ID: 952902452

View in Genome Browser
Species Human (GRCh38)
Location 3:38119255-38119277
Sequence CACTTTGGACAGATTGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952902452 Original CRISPR CACTTTGGACAGATTGAGTT TGG (reversed) Intronic
901467158 1:9429548-9429570 GACTTGGGAGAGACTGAGTTTGG - Intergenic
901919293 1:12524995-12525017 CACTTTGGACACATTGAACATGG + Intergenic
903007472 1:20308320-20308342 CAGTGTGGGCAGATTGGGTTGGG + Intronic
905432427 1:37934176-37934198 CACTTTTGAGAGGTTGAGGTGGG - Intronic
910076537 1:83286560-83286582 CACCTTGGAGATACTGAGTTTGG - Intergenic
911979239 1:104545226-104545248 CAATTTGGACATATTGAATATGG - Intergenic
912559530 1:110539959-110539981 CACTCTTGACAGTTTGAGTAAGG - Intergenic
912654068 1:111469927-111469949 AATTTTGGACACATTGGGTTTGG - Intergenic
919796947 1:201326646-201326668 CAATTTGGAGAGGTTGAGTTTGG + Intronic
921741156 1:218686603-218686625 GACTTTGGATAGAATGACTTGGG - Intergenic
921998310 1:221446275-221446297 CACTTTGGGGAGACTGAGGTGGG - Intergenic
922190455 1:223314226-223314248 CCCTTTTGCCAGAGTGAGTTTGG - Intronic
923255379 1:232217365-232217387 AATTTTGGACATATTGAGTTTGG - Intergenic
923610501 1:235488371-235488393 CATTTTTGACAGATTGCCTTGGG - Intronic
924028619 1:239864817-239864839 CACTTTTTACCTATTGAGTTAGG + Intronic
924656740 1:245979389-245979411 CACTGTAGATAGAATGAGTTAGG + Intronic
1066296434 10:34057861-34057883 CACTTTGATCAGCTTGAGTGTGG + Intergenic
1066929135 10:41734951-41734973 CACTTTGAACACACTGATTTTGG + Intergenic
1066982447 10:42430703-42430725 AAGTTTGGAGTGATTGAGTTGGG + Intergenic
1067372017 10:45693598-45693620 AAGTTTGGAATGATTGAGTTGGG - Intergenic
1067387763 10:45832555-45832577 AAGTTTGGAATGATTGAGTTGGG + Intronic
1067418360 10:46124709-46124731 AAGTTTGGAATGATTGAGTTGGG - Intergenic
1070864986 10:79703108-79703130 CACTGTGCACAGTTTGAATTTGG + Intergenic
1070878775 10:79841239-79841261 CACTGTGCACAGTTTGAATTTGG + Intergenic
1071631881 10:87225329-87225351 CACTGTGCACAGTTTGAATTTGG + Intergenic
1071645336 10:87357549-87357571 CACTGTGCACAGTTTGAATTTGG + Intergenic
1074037724 10:109757552-109757574 CACTTTGGAAAGACAGAGATTGG + Intergenic
1075397458 10:122137927-122137949 GACTTTGGACAGAAGGAGGTGGG + Intronic
1081716474 11:45254083-45254105 CACTTTGGACTGTTGGGGTTGGG + Intronic
1082743412 11:56936448-56936470 CAGTTTGAAAAAATTGAGTTGGG + Intergenic
1085005601 11:73086160-73086182 CACTTTTGAGAGATAGAGGTGGG + Intronic
1086394880 11:86404504-86404526 GACTTCTGACAGATGGAGTTGGG + Intronic
1087411586 11:97797130-97797152 CAATTTGGACAAACAGAGTTGGG + Intergenic
1088474208 11:110218545-110218567 CTTTTTGGACAATTTGAGTTTGG - Intronic
1089006216 11:115093351-115093373 CACTGTGGACAGCTTGACTTTGG + Intergenic
1091047255 11:132335526-132335548 CTCTATGGACTGATTGAATTTGG - Exonic
1091288732 11:134424681-134424703 AACTGGGGACAGATAGAGTTGGG + Intergenic
1092753367 12:11739713-11739735 TATTTTGGCCACATTGAGTTAGG + Intronic
1092801606 12:12173729-12173751 CACTTTGGAAGGGTTGAGGTGGG - Intronic
1094487081 12:30933823-30933845 CTCTTGGTTCAGATTGAGTTGGG + Intronic
1100501264 12:95176181-95176203 CACTTTGGCAAGACTGAGGTGGG - Intronic
1101667274 12:106830538-106830560 TACTTTGGAGAGATTGAGAAGGG + Intronic
1103361591 12:120357750-120357772 CACTTTGGGGAGGTTGAGGTGGG - Intronic
1104288027 12:127443203-127443225 CCCTGTGGACATTTTGAGTTTGG + Intergenic
1105491189 13:20890201-20890223 CACTTTGGAGAGGCTGAGGTGGG + Intronic
1108581012 13:51828189-51828211 TACTTTAGCCAGCTTGAGTTGGG + Intergenic
1112426028 13:99302088-99302110 CACTGTGGGCACATTGATTTAGG - Intronic
1113176897 13:107575352-107575374 CTCTTTGACCAGATTGACTTTGG - Intronic
1113920968 13:113909858-113909880 CACTTTGGGCAGATTGCTTTAGG + Intergenic
1114284966 14:21232610-21232632 CACTTTGGGAGGCTTGAGTTGGG - Intronic
1115821606 14:37218688-37218710 CACTTTTGAGAGGCTGAGTTAGG + Intronic
1118656264 14:67953237-67953259 GAATTTGGACAGATTAAGATGGG + Intronic
1119835149 14:77742808-77742830 CACTTTGGGAAGGTTGAGGTGGG - Intronic
1121176329 14:91893149-91893171 CATTTTAGACAAAGTGAGTTGGG - Intronic
1124388893 15:29235169-29235191 CACTTTGAAAAGATTCAGGTAGG - Intronic
1124498636 15:30206779-30206801 CACTTGGAACACATTGTGTTTGG - Intergenic
1124744945 15:32331897-32331919 CACTTGGAACACATTGTGTTTGG + Intergenic
1125434721 15:39632422-39632444 CACTTTGGAGAGGCTGAGGTGGG - Intronic
1125483554 15:40096916-40096938 CATTTTGAAGAGATTGAGTGTGG - Intronic
1126945189 15:53811562-53811584 CACTTTGAATAGTTTGTGTTTGG + Intergenic
1128329942 15:66749076-66749098 CACTTTGGGGAGACTGAGATGGG + Intronic
1128406279 15:67342903-67342925 AAGTTTGGACAGGTTGAGTTGGG + Intronic
1128446217 15:67763554-67763576 CACCTTGGACAGGTTGTTTTTGG + Intronic
1131769879 15:95725625-95725647 CAATTTGGACATGTTAAGTTTGG + Intergenic
1134423774 16:14118553-14118575 CACTTTGGGGAAACTGAGTTGGG + Intronic
1135657549 16:24264289-24264311 CCCTTTGGATAGAGTCAGTTCGG - Intronic
1137401683 16:48158629-48158651 TACTTTGAACTGATGGAGTTTGG - Intergenic
1140645611 16:77026697-77026719 CACTTTTGAGAGATTGAGGTTGG - Intergenic
1146478526 17:33182778-33182800 CACTCTGCACAGTGTGAGTTAGG + Intronic
1148673572 17:49431755-49431777 CACTTTGGGCAGGTGGAGGTGGG - Intronic
1149732229 17:58957796-58957818 CACTTGGTACACATTTAGTTTGG + Intronic
1149755882 17:59185146-59185168 AACTTTGGACAAATAGAGTATGG + Exonic
1150873303 17:68939747-68939769 TTCTTAAGACAGATTGAGTTGGG + Intronic
1157674099 18:49555627-49555649 TACTTTGGACAGACTGAGTTAGG - Intergenic
1157969355 18:52248487-52248509 CACCTTGGACAGCTTCAGTTAGG - Intergenic
1158253925 18:55524015-55524037 CATGTTGGAAAGATTGATTTCGG - Intronic
1159037125 18:63288043-63288065 CATTTTGGACATTTTGATTTTGG + Intronic
1159296534 18:66497313-66497335 CACTTTTGAAAGAGTGAGTATGG - Intergenic
1161948131 19:7451659-7451681 CACTTTGGAGAGACCGAGGTGGG - Intronic
1165930028 19:39351541-39351563 GACTTAGGCCAGTTTGAGTTGGG - Intronic
1166269557 19:41705620-41705642 CTCTCTGGACAGCTTGAGTGAGG - Intronic
928660823 2:33500317-33500339 TAATTTGGAAAGATTGATTTGGG + Intronic
929204571 2:39276224-39276246 CAATTTGGTCATACTGAGTTTGG - Intronic
929216608 2:39420905-39420927 GATTTTGGACAGATTGATTGAGG - Intronic
931565026 2:63607289-63607311 CACTTTGGGAAGCTTGAGATGGG + Intronic
933375063 2:81468250-81468272 CATTTTGGACATGTTAAGTTTGG - Intergenic
937045989 2:118852198-118852220 CACTTTGGACAGAATTGCTTAGG - Intergenic
938582918 2:132663519-132663541 CACTTTGGGAAGCTTGAGGTAGG - Intronic
941940210 2:171028395-171028417 CATTTTTGACAGGTTGACTTTGG - Exonic
944854143 2:203750126-203750148 CACTTTGGACATGTTGAATTTGG + Intergenic
945702054 2:213184082-213184104 CAGTGTAGACAGGTTGAGTTTGG - Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946884119 2:224206006-224206028 CTCTTTCAAGAGATTGAGTTGGG - Intergenic
948606986 2:239142137-239142159 CACTCTGGACAGAGTGCGTATGG + Intronic
1168844019 20:930055-930077 GACTTTGGTCAACTTGAGTTTGG + Intergenic
1171234975 20:23517566-23517588 CACCTTAGACAGAATGTGTTTGG + Intergenic
1172356398 20:34283241-34283263 CACCTTGGACAGACAGAGCTAGG + Intronic
1174699955 20:52598069-52598091 CACTTTGGGAAGACTGAGGTGGG + Intergenic
1174700072 20:52599355-52599377 GACTTTGGACATACTGAGTTTGG - Intergenic
1177635464 21:23781897-23781919 CAGTTGGGCCAGATTTAGTTGGG - Intergenic
1181150643 22:20880911-20880933 TACTTTGGTCAGAAGGAGTTTGG + Intronic
1183304903 22:37077388-37077410 CACTGTGGCCAGATAGACTTAGG - Intronic
1183552469 22:38498670-38498692 CACTTTGGAGAGATGAAGCTGGG - Intronic
952902452 3:38119255-38119277 CACTTTGGACAGATTGAGTTTGG - Intronic
953318572 3:41951252-41951274 TGCTTTGGATAGATTGATTTTGG - Intronic
954465809 3:50654143-50654165 CACTCTGGACAGAGACAGTTGGG + Intergenic
956276251 3:67504572-67504594 GACTATGGACAGATTGGGTGAGG + Intronic
956534826 3:70264542-70264564 GACTTTGAACAAAGTGAGTTGGG + Intergenic
958053406 3:88379101-88379123 CTCTGTGGTCAGATTGACTTTGG - Intergenic
958284226 3:91717480-91717502 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958284423 3:91720370-91720392 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958293632 3:91871259-91871281 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958298977 3:91958261-91958283 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958301651 3:92001976-92001998 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958305215 3:92060672-92060694 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958315689 3:92232001-92232023 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958334949 3:92548135-92548157 CACTTTGGAAACACTCAGTTTGG + Intergenic
958346084 3:92730364-92730386 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958351090 3:92812355-92812377 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958361534 3:92984492-92984514 CACTTTGGAAACACTCAGTTTGG + Intergenic
958372282 3:93160057-93160079 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958384243 3:93355354-93355376 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958385127 3:93369805-93369827 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958388553 3:93425763-93425785 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958394893 3:93529591-93529613 CACTTTGGAAACAGTCAGTTTGG + Intergenic
958395774 3:93544056-93544078 CACTTTGGAAACAGTCAGTTTGG + Intergenic
962110822 3:132444900-132444922 CACTTTAGACATGTAGAGTTAGG + Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963347582 3:144113707-144113729 CACTTGAGTCAAATTGAGTTAGG + Intergenic
968352969 3:198077464-198077486 CTATTTGGACAGAATGAGCTTGG + Intergenic
970190438 4:13511096-13511118 CACTTTTGAGAGACTGAGGTGGG + Intergenic
971129498 4:23790742-23790764 CAGTTTAGACAGATTTGGTTTGG + Intronic
973076998 4:45941236-45941258 CACTTCTGACACCTTGAGTTTGG - Intergenic
973930462 4:55788662-55788684 TGCTTTGGACACAGTGAGTTTGG - Intergenic
977375428 4:96197134-96197156 CCCTTCTGACAGATTGGGTTAGG + Intergenic
986127485 5:4896631-4896653 TACTTGGGACAGATTTAATTTGG - Intergenic
986241165 5:5961177-5961199 TACTTAGGCCAGTTTGAGTTGGG + Intergenic
987865968 5:23539297-23539319 CACTTTTGACATATTTAATTTGG - Intergenic
988555284 5:32231192-32231214 CATTTTGGCCAGGTTGAGGTTGG - Intronic
991235389 5:64388800-64388822 CACTTTGGAAAGCCTGAGGTGGG - Intergenic
994638762 5:102378377-102378399 CACTTTGGGAAGCCTGAGTTGGG - Intronic
994809798 5:104500763-104500785 GACTTTGAACCAATTGAGTTAGG - Intergenic
999409921 5:151341836-151341858 TATTTTGGACAAGTTGAGTTTGG - Intronic
1000435971 5:161209182-161209204 CACTTTGGAAAGACTGGGCTGGG - Intergenic
1004778905 6:18882695-18882717 CACAATGGACAGAATCAGTTTGG - Intergenic
1006917499 6:37603943-37603965 CAGTTGGGACAGCTTGATTTGGG + Intergenic
1007217855 6:40254509-40254531 CACTTCAGGCAGATTGTGTTGGG + Intergenic
1008192143 6:48473156-48473178 CACTGTGGACTGATTGACATGGG - Intergenic
1009482068 6:64171656-64171678 CACTTAGGCCAGTTTGAGCTGGG - Intronic
1013725542 6:113091193-113091215 CACCTTCGAGAGATTGATTTAGG - Intergenic
1013867364 6:114714892-114714914 CACTCTGGTCAGAATGAGTAAGG - Intergenic
1014050282 6:116944770-116944792 CACTTTGAACAGTTTTAGTGTGG - Intergenic
1016447274 6:144146941-144146963 CATTTTGGACACATTCAGTTTGG + Intergenic
1016447340 6:144147644-144147666 CATTTTGGACACCTTCAGTTTGG - Intergenic
1017202604 6:151772309-151772331 AACTTTGGAGAGATTCAGATTGG - Intronic
1021400630 7:20206224-20206246 CACTATGGGCAGAATGACTTAGG - Intronic
1021639020 7:22720267-22720289 CAATTTGCACAGCTTGATTTAGG + Intergenic
1022517683 7:30986517-30986539 CAGTTTGGGCACATTGGGTTTGG + Intronic
1025959908 7:66210715-66210737 GAGTTTGGGCAGATTGAGGTGGG + Intronic
1026298379 7:69076130-69076152 CATTTTGGAAATATTGATTTGGG - Intergenic
1027294316 7:76751856-76751878 CACCTTGGAGATACTGAGTTTGG - Intergenic
1031588019 7:123556240-123556262 CATTTTGGACATGTTAAGTTTGG + Intronic
1034980951 7:155475951-155475973 CACTTTGGACACATACAGCTAGG + Intronic
1035324884 7:158058859-158058881 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324889 7:158058896-158058918 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324896 7:158058970-158058992 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324900 7:158059007-158059029 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324910 7:158059081-158059103 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324923 7:158059192-158059214 CACTGTGGGCAGATGGAGTGTGG - Intronic
1035324927 7:158059229-158059251 CACTGTGGGCAGATGGAGTGTGG - Intronic
1037523019 8:19698282-19698304 CACTTTGGAAACATTGTGTTTGG + Intronic
1039615776 8:38953939-38953961 CACTTTGCATAGGATGAGTTTGG + Intronic
1040017796 8:42714012-42714034 CCATTTGCACAGATTGAGTTTGG + Intronic
1040327711 8:46363791-46363813 CAGTTTGGAAACATTCAGTTTGG - Intergenic
1041860027 8:62502787-62502809 CACTTCGAACACATTGAATTTGG - Intronic
1041863218 8:62537830-62537852 CACTTTGGTCAGGTTGCTTTTGG + Intronic
1042317976 8:67444368-67444390 CATTTTGGACATGTTAAGTTTGG + Intronic
1043310285 8:78850546-78850568 CCCTTTGGACAGATTTCATTAGG + Intergenic
1044469649 8:92551420-92551442 CACCTTGGACATACTGAGATGGG + Intergenic
1046010645 8:108542686-108542708 CAGTTTGGATAGGCTGAGTTTGG + Intergenic
1048470928 8:134703567-134703589 CACTAGGGAGAGATTGAGTGGGG + Intronic
1050911728 9:11080187-11080209 ATCTTTGAACAGATTGAGTGTGG - Intergenic
1051491589 9:17672904-17672926 CACTTTAGACATTTTGAGTTGGG - Intronic
1052041137 9:23740431-23740453 CACTTTTGAAAGACTGAGTTTGG - Intronic
1057153186 9:92813390-92813412 CTATTTGGACAGAATGAGCTTGG - Intergenic
1060030069 9:120206893-120206915 CTCTTTGTACAGATTTAGGTGGG - Intergenic
1061752048 9:132785718-132785740 CACTGTGGACAGAATGAAATTGG - Intronic
1190571783 X:51790076-51790098 GACTATAGACAGGTTGAGTTTGG + Intergenic
1192123902 X:68482657-68482679 CACTTTGGAAGGCTTGAGGTGGG + Intergenic
1197945623 X:131835926-131835948 CCCTTGGGATAGATTGATTTGGG - Intergenic
1199496877 X:148462116-148462138 CACTTTTCACATCTTGAGTTGGG + Intergenic
1201336663 Y:12888632-12888654 CACTTTGGGCAGGCTGAGATGGG - Intergenic