 3:148592914-148592936 CTGGCTGGGGACATTGATAATGG + Intergenic
964234302 3:154507066-154507088 CTGGTGCAGGATGTTGATAATGG - Intergenic
964361296 3:155899545-155899567 CTGGTGTGGGATGTTGATAATGG - Intronic
964662874 3:159140089-159140111 CAGGTGTGGGATGTTGATAATGG - Intronic
964917725 3:161856310-161856332 TTGGTGGGGTATGTTGATAATGG + Intergenic
965426365 3:168528917-168528939 CTGGTGGAGGATGTAGATAATGG - Intergenic
965641522 3:170833747-170833769 CTGGTGGGGGATGTTGATAATGG - Intronic
965826366 3:172734967-172734989 CTTTTAGGGGATGTTGATAATGG - Intergenic
966193999 3:177295947-177295969 ATGGTAGGGGATGTTGATAATGG - Intergenic
966305621 3:178530799-178530821 CTGGTGGGAGATGTGGATAACGG - Intronic
967806544 3:193719278-193719300 CTGGTGAGGGATGTTGATAACGG + Intergenic
968044418 3:195616038-195616060 CTGGTGGGGGACGCTGATGATGG - Intergenic
968060207 3:195722089-195722111 CTGGTGGGGGACGCTGATGATGG - Intronic
970448527 4:16144317-16144339 CTGGTGGGGGACGTTGATAGTGG + Intergenic
971306061 4:25482711-25482733 CTGGTGGGGAATGTTGATAATGG + Intergenic
971639699 4:29116643-29116665 CTGGTGGGGGATGTTGATAGAGG - Intergenic
971904666 4:32710989-32711011 CTGGTGGGGGATGTTGATAATGG - Intergenic
971992686 4:33920369-33920391 GTGGTGGGGGATGTTGATAATGG - Intergenic
972062792 4:34899530-34899552 CTGGTGGAAGATGTTGATAATGG + Intergenic
972182078 4:36479551-36479573 CTAGTATGGGATGTTGATAATGG - Intergenic
972445507 4:39139594-39139616 CTGGCGGGGGAGGTTGATAACGG + Intergenic
972807265 4:42542080-42542102 CTGGTGGGGGATGTTGATAATGG + Intronic
973289168 4:48453398-48453420 CTGGTGGGGGATGTTGATAATGG + Intergenic
973635252 4:52856357-52856379 CTGGTGTGGGATGTTGATAATGG - Intergenic
974189369 4:58484308-58484330 TCTGTGGGGGATGTTGATAATGG - Intergenic
974489215 4:62543337-62543359 CTGGTGGGGGATGTTGATATTGG + Intergenic
974632614 4:64513417-64513439 CCTGTGGGGGATGTTAATAATGG + Intergenic
974670934 4:65029068-65029090 CTGGTGGGGGATATTGATAATGG - Intergenic
975977111 4:80112125-80112147 CTGGTGGGGGATGTTGATAGCGG + Intronic
976060107 4:81117774-81117796 CTGGCGAGGGATGTTGATAATGG - Intronic
977586717 4:98782526-98782548 CTGGCGGGGGATGTTAATAATGG + Intergenic
977839166 4:101680804-101680826 CTGGTGGGGGATATTGACAATGG - Intronic
978033014 4:103959000-103959022 GTGGTGGGGGATGTTGATAATGG + Intergenic
978113925 4:104996389-104996411 CTAGTGAGGGATGTTAAAAATGG - Intergenic
978129549 4:105178623-105178645 CTGGTATGGGATGTTGATAATGG + Intronic
978207380 4:106093960-106093982 CTGATGGGGGAGGCTGATAATGG + Intronic
978243664 4:106547408-106547430 CTGGTGTGGGATGTTGATAATGG + Intergenic
978415644 4:108473076-108473098 CTTGTGGGGGATATTGATAATGG + Intergenic
978698419 4:111612522-111612544 CTGGTGGGAAATGTTGATAATGG - Intergenic
979162936 4:117486788-117486810 CTGGAGGGGGATGTTAATAATGG - Intergenic
979189807 4:117842289-117842311 TTAGTGAGGGATGTTGATAATGG + Intergenic
979560650 4:122097776-122097798 CTGGTGGAGGATGTTGATAATGG - Intergenic
979891629 4:126103856-126103878 CTGGTGGAGGATGTTGACAATGG + Intergenic
979939914 4:126749557-126749579 CTAGTGGAAGGTGTTGATAATGG - Intergenic
979991241 4:127378324-127378346 CTGGTGGGGGATGTTGATAATGG - Intergenic
980019419 4:127690783-127690805 GTGGTGGGGAATGTTGATAATGG - Intronic
980229386 4:130029521-130029543 CTAGTGGGAAAAGTGGATAATGG + Intergenic
980319147 4:131245400-131245422 CTTGTTGGGGATGTTAATAATGG - Intergenic
980378893 4:131984813-131984835 CTTGTTGGGGACATTGATAATGG - Intergenic
980668126 4:135966953-135966975 CTGGGGTGGGAGGTTGATAATGG - Intergenic
980776334 4:137441226-137441248 CTAATGGCAGATGTTGATAATGG + Intergenic
980793500 4:137650660-137650682 CTTGTGGGGAACGTTGATAATGG + Intergenic
981352436 4:143748085-143748107 CTGGTGCGGGATATTGATAATGG - Intergenic
981523065 4:145684656-145684678 GTGGTGGGGGATGTTGATAGTGG + Intronic
982033851 4:151326242-151326264 CTGGTGGGGGATGTTGATAATGG + Intergenic
982168353 4:152637055-152637077 CTGATGGGGGACGTTGATAATGG + Intronic
982211934 4:153044822-153044844 CTGGTGGGGTATGTTGATAATGG + Intergenic
982429246 4:155303701-155303723 CTGGTGGGGGATGCTGATAACGG + Intergenic
982491245 4:156032135-156032157 CTGGTAGAGGATGTTGATAATGG - Intergenic
983110706 4:163745953-163745975 CTGGTGGGGGGTGTTGATAATGG - Intronic
984313614 4:178097362-178097384 CTTGTGGGGGATGTTGATAATGG + Intergenic
984317425 4:178144322-178144344 CAGGTGGGGGATATTGATAATGG + Intergenic
984703114 4:182831477-182831499 CTGGTGGGGGGTATTGATAACGG + Intergenic
984907490 4:184642518-184642540 CTGGTGCAGGATGTTGATAATGG + Intronic
985308091 4:188565746-188565768 CTTGTGGGGGCTTTTGATAATGG - Intergenic
985953377 5:3240687-3240709 CTGGTAGGGGATGCTGATAATGG - Intergenic
986021820 5:3811813-3811835 CTGGTGGGGGATGCTCATAATGG + Intergenic
986373942 5:7110964-7110986 GTGGTGGGGGATGTTGATAATGG + Intergenic
986429272 5:7665544-7665566 CTTGTGGGGCACGATGATGAAGG - Intronic
987265052 5:16244823-16244845 CTGGTGGGGGATGTCGATAATGG + Intergenic
987808357 5:22800492-22800514 CTTTTTGGGGATGTTGATAATGG - Intronic
988105602 5:26742524-26742546 CTGGTGGGAGATGTTGATTATGG - Intergenic
988372937 5:30395915-30395937 CTGAGGGGGGATGTTGATAATGG - Intergenic
988720667 5:33875382-33875404 CCGGTGGGGGATGTTGAAAATGG + Intronic
988822717 5:34903414-34903436 CTGGTGGGAGATGTTGATAAGGG - Intergenic
989100733 5:37820637-37820659 CTGGTGGGGGATGTTGACAATGG + Intronic
989809007 5:45649356-45649378 ATGGTGGGGGATGTTGATAATGG - Intronic
989843924 5:46115659-46115681 CTAGTGGGGGATGTTGATAGTGG - Intergenic
990202271 5:53389826-53389848 CTGGTGGGGAATGTTGATAATGG + Intergenic
990372512 5:55135096-55135118 CTGGTGGGAGATGTTGATAACGG + Intronic
990473399 5:56139037-56139059 GTAGTGGGAGATGTTGGTAACGG + Intronic
990722808 5:58717018-58717040 CGGGTGGGGGATGTTGATAGTGG + Intronic
991008197 5:61853056-61853078 CTAATAGGGTATGTTGATAATGG + Intergenic
991149854 5:63355113-63355135 CTGGTGGGGGATATTAATAATGG - Intergenic
991178488 5:63720023-63720045 CTGGTAGGGGATGTTGATGATGG - Intergenic
991338462 5:65577824-65577846 CTGGTGGGGGACGTTGATAATGG - Intronic
992134650 5:73731972-73731994 CTGGTGGGGGATGTGGATACTGG - Intronic
992393172 5:76347858-76347880 CTGGTGAGGGGTGTTGATAATGG - Intronic
992456240 5:76918631-76918653 GTGGTGGGAGATGTTGATAATGG - Intronic
992495007 5:77283278-77283300 CTGGTGGGGGATGTTGACAGTGG - Intronic
992600709 5:78396304-78396326 CTGGTGGGAGATATTGATAATGG + Intronic
992852780 5:80827999-80828021 CTGGTGGGGGATGCTGAAAATGG - Intronic
993348437 5:86815914-86815936 CTAGTGGGGGATGGTGATATTGG + Intergenic
994785999 5:104164169-104164191 TTGGTGGGGGATGTTGATAATGG + Intergenic
994943067 5:106349925-106349947 CTGGTGGGGCATGTTGATAAAGG - Intergenic
994964856 5:106655920-106655942 CTAGTGGGGTATGTTGAGATTGG + Intergenic
995044449 5:107629558-107629580 GTGGTGAGGGATGTTGATAATGG + Intronic
995158241 5:108941977-108941999 CTGGAGGGAGATGTTGATAATGG + Intronic
995527908 5:113065247-113065269 CTGGTGGGGGACGCTGAAAACGG + Intronic
995576996 5:113547547-113547569 CTGGTGGGGGATGTTGATAATGG + Intronic
996002438 5:118380833-118380855 CTGGAGAGGGATGTTGATAATGG - Intergenic
996182319 5:120434227-120434249 CTAGTGGGGAATGGTTATAATGG + Intergenic
996507193 5:124280732-124280754 CTGGTGGGGAATGCTGATAATGG + Intergenic
996519037 5:124405782-124405804 CTGGTGGGGAAAGTTTATAAGGG - Intergenic
996546994 5:124690426-124690448 CTGGTGGGGAATGTTGATAATGG + Intronic
996580059 5:125021818-125021840 CTGGTGGAGGATATTGATAATGG + Intergenic
996757209 5:126947588-126947610 CTGGTGGGGGATGGTGATAATGG + Intronic
996963644 5:129281672-129281694 CTAGTGAGGGATTTAGATAATGG + Intergenic
996987655 5:129586111-129586133 CTAGTGGTGAATGTTGATAATGG - Intronic
997054950 5:130431104-130431126 CTGGTGGGGGATGTTGATAATGG + Intergenic
998311117 5:141133349-141133371 CTGGTGGAGGATGTTGATAATGG + Intronic
998361885 5:141595371-141595393 CTAGTGGGGGATGTTGACAATGG + Intronic
998602467 5:143599184-143599206 TTGGTGGGGGGTGTTGATAATGG - Intergenic
999270861 5:150295648-150295670 CTAGTTGGGGGAGGTGATAAGGG + Intergenic
999305529 5:150517126-150517148 GTGGTGGGGGATGTTGATAATGG - Intronic
999373572 5:151070986-151071008 CTGGTGGAGGATGTTGATAATGG + Intronic
999391938 5:151199560-151199582 CAAGTGGGGGACAATGAGAATGG - Intronic
999846142 5:155482677-155482699 CTGGTGGTGGATGTAGATAATGG + Intergenic
1000405391 5:160882311-160882333 CTGGTGGGGGATGTTGATAATGG + Intergenic
1000524106 5:162333742-162333764 CTGGTGAGGAATGTTGATAAGGG + Intergenic
1000684293 5:164228202-164228224 CTAGAGGGTGAAGATGATAAAGG - Intergenic
1002084515 5:176764221-176764243 CTGGTGGGGGACGTTGATAATGG - Intergenic
1002573507 5:180158012-180158034 CTGGTGGGTGACGTCGATAATGG + Intronic
1003526245 6:6900047-6900069 CTGGTGAGGGTTGTTGATAAGGG + Intergenic
1003854509 6:10259357-10259379 TTAGTGGGGGATGTTGATTGTGG + Intergenic
1004777517 6:18864476-18864498 CTGGTGGAGGATGTTGTTAATGG + Intergenic
1005660385 6:27992575-27992597 CTGGTGGAGTATGTTGATAATGG - Intergenic
1005680723 6:28205405-28205427 CTGGTGGGAGATATTGATAATGG + Intergenic
1006590641 6:35153297-35153319 CTCGTAGGGGATATTGATAATGG - Intergenic
1007882540 6:45183624-45183646 CTAGTGGGAGTTGTTGATCATGG - Intronic
1008134769 6:47761800-47761822 CTGGTGTGGGATGTTGATAGTGG - Intergenic
1008744257 6:54649720-54649742 CTAGTGGGGAATGTTCATAATGG - Intergenic
1009548961 6:65061478-65061500 CTGGTGGGGGATGTCGATAATGG - Intronic
1010770819 6:79827979-79828001 CTGGTGGGGAATGTTGATAACGG + Intergenic
1010960841 6:82143993-82144015 CTAGTGGTGGCCTTTGCTAATGG - Intergenic
1011500115 6:87978965-87978987 CAAATGGGGGATGTTGATAATGG - Intergenic
1011658294 6:89571707-89571729 CTGGTGGCGGATGTTGATAATGG - Intronic
1011880308 6:92015803-92015825 CTGGTGGGGGATACTGATAATGG - Intergenic
1012310065 6:97712647-97712669 CTGGTAGAGGACGCTGATAAGGG - Intergenic
1012320909 6:97844396-97844418 CTGGTGAGGGATGTTGATAATGG - Intergenic
1012463996 6:99496864-99496886 CTGGTGGGGGATGTTGATAATGG - Intronic
1012526224 6:100181297-100181319 CTGGTGGAGGATGTTGATACGGG - Intergenic
1012801257 6:103832172-103832194 TTGGTGGGGGATGTTGATACTGG + Intergenic
1012891401 6:104901589-104901611 CTGGTGGTGGATATTGATAATGG - Intergenic
1012897195 6:104963672-104963694 TTGGTAGGGGATGTTGATAATGG - Intronic
1012926048 6:105268945-105268967 GAGGTGGGGGATGTTGATAATGG + Intergenic
1014331976 6:120079505-120079527 CTGGTGGGAGATGTTGATATTGG - Intergenic
1014333802 6:120105675-120105697 CTGATGGAGGATGTTGATAATGG - Intergenic
1014701046 6:124688416-124688438 CTGGTGGAGGATGCTGATAATGG - Intronic
1014784786 6:125606575-125606597 CTGATGGGGGATGTTAATAATGG + Intergenic
1015054157 6:128879130-128879152 CTGATGGGGCATGTTGATAAAGG + Intergenic
1015482948 6:133734494-133734516 CTAGTAGGAGAGATTGATAATGG + Intergenic
1015689911 6:135910525-135910547 TTGGTGGGGGATGTGGATAATGG - Intronic
1015694203 6:135962046-135962068 CTGATGGGGGAGGTTGACAATGG + Intronic
1015752988 6:136579685-136579707 TCTGTGGGGGACCTTGATAATGG + Intronic
1015757186 6:136619529-136619551 CTGGTGGGGAATGTTGATAAGGG - Intronic
1015767454 6:136733733-136733755 CTGGTGGGGGATGTTGACAATGG - Intronic
1016050796 6:139528050-139528072 CTGGTGGGGAATGTTGATAATGG + Intergenic
1016125580 6:140398812-140398834 CTGGTGGGGGATATTGATAATGG - Intergenic
1016145091 6:140660838-140660860 CTGGTGGGGAATGTTGACAATGG + Intergenic
1016430298 6:143977111-143977133 CTAGTGGGGGATGTCGATAATGG - Intronic
1016678458 6:146799682-146799704 CTGGTAGGGGATGTTAATAATGG + Intronic
1017157957 6:151339522-151339544 CTGGTGGGGAATGTTGATAAGGG - Intronic
1018289615 6:162278494-162278516 CTGGTGGGGGATGTTGATAATGG + Intronic
1018657420 6:166051694-166051716 CTGGTGGGGGATGTTGATAAGGG - Intergenic
1019903277 7:4041389-4041411 CTGGTGGGGGATGCTGATAGTGG - Intronic
1020498241 7:8883859-8883881 TTAGTGGGGGATGTTGATAAAGG + Intergenic
1020770365 7:12384552-12384574 CTGGTGGGGGACGTCGACAATGG + Intronic
1020874976 7:13681812-13681834 CTGATGGGGGATGTTGATAATGG + Intergenic
1021341036 7:19463061-19463083 CTGGTGGGGGATGTTGATAATGG + Intergenic
1022420815 7:30221722-30221744 CTGGTGTGGGATGTTGATAATGG + Intergenic
1023379427 7:39591616-39591638 CCGGTGGTGGACGTTGATAATGG - Intronic
1023404956 7:39823736-39823758 TTGGTGGAGGACATTGATAATGG - Intergenic
1023642855 7:42278265-42278287 CTGGTGGGGGATGTTGACAGTGG + Intergenic
1024035962 7:45507633-45507655 CTGGTGGGGGATGTTGATAATGG - Intergenic
1024794032 7:53001931-53001953 CTGGTGGGGGATGTTGACAACGG + Intergenic
1024899660 7:54304280-54304302 CTGGTGGGGGATGTTGATAATGG + Intergenic
1024901673 7:54324859-54324881 CTACTGGGGGAAGTTGGTATAGG + Intergenic
1027478009 7:78657856-78657878 CCAGTGGGTGACGTTAATCATGG + Intronic
1028723001 7:94055443-94055465 TTCTTGGGGGATGTTGATAATGG + Intergenic
1028770184 7:94610412-94610434 CTGGTGGGGGATGTTGATAATGG + Intronic
1029000639 7:97151077-97151099 CCAGTGGGGGATGCTGATAATGG - Intronic
1029801360 7:102951061-102951083 CTTGTGGGTGATGTTGATAGTGG + Intronic
1029846112 7:103413901-103413923 ATAGTGGGGGATGTTGATAGTGG - Intronic
1029846116 7:103413917-103413939 CTGGTGGGGGATGTTGATAGTGG - Intronic
1030062126 7:105630765-105630787 CTGGTGGGGGATGTTGATAGTGG + Intronic
1030290526 7:107867670-107867692 CTTGTGGGGGATGTTGATAATGG + Intergenic
1030910371 7:115240927-115240949 CTGGTGGGAGACATTGATAATGG - Intergenic
1031379003 7:121061512-121061534 CTGGTGGGGGATGTTAATAATGG + Intronic
1031639971 7:124150583-124150605 CTAGTGGGGGATATTGATCATGG - Intergenic
1031668241 7:124512084-124512106 CTAGTGTGGGGTGTTGTTAATGG + Intergenic
1032015312 7:128376317-128376339 CTGGTGAGGGATGTTTATAATGG - Intergenic
1032757305 7:134903349-134903371 CTTGTGAGGGATGTTTATAATGG + Intronic
1032948569 7:136880729-136880751 CTGGTGGGGGAGGTTGATAGTGG - Intronic
1033139321 7:138810869-138810891 CTGGTGGGGGGTGTTGATAATGG + Intronic
1033402704 7:141042065-141042087 CTGGTGGGGGGTGTTAATAATGG + Intergenic
1033435202 7:141327415-141327437 CTAATGGGGAATGTTGATAGTGG - Intronic
1033467843 7:141612591-141612613 CTGGTGAAGGATGTTGATAATGG + Intronic
1033779997 7:144657681-144657703 CTGGTGAGGGATGTTGATAACGG + Intronic
1034915155 7:155032833-155032855 CTGTTGGGGGATGTTGAGAACGG - Intergenic
1034993419 7:155562362-155562384 CTGGTGGGGAACGCTGATAGCGG + Intergenic
1035002492 7:155624360-155624382 CTGGTGGGGGACGCTGATAATGG - Intronic
1035148904 7:156849884-156849906 CTGGTGGGGGATGCTGATAATGG + Intronic
1035409795 7:158630350-158630372 TTAGTGAGTGACATTGATAACGG - Intergenic
1035525827 8:312417-312439 CTGGTGGGGGATGTTGATAATGG - Intergenic
1037529017 8:19756659-19756681 CTAGTGGGGGATGTGGCTGAGGG - Intronic
1038031106 8:23641219-23641241 CTGGTGGGGGATGTTGACAGTGG - Intergenic
1038144080 8:24877780-24877802 CTGGTGGAGGATGTTGATAATGG + Intergenic
1038473882 8:27848230-27848252 CTGGTGGGGGATGTTGATAATGG - Intergenic
1039095792 8:33883563-33883585 CTGGTGTGGGGTGTTGATAATGG + Intergenic
1039165177 8:34670964-34670986 CTAGTGGTGGATGCTGATAGTGG - Intergenic
1039333359 8:36563224-36563246 GTTGTGAGGGATGTTGATAATGG + Intergenic
1039722909 8:40184193-40184215 CTGGTGGGGGATATTGATATTGG + Intergenic
1039940952 8:42090694-42090716 CTGGTGGGGGATGTTTATAATGG + Intergenic
1040004844 8:42611221-42611243 GTGGTGTGGGATGTTGATAATGG + Intergenic
1040294054 8:46140106-46140128 GTATTGGGGGACGTTGAGACAGG - Intergenic
1040406212 8:47105745-47105767 CTAGTGAGGGATACTGATAATGG + Intergenic
1040642643 8:49357440-49357462 CTAATGGGAGATATTGATAATGG - Intergenic
1041299862 8:56399712-56399734 CTGGTGGGGGATGTTGATGTTGG - Intergenic
1041407955 8:57521332-57521354 CTAGTGGGGGATGCTGATGATGG - Intergenic
1041609219 8:59824476-59824498 CTAATAGGGGACGTTGATAATGG + Intergenic
1042127360 8:65551882-65551904 CTGGTGGAGGATGTTGATAGTGG - Intergenic
1042225193 8:66509821-66509843 CTGGTGGGGGATGTTGATGGGGG - Intronic
1042253760 8:66782418-66782440 CTGGTGGGGGATATTGACAATGG - Intronic
1042422288 8:68605923-68605945 CCCCTGGGGGATGTTGATAATGG + Intronic
1042427796 8:68669226-68669248 TTGGTGGGGGATGTTGATAATGG + Intronic
1042501245 8:69511649-69511671 CTAGTGGTGGATGTTGAGAATGG - Intronic
1043038795 8:75232543-75232565 CTGGTGGAAGATGTTGATAATGG + Intergenic
1043413636 8:80027019-80027041 CTGGTGGGGGATGTTGACAGTGG - Intronic
1043532168 8:81163090-81163112 CTAGAGGGGAATGTTGATCATGG - Intergenic
1043562454 8:81509977-81509999 GTGGTGGGGGATGTTGGTAATGG + Intergenic
1043739706 8:83795357-83795379 CTGGTGGGGCATGTTGATAATGG + Intergenic
1043742159 8:83827867-83827889 TTAGTGGAGGATGTTGATAATGG - Intergenic
1043830884 8:84987428-84987450 CTGGTGGAGGATGTTGATAATGG - Intergenic
1043987691 8:86713956-86713978 CTCTTGGGGGATGTTGATAATGG - Intronic
1044057791 8:87593873-87593895 CTGGTGGGGGATGTTTATAATGG - Intronic
1044309506 8:90677438-90677460 CTGGTGTGGGATGTTGATAATGG - Intronic
1044956883 8:97490431-97490453 CTCATGGGGGACGTCGATAATGG + Intergenic
1045350918 8:101338873-101338895 CTGGTGTGGGATGTTGACAATGG - Intergenic
1045619868 8:103963639-103963661 TTGGTGGAGGAGGTTGATAATGG - Intronic
1045650258 8:104335740-104335762 ACAGTGGGGGATGTTGATATTGG + Intronic
1046120084 8:109835313-109835335 CTGGTGAGGGATGTTGATAATGG - Intergenic
1046227459 8:111302729-111302751 CTGGTGGAGGATGCTGATAATGG + Intergenic
1046869955 8:119195104-119195126 CTGGTGGGGAATGTTGATAATGG + Intronic
1047190797 8:122677561-122677583 TTGGTGGGTGAAGTTGATAATGG + Intergenic
1047640654 8:126817984-126818006 GTAGTAGGGGATGTTGATAATGG - Intergenic
1047715615 8:127592294-127592316 CTGCTGGGGGATGCTGATAATGG - Intergenic
1047980907 8:130181021-130181043 CTGGTGGGGGTCAGTGATAACGG + Intronic
1048318640 8:133381160-133381182 CTGATGGGGGATGTTGATAATGG + Intergenic
1048778706 8:137977673-137977695 CTGGTGGAGGATGTTGATTATGG + Intergenic
1048810718 8:138283651-138283673 CTAATGGGAGATGTTGATAATGG + Intronic
1050145627 9:2564372-2564394 CTGATGAGGGATGTTGATAATGG + Intergenic
1050218073 9:3351148-3351170 CTGGTGGGGAATGTTTATAATGG + Intronic
1050777350 9:9282280-9282302 CTGTTGGGGGATGTTGATAATGG + Intronic
1050796130 9:9545080-9545102 TTGGTGGGGGATGTTGGTAATGG - Intronic
1050804515 9:9656820-9656842 CTGGTGGGGGATGTTGATAGTGG + Intronic
1050847239 9:10237135-10237157 CTGGTGGGGGATGTTGATAATGG + Intronic
1051746712 9:20301682-20301704 CTGGTGGGGGATGTTGATAATGG - Intergenic
1051765977 9:20524176-20524198 CTGGTAGGGGATGTTGATAATGG + Intronic
1052139482 9:24961403-24961425 CTAGGGGAGGATGTTGATAACGG + Intergenic
1052455946 9:28698734-28698756 CTGGTGGGGGATGTTGATAGTGG - Intergenic
1052783874 9:32810830-32810852 CTGGTGGGGGATGTTGATAGTGG + Intergenic
1053624764 9:39857826-39857848 CTGGTGGGGGATGTTTATTATGG - Intergenic
1053838122 9:42162785-42162807 CTGGTGGGGGATGTTTATTATGG - Intergenic
1053880106 9:42585402-42585424 CTGGTGGGGGATGTTTATTATGG + Intergenic
1053892555 9:42708907-42708929 CTGGTGGGGGATGTTTATTATGG - Intergenic
1054219131 9:62392872-62392894 CTGGTGGGGGATGTTTATTATGG + Intergenic
1054231582 9:62516301-62516323 CTGGTGGGGGATGTTTATTATGG - Intergenic
1054726571 9:68658026-68658048 CTGGTAGGGGATGTTGATAAGGG + Intergenic
1055005626 9:71502721-71502743 CTGGTGGGGAATATTGATAATGG + Intergenic
1055324034 9:75110002-75110024 CTGGTGAGGGATGTTGATAATGG - Intronic
1055527015 9:77145192-77145214 CTGGTGGGGGATGTTGATAGTGG + Intergenic
1055932000 9:81568634-81568656 CTGGTGTGGGATGTTGATAGTGG - Intergenic
1056096923 9:83264514-83264536 CTTGTGTGGGATGTTGATGATGG + Intronic
1057368523 9:94447606-94447628 CTCGTGGGAGATGTTGATAGTGG - Intronic
1057740005 9:97703090-97703112 CTGGTTGAGGACGTTAATAATGG - Intergenic
1057862798 9:98655272-98655294 CTGGTGGGGGATGTCGATAATGG + Intronic
1058789044 9:108423210-108423232 CTGGTAGGGGATGCTGATAATGG + Intergenic
1059894825 9:118850970-118850992 CTGGTGGGGGATGGTAATAATGG + Intergenic
1059939845 9:119347904-119347926 CTAATAGGGCATGTTGATAATGG - Intronic
1060213367 9:121723870-121723892 CTGCTGGGGGACCTTGATCAAGG + Intronic
1060714976 9:125917315-125917337 CTGGTGGGGGATGCTGATAATGG - Intronic
1061455277 9:130692918-130692940 GTAGTGGGGGACGGGGAGAAGGG + Intergenic
1061495772 9:130973467-130973489 CTAGAGGCGGACGTGGATCAGGG - Intergenic
1061791267 9:133060517-133060539 CTGGTGGGGGATGTTGATAACGG + Intergenic
1061794929 9:133080994-133081016 CTGGTGGGGGATGTTGATAATGG + Intronic
1185814108 X:3138181-3138203 CTAGTGGGGGATGTTGACAGTGG - Intergenic
1185819237 X:3185651-3185673 CTAGTCGGGGATGTTCATAGTGG + Intergenic
1186074868 X:5867097-5867119 CTGGTGGGGGATGTTGATAATGG - Intronic
1186167353 X:6840804-6840826 CAGGTGGGGGATGTTGGTAATGG + Intergenic
1186347249 X:8706602-8706624 CTGGTGGGGGATGTTGGTAATGG + Intronic
1186695618 X:12028419-12028441 CTAGTGTGAGATGCTGATAATGG - Intergenic
1187219372 X:17308698-17308720 CTAGTGGGAGATGGTGATAATGG - Intergenic
1187626508 X:21120675-21120697 CTGTTGGGGGATTTTGATAACGG - Intergenic
1187758299 X:22549737-22549759 CTGGTGGGGGATGCTGATAATGG + Intergenic
1188043757 X:25401948-25401970 CTGGTGGGGGATGTTGATAATGG - Intergenic
1188269054 X:28116098-28116120 CTGGTGGGGGATGTTGATAATGG - Intergenic
1188622168 X:32239462-32239484 CTGGTGTGGGATGTTGATAGCGG - Intronic
1188709127 X:33372519-33372541 CTGGTGGGGCGTGTTGATAATGG - Intergenic
1189001219 X:36949370-36949392 CTGGTGGGGGATGTTGAAAATGG - Intergenic
1189027562 X:37413080-37413102 CTGGTAAGGGATGTTGATAATGG - Intronic
1189058448 X:37726174-37726196 CTGGTGGGGGATGTTGATAATGG + Intronic
1189464965 X:41271632-41271654 CTGGTGGGGGATATTGATAATGG + Intergenic
1189572836 X:42317949-42317971 TTGGTGGGGGATATTGATAATGG - Intergenic
1189742115 X:44130013-44130035 CCAGTGGGGGACCTGGGTAAGGG - Intergenic
1189937549 X:46085587-46085609 CTAGTGGGGGATGTTGATAGTGG - Intergenic
1190365053 X:49684876-49684898 CCTTTGGGGGATGTTGATAATGG - Intergenic
1192187649 X:68962869-68962891 CTGGTAGGGGATGTTGATAATGG - Intergenic
1192903645 X:75525676-75525698 CTGGTGGGGGATGTTGATAATGG - Intergenic
1194184440 X:90756504-90756526 CTGGTGGGGGATATTGATAATGG + Intergenic
1194278766 X:91921253-91921275 CTGGTGGGGGATATTGACAATGG - Intronic
1195301306 X:103532431-103532453 GTAGTGAAGGATGTTGATAAGGG + Intergenic
1195587479 X:106581806-106581828 CTGGTGGAGGATGTTGATAATGG + Intergenic
1195827448 X:109017696-109017718 CTGGTAGGAGACGTTGATAATGG + Intergenic
1196264853 X:113630890-113630912 CTGGTGGGGCATGTTGATAATGG + Intergenic
1196767360 X:119259604-119259626 CTGGTGGGAGACGTTAATCATGG + Intergenic
1197241179 X:124124901-124124923 CTTGTTGGGGATGTTGATAATGG + Intronic
1198410836 X:136365973-136365995 CTGGTGGGGGATGTTGATGGTGG - Intronic
1198819307 X:140629623-140629645 TTGGTGGGGGATATTGATAATGG + Intergenic
1199088093 X:143652629-143652651 CTGGTGGAGGATGTTGATAAAGG - Intergenic
1200531029 Y:4338417-4338439 CTGGCGGGGGATATTGATAATGG + Intergenic
1200596249 Y:5144755-5144777 CTGGTGGGGGATATTGACAATGG - Intronic
1201267599 Y:12223300-12223322 CTAGTAGGGGATGTTGACAGTGG + Intergenic
1201419656 Y:13784545-13784567 CTGGTGGGGGATGTTGGTAATGG - Intergenic
1201745827 Y:17372327-17372349 CTGGTGGGAGATGTTGATAATGG - Intergenic