ID: 952896007

View in Genome Browser
Species Human (GRCh38)
Location 3:38079503-38079525
Sequence TAGGGGGCTTTGGAGGCGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 2, 2: 116, 3: 173, 4: 253}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952895998_952896007 2 Left 952895998 3:38079478-38079500 CCAAAGCTCGGTGTCCGTGATGG 0: 9
1: 80
2: 113
3: 62
4: 73
Right 952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG 0: 1
1: 2
2: 116
3: 173
4: 253
952895995_952896007 18 Left 952895995 3:38079462-38079484 CCACTGTGAGAGTTACCCAAAGC 0: 59
1: 312
2: 360
3: 166
4: 138
Right 952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG 0: 1
1: 2
2: 116
3: 173
4: 253
952895997_952896007 3 Left 952895997 3:38079477-38079499 CCCAAAGCTCGGTGTCCGTGATG 0: 6
1: 75
2: 171
3: 190
4: 160
Right 952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG 0: 1
1: 2
2: 116
3: 173
4: 253
952895994_952896007 22 Left 952895994 3:38079458-38079480 CCTTCCACTGTGAGAGTTACCCA 0: 84
1: 318
2: 319
3: 133
4: 158
Right 952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG 0: 1
1: 2
2: 116
3: 173
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952896007 Original CRISPR TAGGGGGCTTTGGAGGCGAT CGG Intronic
900520034 1:3100976-3100998 GAGGGGGCATTGGAGGGGGTGGG + Intronic
900840840 1:5047332-5047354 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
900847527 1:5115607-5115629 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
902970376 1:20043913-20043935 CAGGGGGCTTTCGAGGTGATTGG + Intronic
903793551 1:25911045-25911067 CAGGGGGCTTCCGAGGCGATCGG + Intergenic
904850115 1:33452820-33452842 TGGGGGGCTGTGGAGGAGGTTGG + Intergenic
904996434 1:34635183-34635205 TGTGGGGCTTCCGAGGCGATAGG + Intergenic
905241956 1:36587236-36587258 TAGGGGGCTCTGGACACCATGGG + Intergenic
907292676 1:53426781-53426803 TACAGGGCTTCCGAGGCGATCGG - Intergenic
907521309 1:55025085-55025107 CTGGGGGCTTCCGAGGCGATCGG - Intergenic
908461666 1:64353193-64353215 CAGGGGGCTTCCGAGGCGATCGG + Intergenic
908591905 1:65645101-65645123 CAGGGGGCTTCCGAGGCGATCGG + Intergenic
908852456 1:68388750-68388772 CAGGGGGCTTCCGAGGCGATCGG - Intergenic
909550974 1:76897999-76898021 TACGGGGCTTCCGAGGCAATCGG + Intronic
909776640 1:79491792-79491814 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
909792935 1:79699584-79699606 TATGGGGCTTTCGAGGTGATCGG + Intergenic
909910010 1:81247924-81247946 TACGGGGCTTCCGAGGCGATCGG - Intergenic
909978402 1:82070741-82070763 TACGGGGCTTCCGAGGCGATCGG + Intergenic
911570440 1:99512104-99512126 TAGGGGGCTTCTGAGGTGATTGG - Intergenic
911759731 1:101601264-101601286 TAGGGGGCTTCCAAAGCGATCGG + Intergenic
915075809 1:153307396-153307418 GAGGGGGCTTTGGTGGTGAAGGG - Intronic
918347167 1:183616132-183616154 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
918567622 1:185951525-185951547 TAGGGGGCTTCTGAGGCGATCGG + Intronic
918714357 1:187768732-187768754 TAAGGGGCTTCCGAGGCGATCGG + Intergenic
919476444 1:198037268-198037290 TACGGGGCTTCTGAGGCGATCGG - Intergenic
919778691 1:201209493-201209515 TTGGGGGCTTCTGAGGCAATAGG + Exonic
919814912 1:201431207-201431229 TATGGGGCTTTGGAGGAGAATGG - Intergenic
920427302 1:205888535-205888557 CAGGGGGCTTCTGAGGTGATTGG + Intergenic
920908049 1:210189774-210189796 CAGGGGACTTCTGAGGCGATTGG - Intergenic
921070738 1:211655805-211655827 TAGGGGGCTGGGGAGGGGAGCGG - Intergenic
921212470 1:212911990-212912012 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
921459731 1:215413169-215413191 TAGGGGGCTTCCGAGGCTATCGG + Intergenic
921509308 1:216010481-216010503 TAGGGGGCTTCCAAGGCGATCGG - Intronic
921520183 1:216148028-216148050 TAGGGGGCTTCCGAGGCGATCGG - Intronic
921732926 1:218597018-218597040 TAGGGGGCTTCTGAGGCAATTGG + Intergenic
922048458 1:221968430-221968452 TACGGGGTTTCTGAGGCGATCGG - Intergenic
922154017 1:223027632-223027654 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
922906445 1:229176904-229176926 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
923244806 1:232120663-232120685 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
923408579 1:233686661-233686683 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
923770689 1:236935490-236935512 TACGGGGCTTCCAAGGCGATCGG + Intergenic
924180701 1:241436456-241436478 TACGGGGCTTCTGAGGCAATCGG - Intergenic
924623613 1:245683199-245683221 CAGGGAGCTTTGCAGGGGATGGG + Intronic
924896133 1:248339456-248339478 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1064131661 10:12715085-12715107 TAGGGGGCGTCTGAGGGGATTGG - Intronic
1064663767 10:17630081-17630103 TATGGGGCTTCCGAGGCGATCGG + Intergenic
1064886948 10:20122390-20122412 TAGGGGGCTTTCGAGGCGATTGG + Intronic
1065437680 10:25718931-25718953 TAGGGGGCTTCCGAGGCGATGGG - Intergenic
1065443071 10:25771980-25772002 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1066437170 10:35405743-35405765 CAGGGGGCTTCCGAGGCTATTGG + Intronic
1067557311 10:47282068-47282090 TAGCTGGCTTTGGAGGGAATTGG + Intergenic
1068179609 10:53502262-53502284 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1068592295 10:58864244-58864266 CTGGGGGCTTCTGAGGCGATCGG + Intergenic
1070474974 10:76821054-76821076 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1071481578 10:86068978-86069000 TAGGGGCCTGTGGAGCAGATTGG - Intronic
1071897685 10:90084267-90084289 TAGGGGGCTTCCAAGGCAATCGG + Intergenic
1072580311 10:96734697-96734719 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1074740830 10:116483134-116483156 TAGGGGGCTTCCAAGGCGATCGG - Intergenic
1074868967 10:117562334-117562356 TCGGGGGCTTTGTAGGCTTTGGG + Intergenic
1075225011 10:120620940-120620962 AAGGGGGTTTGGGAGGAGATGGG - Intergenic
1075248746 10:120847323-120847345 TACGGGGCTTCCGAGGCGATCGG - Intergenic
1076068143 10:127464944-127464966 AAGGGAGCTGTGGAGGCGGTGGG + Intergenic
1076090620 10:127682396-127682418 TGGGTACCTTTGGAGGCGATTGG + Intergenic
1077612238 11:3650420-3650442 TAGGGGGCTTCCGAGGCAATCGG - Intronic
1077850751 11:6073064-6073086 TAGGGGGCTTCCGAGGCAATCGG + Intergenic
1079005473 11:16788806-16788828 GAGGGGCCTTTGCAGGCGTTCGG - Exonic
1079447511 11:20570273-20570295 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1079672522 11:23187166-23187188 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1080027866 11:27632311-27632333 TAGGGGGCTTCCGAGGCCATCGG + Intergenic
1080227408 11:29975889-29975911 TAGGGGGCTTCTGAGGCTGTCGG - Intergenic
1081356857 11:42123060-42123082 TACGGGGCTTCCGAGGTGATCGG - Intergenic
1084355598 11:68636188-68636210 TAGGGGGCTTCTGAGGCAATCGG - Intergenic
1085570242 11:77552417-77552439 CAGGAGGCTTGCGAGGCGATTGG - Intronic
1086658108 11:89383467-89383489 CAGGAGGCTTCAGAGGCGATCGG - Intronic
1087127861 11:94644087-94644109 TACGGGGCTTCCGAGGCGATCGG - Intergenic
1087314726 11:96590408-96590430 TAGGGGGCTTCCAAGGTGATCGG - Intergenic
1087839491 11:102907306-102907328 TACGGGGCTTCTGAGGTGATCGG + Intergenic
1089953347 11:122549435-122549457 CAAGGGGCTTCCGAGGCGATCGG - Intergenic
1090107548 11:123868825-123868847 TAGGGGGCTTCTGAGGCCATTGG + Intergenic
1090526763 11:127545959-127545981 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1090850546 11:130567591-130567613 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1090871911 11:130756747-130756769 TAGGGGGCTTCTGAGGTGATCGG + Intergenic
1090926888 11:131257721-131257743 TAGGGGTCTTCCGAGGCGATTGG + Intergenic
1091183726 11:133629271-133629293 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1091886570 12:4021015-4021037 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1092924808 12:13263201-13263223 TAGGGGGCTTCCGAGGCAATCGG + Intergenic
1093071113 12:14708101-14708123 TAGGCGGCTTCCGAGGCGATCGG + Intergenic
1093267962 12:17024941-17024963 TACAGGGCTTCTGAGGCGATCGG + Intergenic
1093321938 12:17723502-17723524 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1093358483 12:18197435-18197457 TACGGAGCTTCTGAGGCGATTGG - Intronic
1094316004 12:29138233-29138255 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1094400728 12:30058462-30058484 TAGGGGGCTTCCAAGGTGATCGG - Intergenic
1095302215 12:40598082-40598104 TAGAGGACTTTGAAGGCCATGGG + Intergenic
1096469694 12:51868576-51868598 TGGGGGGCATTGGAGGAGTTCGG - Intergenic
1097417007 12:59326447-59326469 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1097957142 12:65497544-65497566 CAGGGGGCTTTGTAGACTATAGG - Intergenic
1098173592 12:67769876-67769898 CAGGGGGCTTCCGAGGCGATCGG + Intergenic
1098402300 12:70087885-70087907 CAGGGGGCTTCCGAGGCGATCGG - Intergenic
1098629108 12:72705834-72705856 TAGGGGGCTTCCGAGGCGAATGG - Intergenic
1099292051 12:80786309-80786331 TAGGGGGCTTCCAAGGCGATCGG + Intergenic
1099762634 12:86941284-86941306 TAGAGGGCTTCCGAGGCCATCGG - Intergenic
1099836052 12:87910622-87910644 TAGGGGGCTTCCGAGGCAATCGG + Intergenic
1099872837 12:88370159-88370181 CAGGGGGCTTCCAAGGCGATCGG - Intergenic
1100561410 12:95751661-95751683 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1100940348 12:99717672-99717694 TAGGGGGCTTCCAAGGCGATCGG - Intronic
1101077455 12:101145962-101145984 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1101278349 12:103225907-103225929 TAAGGGGCTTCCTAGGCGATCGG + Intergenic
1102599970 12:114022247-114022269 TAGGGGACTTCCGAGGTGATCGG - Intergenic
1102604523 12:114058323-114058345 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
1103216243 12:119203435-119203457 TAGAGGGAGTTGGAGGTGATGGG - Intronic
1104319925 12:127741496-127741518 ATGGGGCCTTTGGAGGTGATTGG + Intergenic
1104591262 12:130085992-130086014 GAGGGTGCCTTGGAGGTGATTGG + Intergenic
1107075631 13:36318927-36318949 TAGGGGGCTTCCGAGGCGATCGG - Intronic
1107220250 13:37972403-37972425 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1107224079 13:38026100-38026122 TAGGGGGTTTGGGAGGTGGTAGG - Intergenic
1107683091 13:42870645-42870667 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1108282016 13:48870350-48870372 TAGGGGGCTTCCAAGGCAATTGG + Intergenic
1108803826 13:54130918-54130940 TAGGGGGCTTCCAAGGCGATTGG + Intergenic
1108814175 13:54269341-54269363 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
1109499336 13:63215598-63215620 TACGGGGCTTCTGAGGCAATGGG - Intergenic
1109709616 13:66144564-66144586 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1109716694 13:66229612-66229634 TAGGGGGCTTCTGAGGCTATCGG + Intergenic
1110765531 13:79276613-79276635 TACGGGGCTTCCCAGGCGATCGG - Intergenic
1111125992 13:83911508-83911530 TAGGGGGCTTCCCAGGCGATCGG + Intergenic
1111362058 13:87189654-87189676 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1111458789 13:88516052-88516074 TAGGGTGCTTCCGAGGCGATCGG + Intergenic
1111630492 13:90841925-90841947 TATGGGGCTTCCAAGGCGATCGG - Intergenic
1112086589 13:96038736-96038758 TTGGGGGCTTTGGGGGCTAGAGG - Intronic
1112186906 13:97136602-97136624 TAGGGGGTTTGGCAGGCAATGGG - Intergenic
1115240557 14:31248580-31248602 TACGGGGCTTCCGAGGCGATCGG + Intergenic
1116179729 14:41518428-41518450 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1116573499 14:46546399-46546421 TACGGGGCTTCTGAGGCAATCGG - Intergenic
1116613560 14:47106666-47106688 TAGGGGGCTTCCGAGGCGATCGG - Intronic
1116702357 14:48258610-48258632 TCCGGGGCTTCCGAGGCGATTGG + Intergenic
1116703241 14:48265605-48265627 TAGGGGGCTTCTGAGGCTATTGG + Intergenic
1116952963 14:50895656-50895678 TAGGGGGCTTCCGAGGCGATCGG - Intronic
1117801236 14:59446567-59446589 TACGGGGCTTCCAAGGCGATCGG - Intronic
1118937210 14:70299029-70299051 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1119248292 14:73131548-73131570 CAGGAGGCTTCTGAGGCGATCGG + Intergenic
1119317252 14:73705976-73705998 TAGGGGGCTTCCGAGGCAATCGG - Intergenic
1119560230 14:75583906-75583928 CAGGGGGCTTCCGAGGCGATTGG + Intronic
1119640162 14:76308798-76308820 TAGGGGGCTGTGGAAGCCCTAGG + Intergenic
1120659907 14:87238268-87238290 TAGGGGGCTTCCGAGGCAATCGG + Intergenic
1121129068 14:91428728-91428750 TTGGGGGATTTGGATGGGATAGG + Intergenic
1121289463 14:92762353-92762375 CAGGGGGCTTCCGAGGCGATCGG - Intergenic
1122006482 14:98708499-98708521 TCGGGGGCTGGGGAGGAGATGGG - Intergenic
1122041047 14:98987680-98987702 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1122469008 14:101953448-101953470 GAGGTGGCTTTGGAGGAGTTTGG - Intergenic
1123882449 15:24688806-24688828 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1125045825 15:35241255-35241277 TAGGGGGCTTCCGAGGCGATCGG - Intronic
1125131467 15:36288868-36288890 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1125756106 15:42066073-42066095 TGGGGGGCTTTGGAGACTAAAGG - Intergenic
1126530105 15:49702367-49702389 TAGTGGGCTTCTGAGGCGATCGG + Intergenic
1126843795 15:52741062-52741084 TACAGGGCTTCTGAGGCGATCGG - Intergenic
1129117355 15:73371936-73371958 TAGGGGACTTTGGAGACAAATGG + Intergenic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1129902452 15:79161323-79161345 GATGGTGCTTTGGAGGGGATTGG + Intergenic
1129908022 15:79203366-79203388 GAGGGGGCTGTGGGGGCAATGGG + Intergenic
1130855158 15:87833752-87833774 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1130945898 15:88550728-88550750 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1131882467 15:96875051-96875073 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1132263061 15:100442772-100442794 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1132340465 15:101075022-101075044 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1133765686 16:8836247-8836269 TATGGGGCTTCCGAGGGGATTGG + Intronic
1133938219 16:10285640-10285662 CAGGGGGCTTCTGAGGCGATTGG - Intergenic
1134342129 16:13355795-13355817 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1136414577 16:30095707-30095729 GAAGGGGCTTTGGAGGGGCTGGG + Exonic
1137332586 16:47514015-47514037 TGGGGGGCTTTGGAGAATATAGG - Intronic
1139039190 16:62982374-62982396 TCGGGGGCTTCTGAGGCGATCGG + Intergenic
1139225865 16:65233059-65233081 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1139230549 16:65278480-65278502 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1139943002 16:70619691-70619713 TACAGGGCTTTCGAGGCGATCGG + Intronic
1139956279 16:70694497-70694519 AAGGGGGCTCAGGAGGGGATGGG + Intronic
1141865159 16:86745258-86745280 TACGGGGCTTCCGAGGCGATCGG + Intergenic
1143414309 17:6734866-6734888 CAGGAGGCTTCTGAGGCGATCGG + Intergenic
1146597947 17:34185760-34185782 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
1146757607 17:35447608-35447630 TGGGGGGCTTGGGAGTGGATGGG - Intronic
1148088119 17:45006769-45006791 TGGGGGGGTTTGGAGGGGGTTGG - Intergenic
1151221663 17:72617162-72617184 TGGGGGGCTGTGGAGGAGTTGGG + Intergenic
1151622537 17:75255055-75255077 TATGGGGCTTCCGAGGCGATCGG - Intronic
1151839708 17:76609188-76609210 TACGGGGCTTCCGAGGCTATCGG + Intergenic
1154177427 18:12094392-12094414 TGGGGGGCGTTGGATGTGATGGG + Intronic
1154177482 18:12094538-12094560 TGGGGGGCGTTGGATGTGATGGG + Intronic
1155173869 18:23286537-23286559 TACGGGGCTTCCGAGGCGATCGG - Intronic
1155696971 18:28696334-28696356 TACGGGGCTTTCGAGGTGGTCGG + Intergenic
1155962046 18:32003093-32003115 TAGGGGGCTTCCAAGGCGATCGG - Intergenic
1156958226 18:42993360-42993382 TAGGGGGCTTCCGAGGCAATCGG - Intronic
1157217021 18:45792708-45792730 AAGCGGGCTGTGGAGGAGATTGG - Intergenic
1158394597 18:57069854-57069876 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1159164513 18:64684113-64684135 TACGGGGCTTCCGAGGCGATCGG - Intergenic
1159835101 18:73327123-73327145 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1161661770 19:5550957-5550979 TACGGGGCTTCCGAGGCGATCGG - Intergenic
1161751483 19:6100477-6100499 CAGGAGGCTTTGGCGGCGACCGG + Intronic
1161973585 19:7596726-7596748 GAGGGGGCTATGGAGGCGAAAGG - Intronic
1162361673 19:10224091-10224113 TAGTGGGCTTTGTAGAGGATCGG + Exonic
1163209687 19:15831290-15831312 CAAGGGGCTTCTGAGGCGATCGG - Intergenic
1163487338 19:17595911-17595933 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1163900177 19:20093848-20093870 CAGGGGGCTTCCGAGGCGATCGG + Intronic
1163907231 19:20158019-20158041 TAGGGGGCTTCCGAGGCGTTCGG - Intergenic
1164153021 19:22570727-22570749 TAGGGGGCTTCCGAGGCGTTCGG - Intergenic
1164459178 19:28433087-28433109 TATCGGGCTTCTGAGGCGATCGG + Intergenic
1164618818 19:29681837-29681859 GAGGGGGCTTGGGAGGCCAGAGG - Intergenic
1164705019 19:30313577-30313599 TGGGAGGCTTTGGAGGTCATGGG - Intronic
1165496961 19:36158651-36158673 TACGGGGCTTCCGAGGCAATCGG + Intergenic
1165835408 19:38752097-38752119 TACGGGGCTTCCGAGGCAATCGG - Intronic
1165992870 19:39826146-39826168 TTGGGGGCTTTGGAGGTGGGTGG - Intronic
1167046553 19:47052980-47053002 TACGGGGCTTTCGAGGTGATCGG + Intergenic
1167099506 19:47395529-47395551 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1168266781 19:55227754-55227776 CATGGGGCTTTGGAGGCCAAGGG - Intronic
925544599 2:5003464-5003486 TAGGGGGCTTCCGAGGCAATCGG - Intergenic
926407814 2:12572243-12572265 TACGGGGCTTCCGAGGCGATCGG - Intergenic
926413637 2:12628984-12629006 TAGGGGGCTTCCAAGGCAATCGG - Intergenic
926464045 2:13167218-13167240 TAGGGGGCTTCCAAGGCAATCGG + Intergenic
926815498 2:16795165-16795187 TAGGGGGCTTCCGAGACGATTGG + Intergenic
927707571 2:25306295-25306317 TAGGGGGCTTTGGAGGGCTCTGG - Intronic
928770777 2:34700320-34700342 TAGGGGGCTTCCAAGGTGATCGG + Intergenic
928827611 2:35440325-35440347 TACGGGGCTTCCGAGGAGATCGG + Intergenic
928857220 2:35815567-35815589 TACGGGGCTTCCGAGGAGATTGG - Intergenic
928928611 2:36601519-36601541 TAGGGGGCTTCCGAGGCGATTGG - Intronic
929434638 2:41919190-41919212 TTGGGGGCCTTAGAGGAGATGGG - Intergenic
929793018 2:45037663-45037685 TAGGCGGCTTCCGAGGCGATCGG + Intergenic
930955143 2:57195443-57195465 TACGGGGCTTCGGAGGCAATCGG - Intergenic
931042664 2:58316179-58316201 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
931236985 2:60420088-60420110 TACGGGGCTTCCGAGGCGATCGG - Intergenic
931625828 2:64255015-64255037 TAGGGGTCTTCCGAGGTGATCGG - Intergenic
932159410 2:69446879-69446901 TAGGGGGCTTCCAAGGTGATTGG + Intergenic
932295900 2:70623114-70623136 TAAAGGGCTTCCGAGGCGATCGG - Intronic
932358770 2:71088271-71088293 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
932367598 2:71162911-71162933 TAGGGGGCTTCCGAGGTGATTGG + Intergenic
932973908 2:76577077-76577099 TAGGGGGCTTCCGAGGCGATTGG + Intergenic
933013135 2:77090853-77090875 TAGGGGGCTGCCGAGGCAATCGG - Intronic
933179725 2:79215042-79215064 TAGGGGGCTTCTGAGGCGATCGG + Intronic
934074103 2:88412852-88412874 AAGGTGTCTTTGGAGGCGTTTGG - Intergenic
936794241 2:116187492-116187514 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
939083091 2:137686167-137686189 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
940508740 2:154586461-154586483 TACGGGGCTTCCGAGGTGATCGG + Intergenic
941353433 2:164461597-164461619 CTGGGGGCTTCCGAGGCGATCGG - Intergenic
941456146 2:165713729-165713751 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
941935847 2:170980866-170980888 TATGGGGCTTCCGAGGCGATCGG + Intergenic
942097125 2:172544210-172544232 TAGGGGGCTTCCAAGGTGATCGG - Intergenic
942730245 2:179054979-179055001 TACGGGGCTTCCGAGGAGATCGG + Intergenic
943421539 2:187673711-187673733 TACGGGGCTTTCGAGGTGATCGG + Intergenic
943461151 2:188172432-188172454 TAAGGGGCTTCCGAGGCGATCGG + Intergenic
944876081 2:203965143-203965165 TAGGGGGATTCTGAGGCGATCGG + Intergenic
945153054 2:206810081-206810103 TAGGGGGCTTCCAAGGCGATCGG + Intergenic
945394348 2:209301700-209301722 TAGGGCGCTTCCGAGGTGATCGG - Intergenic
945938367 2:215924858-215924880 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
946214988 2:218177265-218177287 TACGGGGCTTCCGAGGCAATAGG + Intergenic
946871712 2:224091074-224091096 TACAGGGCTTCTGAGGCGATCGG + Intergenic
946886547 2:224227773-224227795 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
946893321 2:224299158-224299180 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
948390736 2:237609438-237609460 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1170068820 20:12343499-12343521 TAGTGGGCTTCCGAGGCGATCGG + Intergenic
1170106282 20:12756359-12756381 TAGGGGGCTTCTGAGGCCATCGG - Intergenic
1170158227 20:13287500-13287522 TAGGGGGGCTTGGAGGTGAGAGG - Intronic
1170165789 20:13359444-13359466 TAGGGGGCTTCTGAGGCCATCGG - Intergenic
1170562478 20:17569610-17569632 GAGGGGGATTTGGAGGGGAGAGG - Intergenic
1170820655 20:19754379-19754401 TACGGGGCTTCCGAGGCGATCGG + Intergenic
1172182933 20:33014602-33014624 TAGGGGGATTTGCAAGCCATGGG - Intronic
1172242519 20:33422934-33422956 TAGGGGACTGCGGAGGTGATGGG - Intronic
1172932425 20:38595940-38595962 CGGGGGGCTTCCGAGGCGATCGG + Intergenic
1173176921 20:40771652-40771674 TTGAGGGCTTTGTAGGGGATGGG - Intergenic
1173652083 20:44672843-44672865 CAGGAGGCTTCTGAGGCGATCGG - Intergenic
1173763730 20:45587425-45587447 TATGGGGATTCCGAGGCGATCGG + Intergenic
1175387056 20:58604206-58604228 GAGGGGGCTTTGGATGAGGTGGG + Intergenic
1176073901 20:63239906-63239928 AAGCCGGCTTTGGAGGCGTTTGG + Intronic
1176375856 21:6086627-6086649 TTGGCGGCTGTGGAGGCGAGTGG - Intergenic
1177062965 21:16396562-16396584 CAGGAGGCTTCCGAGGCGATCGG + Intergenic
1177102724 21:16916475-16916497 TACAGGGCTTCTGAGGCGATCGG - Intergenic
1179015236 21:37590234-37590256 TAGGGGGCTTCTGAGGCGATTGG + Intergenic
1179387605 21:40957432-40957454 TAGGGGGCTTCCAAGGTGATTGG - Intergenic
1179590454 21:42404559-42404581 TTTGGGGGTTTGGAGGAGATTGG + Intronic
1179747618 21:43451617-43451639 TTGGCGGCTGTGGAGGCGAGTGG + Intergenic
1180560990 22:16614112-16614134 CAGGGGACTTCCGAGGCGATCGG - Intergenic
1180988597 22:19920060-19920082 TAGGGGGCTCTGGCTGGGATGGG - Intronic
1182113998 22:27744470-27744492 CTGGGGGCTTCCGAGGCGATCGG - Intergenic
1183134735 22:35875761-35875783 TAGGGGGATAAGGAGGCGCTAGG - Intronic
949671200 3:6400162-6400184 TATGGGGCTTCTGAGGCAATCGG - Intergenic
949827487 3:8179493-8179515 TACGGGGCTTCCGAGGCAATCGG - Intergenic
952895172 3:38073887-38073909 TAGGGGGATTCTGAGGTGATCGG + Intronic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
953077085 3:39581027-39581049 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
953177241 3:40563462-40563484 TAGGGGGCTTCCGAGGTGATCGG - Intronic
955253413 3:57306165-57306187 TTAGGGGCTTCTGAGGCGATCGG - Intronic
956548944 3:70438090-70438112 TACGGGGCTTCTGAGGCAATCGG + Intergenic
957155065 3:76535879-76535901 CAGGGGGCTTCCGAGGTGATTGG + Intronic
957295284 3:78326289-78326311 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
957317263 3:78586370-78586392 CAGGGGGCTTCCGAGGCGATCGG + Intergenic
957394416 3:79620300-79620322 CAGGAGGCTTCCGAGGCGATCGG - Intronic
957451482 3:80387367-80387389 CAGGAGGCTTCCGAGGCGATCGG - Intergenic
957991720 3:87635026-87635048 TGGGGGGAGTTGGAGGTGATTGG - Intergenic
958676765 3:97276208-97276230 TAGGGGGCTTCCGAGGCGATCGG + Intronic
959002688 3:100982748-100982770 TAGGGGAGTTTGGAGAGGATGGG + Intronic
959288304 3:104443142-104443164 TAGGGGGCTCACGAGGCGATCGG + Intergenic
959972219 3:112420788-112420810 TAGGGGGCTCACGAGGCGATCGG + Intergenic
960282827 3:115796729-115796751 TAGGGGTCTTCCAAGGCGATCGG + Intergenic
960447756 3:117768579-117768601 TAATGGGCTTTGAAGGGGATGGG - Intergenic
961171842 3:124802708-124802730 TTGAGGGCCTTGGAGGCCATCGG - Intronic
961711575 3:128832415-128832437 TACGGGGCTTCCAAGGCGATCGG + Intergenic
961730633 3:128962182-128962204 TATGGGGCTTCCGAGGCGATCGG - Intronic
962205611 3:133431605-133431627 TGCGGGGCTTCTGAGGCGATCGG - Intronic
962523917 3:136221101-136221123 CAGGGGGCTTCCGAGGTGATCGG + Intergenic
962660682 3:137597960-137597982 TACGGGGCTTCCGAGGTGATCGG - Intergenic
963058670 3:141207450-141207472 TAGGGAGCTTCCGAGGTGATCGG - Intergenic
963456621 3:145554409-145554431 TACGGGGCTTCCGAGGTGATCGG + Intergenic
963520488 3:146356034-146356056 TAGGGGGCTTCCAAGGCTATCGG - Intergenic
963603990 3:147398517-147398539 TGGGGGGCTTTGGGGGCGAGCGG + Intronic
963684379 3:148416830-148416852 TAAGGGGCTTCCGAGGCAATCGG - Intergenic
965336377 3:167433701-167433723 TACGGGGCTTCTGAGGCGATCGG - Intergenic
965713454 3:171578900-171578922 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
966085477 3:176063821-176063843 TACGGGGCTTCCGAGGTGATCGG - Intergenic
966397697 3:179519344-179519366 TAGAGGGCTTTTGAGGTGATTGG - Intergenic
967005306 3:185377768-185377790 CAGGAGGCTTCCGAGGCGATCGG + Intronic
967152168 3:186660501-186660523 TACGGGGCTTCCAAGGCGATCGG - Intronic
967212119 3:187178757-187178779 TAGGGGGCTTCCGAGGCGATCGG + Intronic
967244125 3:187469499-187469521 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
967496269 3:190146987-190147009 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
967561428 3:190922592-190922614 TAGGGGGCTTCCAAGGTGATTGG - Intergenic
967643781 3:191898582-191898604 TAGGGGGCTTCTGAGGCGATTGG + Intergenic
968229173 3:196994474-196994496 AAAGGGGGTTGGGAGGCGATGGG + Intronic
969500632 4:7550453-7550475 CAGGCGGCTTTGGTGGTGATCGG + Intronic
970042132 4:11808759-11808781 TACGGGGCTTCCGAAGCGATGGG - Intergenic
970087588 4:12366248-12366270 TACGGGGCTTCCGAGGCAATTGG - Intergenic
970256375 4:14173754-14173776 TACGGGGCTTCTGAGGCAATCGG + Intergenic
971123140 4:23725250-23725272 CTGGGGGCTTCCGAGGCGATTGG + Intergenic
971180606 4:24325686-24325708 TACGGGGCTTCCGAGGCGATCGG - Intergenic
971200181 4:24503493-24503515 TACGGGGCTTCCGACGCGATCGG - Intergenic
971552695 4:27976450-27976472 CAGGGGGCTTCCGAGGTGATTGG - Intergenic
974173391 4:58294545-58294567 CAGGAGGCTTCTGAGGCGATTGG + Intergenic
974428353 4:61767526-61767548 TAGGGGGCTTCCGAGGCAATCGG + Intronic
975152173 4:71034014-71034036 CAGGAGGCTTCCGAGGCGATCGG - Intergenic
975933844 4:79557205-79557227 TAGGGGGCTTCCGAGGCTATCGG + Intergenic
976651710 4:87441859-87441881 CCGGGGGCTTTTGGGGCGATGGG + Exonic
976696585 4:87924347-87924369 TAGGGGGCTTTCGAGGCGATCGG - Intergenic
976884525 4:89968024-89968046 TAGGGGGCTTCTGAGGTGATCGG + Intergenic
977010362 4:91626563-91626585 TAGGGGGCTTCGGAGGCAATCGG - Intergenic
977012879 4:91657850-91657872 TAGGGGTCTTCCGAGGTGATCGG + Intergenic
977042038 4:92028141-92028163 CAGGGGGCTTCCGAGGCGATCGG - Intergenic
977075160 4:92442193-92442215 TAGGGGGCTTCCGAGGCGATCGG + Intronic
977198385 4:94087862-94087884 TATGGGGCTTCCGAGGTGATCGG + Intergenic
977217112 4:94296456-94296478 TACGGGGCTTCCGAGGCGATCGG + Intergenic
977782396 4:100995010-100995032 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
978001073 4:103556991-103557013 TAGGGGGCTTCCGAGGCAATCGG + Intergenic
979379986 4:119996404-119996426 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
979850263 4:125564864-125564886 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
980388973 4:132120679-132120701 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
980472394 4:133266920-133266942 TACGGGGCTTCCGAGGTGATAGG + Intergenic
980527913 4:134014657-134014679 TAAGGGGCTTCTGAGGCGATCGG - Intergenic
980611734 4:135170528-135170550 TACGGGGCTTCCGAGGCAATCGG + Intergenic
981525254 4:145701571-145701593 TAGGGGGCTTCTGAGGCGATCGG - Intronic
981539767 4:145835228-145835250 TAGGGGGCTTCTGAGGCGATCGG - Intronic
982083924 4:151815840-151815862 TAGAGGGCTTCCGAGGTGATCGG + Intergenic
982180438 4:152744560-152744582 CAGGGGGCTTCCGAGGCGATCGG + Intronic
982535490 4:156602765-156602787 CTGGGGGCTTCTGAGGCGATCGG - Intergenic
983023920 4:162711580-162711602 TAGGGGACTTCCGAGGCAATCGG - Intergenic
983345605 4:166523005-166523027 TACAGGGCTTCCGAGGCGATCGG - Intergenic
983360450 4:166718783-166718805 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
983414664 4:167439032-167439054 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
983452379 4:167925373-167925395 TAAGGGGCTTCCGAGGCGATTGG - Intergenic
983659617 4:170118933-170118955 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
984437308 4:179722929-179722951 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
984700714 4:182817001-182817023 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
985389823 4:189482691-189482713 GAGGGGGCTTCCGAGGTGATCGG + Intergenic
985582397 5:705268-705290 TACGGCGCTTCCGAGGCGATTGG - Intergenic
986388923 5:7266068-7266090 TACGGGGCTTCCGAGGCCATCGG - Intergenic
986905817 5:12492274-12492296 TACGGGGCTTCCGAGGCGATCGG - Intergenic
986919543 5:12665767-12665789 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
987282083 5:16422493-16422515 TGGGGGGCTTCCGAGGTGATTGG - Intergenic
987487545 5:18540792-18540814 TACGGGGCTTCTGAGGCGATTGG - Intergenic
987755871 5:22097328-22097350 TAGGGGGCTTCTGAGGCGATCGG - Intronic
989688858 5:44117962-44117984 CAGGAGGCTTTTGAGGTGATCGG + Intergenic
990514370 5:56518128-56518150 GAGGGGGCGATGGAGGCTATTGG - Intronic
991371857 5:65926641-65926663 TAGGTGGCTTTGGTGGGGGTTGG - Intronic
991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG + Intronic
992221753 5:74580444-74580466 AAGAGGGCTGTGGAGGTGATGGG - Intergenic
992394710 5:76359837-76359859 TACGGGGCTTCCGAGGCGATCGG - Intergenic
992960876 5:81955737-81955759 TAGAGGGCTTCCGAGGTGATCGG - Intergenic
993192759 5:84700958-84700980 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
994126063 5:96170116-96170138 TAGGGGGCTTCCGAGGCAATCGG + Intergenic
994295191 5:98081548-98081570 TATGGGGCTTCCAAGGCGATCGG - Intergenic
994532500 5:100987482-100987504 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
994775726 5:104034090-104034112 TACGGGGCTTCCGAGGTGATCGG - Intergenic
994854284 5:105097319-105097341 TAGGGGGCTGTTGGGGAGATTGG + Intergenic
995296717 5:110532324-110532346 TAGGGGGCTTCTGAGGCGATCGG - Intronic
996203214 5:120700818-120700840 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
996344774 5:122476832-122476854 TAGGGGGCTTCCGAGGCGATTGG + Intergenic
996574952 5:124969832-124969854 CAGGGGGCTTCTGAGGTGATCGG + Intergenic
997770585 5:136549552-136549574 TAGGGTGCTTCCGAGGCAATCGG + Intergenic
997772599 5:136568575-136568597 TAGGGGGCTTCCAAGGTGATCGG + Intergenic
998887048 5:146705735-146705757 TAGGGGGTTGGGGAGGGGATAGG + Intronic
998995436 5:147865758-147865780 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
998996356 5:147872214-147872236 TAGGGGGCTTCCGAGGTGATCGG + Intronic
999618823 5:153452937-153452959 TAGGGGGCTTCCAAGGCGATCGG + Intergenic
1000519365 5:162278627-162278649 TACGGGGCTTCCAAGGCGATCGG + Intergenic
1000802059 5:165740009-165740031 TAGGGGGGTTGGGAGGCAGTTGG - Intergenic
1000935595 5:167301118-167301140 TAGGGGGCTTCCGAGGTGATCGG + Intronic
1001331409 5:170765271-170765293 TACGGAGCTTCCGAGGCGATCGG + Intronic
1001354266 5:171004617-171004639 CAGGGGGCTTCCAAGGCGATGGG + Intronic
1001688099 5:173610807-173610829 TAGGGCCTTTGGGAGGCGATCGG + Intronic
1002523143 5:179802313-179802335 GAGTGGGCTTTGGAGGCCAACGG - Exonic
1002610913 5:180417953-180417975 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1002718982 5:181246625-181246647 TATGGGGCCTTGGGGGCAATTGG + Intronic
1004283476 6:14300183-14300205 TAGGGGGCTTCCGAGGCGATTGG + Intergenic
1004507951 6:16262224-16262246 TAGGGGGCTTCCGAGGCGATCGG + Intronic
1004575268 6:16888431-16888453 TAGGGGGCTTCTGAGGCAATCGG - Intergenic
1004768528 6:18757297-18757319 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1005014612 6:21364735-21364757 TATGGGGCTTCCGAGGCGATCGG + Intergenic
1006104188 6:31706788-31706810 CAAGGGGCTCTGGAGGGGATGGG - Intronic
1006292148 6:33146434-33146456 TTGGGGGCTTTGGGGGCCTTTGG + Intergenic
1008850164 6:56014047-56014069 TAGGGGGCTTCCAAGGCGATTGG + Intergenic
1009269862 6:61602585-61602607 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1010662357 6:78585867-78585889 TACGGGGCTTCTGAGGCGATCGG - Intergenic
1010826868 6:80485675-80485697 TACGGGGCTTCCGAGGTGATCGG + Intergenic
1010841268 6:80651029-80651051 TAGGGGGCTTCCAAGGCAATAGG + Intergenic
1011770895 6:90673440-90673462 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1012014346 6:93833306-93833328 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1012066498 6:94557172-94557194 TAGGGGGCTTCCGAGGTGATCGG + Intergenic
1012315869 6:97782081-97782103 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1012689618 6:102295408-102295430 TAGGGGGCTTCTGAGGCAATCGG - Intergenic
1013407844 6:109858993-109859015 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1013843637 6:114425566-114425588 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1013891749 6:115034362-115034384 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1014360116 6:120465504-120465526 TACGGGGCTTCTGAGGTGATCGG + Intergenic
1014454825 6:121623667-121623689 TAGGGGGCTTCCAAGGCGATCGG + Intergenic
1014555893 6:122842311-122842333 TAGGGGGCTTCCGAGGAGATCGG - Intergenic
1014614625 6:123585520-123585542 TAGGGGGCTTCCGAGGCGATTGG + Intronic
1014718942 6:124894520-124894542 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1014793943 6:125705089-125705111 TAGGGAGCTTCCGAGGCGATCGG + Intergenic
1015266783 6:131297934-131297956 TAGGGGGCTTCCGAGGGGATCGG - Intergenic
1015269701 6:131325875-131325897 TACGGGGCTTCCGAGGCGACCGG - Intergenic
1015287998 6:131507512-131507534 TAGGGGGCTTCCGAGGGGATCGG + Intergenic
1015323878 6:131904168-131904190 TAGGGGGCTTCCAAGGCAATCGG - Intergenic
1016114104 6:140260674-140260696 TATGGGGCTTCCGAGGTGATCGG + Intergenic
1017389549 6:153923967-153923989 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1017922786 6:158886260-158886282 CAGGGGGCTTCTGAGGCGATTGG + Intronic
1018077642 6:160230976-160230998 CAGGGGGCTTCCGAGGTGATTGG - Intronic
1018084450 6:160289803-160289825 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1018495358 6:164341965-164341987 TAGGGGGCTTCCGAGGCGATGGG + Intergenic
1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG + Intronic
1020532669 7:9356648-9356670 TAGGGGACTTCCGAGGCGATCGG + Intergenic
1021810706 7:24398749-24398771 TACGGGCCTTCTGAGGCGATCGG - Intergenic
1021977851 7:26027425-26027447 TACGGGGCTTCCGAGGCGATCGG + Intergenic
1022447443 7:30481704-30481726 CAGGAGGCTTCTGAGGCGATCGG - Intergenic
1022572747 7:31470255-31470277 TATGGGGCTTCTGAGGCGATCGG + Intergenic
1022710001 7:32841141-32841163 TACAGGGCTTCTGAGGCGATCGG + Intergenic
1022854667 7:34303130-34303152 AAAGGGGCTTTCGAGGTGATTGG + Intergenic
1024739204 7:52336869-52336891 CAGGAGGCTTTTGAGGCAATCGG + Intergenic
1024862508 7:53861964-53861986 TCTGGGGCTTTGGGGGCCATGGG - Intergenic
1027851993 7:83462143-83462165 TAGGGGGCTTCCGAGGTGATCGG - Intronic
1028670554 7:93396413-93396435 TAGGGGGCTTCTGAGGCGATTGG - Intergenic
1030441638 7:109595254-109595276 TACGGGGCTTCTGAGGCGATCGG + Intergenic
1031004713 7:116457966-116457988 TAGGGGGCTTCCGAGGCGATTGG - Intronic
1031355146 7:120780372-120780394 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1031400029 7:121318048-121318070 TACGGGGCTTCCGAGGCAATCGG - Intergenic
1031525637 7:122819403-122819425 TAGGGGGCTTCCAAGGCGATCGG - Intronic
1031685893 7:124731514-124731536 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1031776366 7:125912471-125912493 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033370669 7:140704572-140704594 TAGGGGGAAGTGGAGGCAATAGG - Intronic
1033675902 7:143540454-143540476 TAGGGGGCTTCCGAGGCGATTGG + Intergenic
1033695932 7:143788989-143789011 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
1034084786 7:148313282-148313304 TAGGGGGCTTCCGAGGTGATCGG + Intronic
1036281526 8:7404918-7404940 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1036339945 8:7906654-7906676 TAGGGGGCTTCTGAGGCGATCGG + Intergenic
1036549700 8:9805421-9805443 CACGGGGCTTCCGAGGCGATCGG - Intergenic
1038256223 8:25953739-25953761 GAGTGGGCTTTGGAGCCAATAGG - Intronic
1040862043 8:52008844-52008866 TTGGGGCCCTTGGAGGTGATTGG + Intergenic
1041917498 8:63151563-63151585 CAGGGGGCTTCCGAGGCGATCGG + Intergenic
1042453604 8:68975653-68975675 TAGGGGGCTTCCGAGGGGATTGG - Intergenic
1042707416 8:71677392-71677414 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1043353626 8:79389333-79389355 TCGGGGGCTTCTGAGGCGATCGG + Intergenic
1043970968 8:86527744-86527766 AAGGGGGCTTTGGGGGCTTTTGG + Intronic
1044148472 8:88745443-88745465 TAGGAGGCTTCTGAGGCAATCGG + Intergenic
1044417128 8:91950440-91950462 TACGGGGCTTCCGAGGCGATCGG - Intergenic
1044925206 8:97203397-97203419 TAGGGGGCTTCCGAGGCAATCGG - Intergenic
1045077895 8:98590365-98590387 TAGAGGGCTTCCGAGGCGATCGG + Intronic
1045197570 8:99946352-99946374 TAGGGGGCTTCCAAGGTGATCGG - Intergenic
1045644825 8:104288416-104288438 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1046386295 8:113512743-113512765 TAGAGGGCTTCCAAGGCGATCGG + Intergenic
1046440059 8:114243819-114243841 TACGTGGCTTCTGAGGCGATCGG - Intergenic
1046443292 8:114284467-114284489 TAGGGGGCTTCCGAGGTGATTGG - Intergenic
1046559323 8:115817080-115817102 TACGGGGCTTCCGAGGCGATCGG - Intergenic
1047856419 8:128916897-128916919 TAGGGGGCTTCCGAGGCGATTGG - Intergenic
1047911812 8:129538429-129538451 AAGTGGGATTTGGAGGAGATGGG - Intergenic
1048135511 8:131743204-131743226 TACGGGGCTTCTGAGGTGATCGG - Intergenic
1048168389 8:132083465-132083487 TAGGGGGCTTCCGAGGCAATCGG + Intronic
1049043398 8:140129578-140129600 CAGGGGGCAGTAGAGGCGATGGG + Intronic
1050896115 9:10887248-10887270 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1051849240 9:21488933-21488955 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1053134717 9:35643331-35643353 CAGGGGGCTTCCAAGGCGATTGG - Intronic
1053564629 9:39235982-39236004 TGGGGGGCTGGGGAGGAGATGGG + Intronic
1054132523 9:61383052-61383074 TGGGGGGCTGGGGAGGAGATGGG - Intergenic
1054807440 9:69407980-69408002 TACGGGGCTTCCGAGGCGATCGG + Intergenic
1055233110 9:74088142-74088164 TAGGGGGCTTCCGAGGCCATTGG - Intergenic
1055475475 9:76659058-76659080 TAGGTGGCTGTGGAGGGGCTCGG + Intronic
1055492079 9:76815547-76815569 TAGGGGACTAGGGAGGTGATTGG - Intronic
1055626770 9:78183290-78183312 TACGGAGCTTCCGAGGCGATCGG - Intergenic
1055810094 9:80139892-80139914 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1055881790 9:81011490-81011512 TACGGGGCTTCCGAGGCAATCGG - Intergenic
1056044692 9:82703948-82703970 TACTGGGCTTCCGAGGCGATTGG + Intergenic
1056061202 9:82886228-82886250 TACGGGGCTTCCAAGGCGATTGG - Intergenic
1056323932 9:85461125-85461147 TAGGGGGCTTCTGGGGCGATCGG - Intergenic
1056363754 9:85883168-85883190 TAGGCGGCTTCTGAGGCGATCGG - Intergenic
1056522492 9:87413405-87413427 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1056883024 9:90415055-90415077 TCGGGGGCTTCCGAGGCGATCGG - Intergenic
1057234892 9:93350088-93350110 TAGGGGGCTTCCAAGGCGATCGG - Intergenic
1057982128 9:99672641-99672663 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1058026164 9:100143921-100143943 TAGGGGGCTTCCGAGGCGATCGG + Intronic
1058612439 9:106790680-106790702 TACGGGGCTTCTGAGGCGATCGG - Intergenic
1059606660 9:115842432-115842454 TAGGGGGCTCCCGAGGCGATCGG + Intergenic
1059801165 9:117750819-117750841 CAGGTGGCTATGGAGGTGATTGG - Intergenic
1059863443 9:118488901-118488923 CAGGGGGCTTCTGAGGCGATTGG + Intergenic
1061583116 9:131549569-131549591 TAGGGGGCTTCTGAGGCGATCGG - Intergenic
1062451167 9:136616413-136616435 CAGGGGGCATGGGAGGCGCTGGG - Intergenic
1187086476 X:16047918-16047940 TAGGGGGCTTCTGAGGCAATCGG + Intergenic
1187103724 X:16220052-16220074 CAGGAGGCTTCTGAGGCGATCGG + Intergenic
1187223461 X:17353240-17353262 TAGGGGGCACTAGAGGAGATTGG + Intergenic
1188200927 X:27292370-27292392 CAGGGGGCTTCCAAGGCGATCGG + Intergenic
1188419531 X:29977754-29977776 TACGGGGCTTCCGAGGCGATTGG - Intergenic
1188431070 X:30105827-30105849 TACGGGGCTTCTGAGGCGATCGG - Intergenic
1188552699 X:31379984-31380006 TAGGGGGCTTCTGAGGCAATCGG - Intronic
1188891140 X:35611935-35611957 CAGGGGGCTTCCGAGGCAATAGG - Intergenic
1189031764 X:37458995-37459017 CAGGGGGCTTCCAAGGCGATCGG + Intronic
1190453921 X:50607406-50607428 TGGTGGGCTTTGGAGGACATCGG - Exonic
1191805765 X:65132865-65132887 TAGGAGGCTTCCGAGGTGATTGG + Intergenic
1192454634 X:71266666-71266688 CAGGAGGTTTTTGAGGCGATCGG - Intergenic
1192706186 X:73530149-73530171 TAAGGGGCTTCCAAGGCGATTGG - Intergenic
1193885973 X:86984279-86984301 TATGGGGCTTCCGAGGCGATCGG - Intergenic
1193941544 X:87684373-87684395 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1194293580 X:92103472-92103494 TACGGGGCTTCTGAGGCGATCGG + Intronic
1194351334 X:92826975-92826997 CTGGGGGCTTCCGAGGCGATCGG - Intergenic
1194367152 X:93025413-93025435 TAGGGGGCTTCCGAGGTGATCGG - Intergenic
1195435246 X:104836272-104836294 TGGGGGGCTGTGGAGGAGATGGG + Intronic
1196165589 X:112533096-112533118 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1196227174 X:113180026-113180048 TAGGGGGCTTCCGAGGCGATCGG + Intergenic
1196330871 X:114469247-114469269 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1196341671 X:114604528-114604550 TAGGGGGCTTCCGAGGCGATCGG + Intronic
1196496910 X:116333307-116333329 TAGGGGGCTTCTGAGGCAATCGG - Intergenic
1196533499 X:116815715-116815737 TAGGAGGCTTCCGAGGCGATCGG + Intergenic
1196572543 X:117281633-117281655 TAGGGGGCTTCCGAGGCGATCGG - Intergenic
1196773812 X:119321001-119321023 TACAGGGCTTTTGAGGTGATCGG + Intergenic
1197064962 X:122224515-122224537 TAGGGGGCTTCTGAGGCGATTGG - Intergenic
1197352011 X:125392075-125392097 TAGGGGGTTTCCGAGGTGATCGG + Intergenic
1199576521 X:149318140-149318162 TACGGGGCTTCCGAGGCAATCGG - Intergenic
1200611100 Y:5328018-5328040 TACGGGGCTTCTGAGGCGATGGG + Intronic