ID: 952906421

View in Genome Browser
Species Human (GRCh38)
Location 3:38141893-38141915
Sequence CCATTAGGAAATAAGGCTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952906421 Original CRISPR CCATTAGGAAATAAGGCTCA AGG (reversed) Exonic
901228345 1:7627989-7628011 TTTTTAGGAACTAAGGCTCATGG + Intronic
902130179 1:14253495-14253517 GCATTTTGAAATAAGACTCATGG + Intergenic
902766188 1:18617212-18617234 CCATTAAGAAAGTAGACTCATGG + Intergenic
904250488 1:29220422-29220444 CATTTAGGAAATCAGGCGCAGGG + Intronic
905199131 1:36304715-36304737 AAATCAGGAAATAGGGCTCAGGG - Exonic
905783821 1:40736487-40736509 CCATTAGGAACTAATTCTGAGGG - Intronic
907971351 1:59384713-59384735 GGATGAGGAAATAAGGCTCAGGG - Intronic
909167929 1:72252342-72252364 CCTTTAAGAAGTAAGGCTGAAGG - Intronic
909925177 1:81430191-81430213 CCATTACAATATAAAGCTCATGG - Intronic
912625306 1:111201187-111201209 CCATCAGGAAAGAAGGCTATTGG - Exonic
914391029 1:147223555-147223577 CCAATAGGAAAGAAGGCTAAGGG + Intronic
917199247 1:172498081-172498103 CCATTAGGAGAGCAGGCTCTGGG - Intergenic
918937879 1:190947490-190947512 TCATTAGGAAATAAGCTTTAGGG + Intergenic
920668918 1:207988116-207988138 CCATTAGTTAATAAGCCTCATGG - Intergenic
921168707 1:212526470-212526492 CCATGAGGAAATGAGGCCCAGGG + Intergenic
922887959 1:229034762-229034784 CCATTATGAAATAATGATGATGG - Intergenic
1067538493 10:47134968-47134990 CAATCAGGAAAAAAGGCTAATGG - Intergenic
1069254443 10:66314288-66314310 CCATGATGAAATAAGGCCCAAGG + Intronic
1074079715 10:110157859-110157881 TCATTAGGGCATAAGCCTCATGG - Intergenic
1074531351 10:114300887-114300909 AGATGAGGAAATAAGGTTCAGGG - Intronic
1075529181 10:123213127-123213149 TCATTTGCAAATAAAGCTCAGGG - Intergenic
1075798493 10:125137317-125137339 CCCTTGGGAAATAAGGCTGAGGG - Intronic
1076289905 10:129337390-129337412 CCATGAGGAAATTAGTCTAAAGG - Intergenic
1077779211 11:5306764-5306786 CCATCAGGAAAGAAGTCTTAGGG - Intronic
1080878213 11:36295929-36295951 GCATTATGTAATAAGGGTCAGGG - Intergenic
1084431492 11:69113929-69113951 CCAGGAGGAAATGAGACTCATGG - Intergenic
1089123010 11:116153768-116153790 CCATTATGAAATAAACCTAAAGG - Intergenic
1090243512 11:125200224-125200246 CCATGAAGAAATAAGGCAAAGGG + Intronic
1091606075 12:1952672-1952694 ACAGTAGGACATCAGGCTCATGG - Exonic
1091912886 12:4245883-4245905 CCAATAGGAAAGCAGGCTCAGGG + Intergenic
1093808478 12:23464730-23464752 CCACTAGGGACTCAGGCTCAGGG - Intergenic
1101066566 12:101027714-101027736 CCACTAGGGGATAAGGCCCAGGG - Intronic
1102783066 12:115582450-115582472 TCATTAGGATATAAGCCTCTTGG - Intergenic
1106396875 13:29388953-29388975 CCATTAGGAAATACTGCTGGGGG - Intronic
1107458268 13:40575723-40575745 CAAGTAGGCATTAAGGCTCAAGG + Intronic
1110820597 13:79910799-79910821 ACAATAGCAAATAAGGCTTAAGG + Intergenic
1114339167 14:21724801-21724823 CCATTAAAAAATTAGGTTCATGG + Intergenic
1115731872 14:36278327-36278349 CACTTTGGAAATAAGGCTTAGGG + Intergenic
1118965995 14:70586147-70586169 CCCTAAGGAAATAAGACTCTGGG - Intronic
1119421608 14:74510758-74510780 CCCTCAGGAAGAAAGGCTCAGGG - Intronic
1120520962 14:85528162-85528184 CGAATAGGAAATGTGGCTCAGGG - Intergenic
1126670543 15:51111569-51111591 CCATCAGGAAAACAGGGTCATGG - Intergenic
1126810983 15:52403798-52403820 CCATTAGGAAAAGAGGCTGGGGG + Intronic
1126839023 15:52697815-52697837 AAATTATGAAATAAAGCTCACGG + Intronic
1128318848 15:66678761-66678783 ACATGAGGAAATAAGGATCTTGG + Intronic
1129937715 15:79464528-79464550 CCATCTGGCAATAAGTCTCATGG + Intronic
1132625703 16:890490-890512 CCATCAGGACATCAGGCTCATGG + Intronic
1133659484 16:7902669-7902691 TCATTAGGAAAGAAGGATCCTGG + Intergenic
1134759472 16:16701301-16701323 AGATGAGGAAATAAGGGTCATGG - Intergenic
1134986598 16:18657893-18657915 AGATGAGGAAATAAGGGTCATGG + Intergenic
1137985897 16:53107844-53107866 CCATTAGAAAATAAGCTTCAGGG - Intronic
1138161830 16:54761673-54761695 CCCTTAGGAAAGAAGGTCCAGGG - Intergenic
1138202210 16:55097951-55097973 CCAATAGGAAATCAGGCAGATGG + Intergenic
1138886094 16:61080938-61080960 GCATTAGGAAAAAAAGCTGACGG + Intergenic
1140805970 16:78532754-78532776 ACAATAGCAAATAAGTCTCAAGG - Intronic
1141120485 16:81351272-81351294 ACATTAGAAAATAAGCCTAAAGG + Intronic
1141158527 16:81613269-81613291 CCATGGAGAAATAATGCTCACGG + Intronic
1143112620 17:4560698-4560720 CCATTAGGACACAAGGCCCGAGG + Exonic
1143507971 17:7380030-7380052 CCTTTATTAAATAAGGCTCTGGG + Intergenic
1144417664 17:15067095-15067117 CCATCAGTAAATTAGGCTTATGG + Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1146648704 17:34592742-34592764 CCATTATGAAATAATGATTATGG - Intronic
1147211089 17:38872808-38872830 CCTTTGGGAGATAAGGCTCAGGG - Intronic
1149928924 17:60730177-60730199 CCTTTAGAAAATCAGGCTGAAGG + Intronic
1150872207 17:68924685-68924707 CCATCAGGTAATAAGGCTGCAGG - Exonic
1151858431 17:76739240-76739262 GAACTAGGAAATTAGGCTCACGG - Intronic
1153153699 18:2125317-2125339 CCTTTAGGAAATAATTTTCAGGG - Intergenic
1153675610 18:7453687-7453709 CCAGTAGGAACTTAGGCTCAGGG - Intergenic
1155650664 18:28137336-28137358 CCATTTGGAAAGAAGTCTAAAGG + Intronic
1156469141 18:37366658-37366680 CCATTAGGCAAGGAGGGTCAGGG + Intronic
1158633387 18:59135335-59135357 CCATGATGAAGCAAGGCTCATGG - Intergenic
1162023823 19:7882131-7882153 CCATGAGGACATCATGCTCAGGG + Intergenic
1166601900 19:44103628-44103650 CCATTTGGAAATAAGTATAAAGG + Intronic
925559041 2:5167873-5167895 CTATTAGAAAATGAGGTTCATGG + Intergenic
926406814 2:12562027-12562049 CCATCATGAAATAAGGCTTTAGG + Intergenic
927607216 2:24497092-24497114 AAATGAGGAAACAAGGCTCAGGG + Intronic
928124266 2:28605089-28605111 CATTTAGGAAATAAGGGACAGGG + Intronic
929296011 2:40247549-40247571 AAATGAGGAAAAAAGGCTCAGGG + Intronic
929873219 2:45775176-45775198 TCATAAGGAACTAAGGCTCTTGG + Intronic
931785969 2:65619740-65619762 CCATGAGAAACTAAGGCTCAGGG - Intergenic
932819124 2:74884737-74884759 CCACCAGGAAACAAGCCTCAGGG - Intronic
933735522 2:85490878-85490900 CAATGTGGAAATAAGGTTCATGG - Intergenic
937342511 2:121100270-121100292 CGATGAGTAAATGAGGCTCAGGG + Intergenic
937370123 2:121291486-121291508 CCATTGGAAAATAGGGTTCAAGG - Intergenic
939307072 2:140425752-140425774 ACTTAAGGAAATAAAGCTCAGGG - Intronic
939514619 2:143151249-143151271 CCTTTATGAAATAAGGTTCTAGG - Intronic
940538068 2:154971717-154971739 CTAATAGGAAAAAAGGCACAAGG - Intergenic
945076498 2:206044866-206044888 CCATTAGGAAGTATGACTGATGG + Intronic
945439752 2:209864592-209864614 CCATTAGAAAAGAGGGGTCAGGG + Intronic
945535891 2:211017466-211017488 CCTTTAGGGGATAATGCTCATGG + Intergenic
945558969 2:211314530-211314552 GCCTTAGAAAAAAAGGCTCATGG + Intergenic
947950655 2:234144239-234144261 CCATCAGGACAGGAGGCTCATGG + Intergenic
948307729 2:236962063-236962085 CAAGTAGAAAAGAAGGCTCAGGG - Intergenic
1170743556 20:19078794-19078816 GCATTAGGAGGTAAGGCTCTTGG + Intergenic
1176104295 20:63378541-63378563 GCATTAGGAAATAAGGAACGGGG + Intergenic
1177261691 21:18737642-18737664 CCATTTGTTAATAAGGCTCAAGG + Intergenic
1180579369 22:16816274-16816296 CAATTAGAAAAAAAGGTTCAGGG - Intronic
1182529907 22:30947228-30947250 CCTTTTGGAAATCAGCCTCAAGG - Intronic
1183478948 22:38052466-38052488 CCATTAGGAAAGACAGCTCCTGG - Intergenic
951356268 3:21670795-21670817 CCATAAGGAAGAAAGGCTAATGG - Intronic
952233643 3:31456589-31456611 AAATCAGGAAATAGGGCTCAGGG - Intergenic
952906421 3:38141893-38141915 CCATTAGGAAATAAGGCTCAAGG - Exonic
956507099 3:69953430-69953452 CCATTGGGAATTAATACTCAAGG + Intronic
958270124 3:91489359-91489381 CCATTAGTCAATAAGGCACCTGG - Intergenic
960423743 3:117480962-117480984 CCTTTAGGAAACAAGGCCCTAGG - Intergenic
962953190 3:140240497-140240519 CCATGAGTAAATGAGCCTCAGGG - Intronic
963315044 3:143750012-143750034 CTATTCGCAAATAAGGATCATGG - Intronic
963803655 3:149701408-149701430 AAATTAGGAAATAGGGCTCAGGG - Intronic
965612676 3:170561390-170561412 CCAGTAGGACCTAAGGCTTAAGG - Intronic
965655434 3:170978383-170978405 GCATTAGGAAAACAGCCTCAGGG + Intergenic
967237640 3:187402019-187402041 CCGTTAGGAAAGCAGGATCATGG - Intergenic
967518273 3:190397753-190397775 TCATTAGGTATTAATGCTCAGGG - Intronic
969182206 4:5450911-5450933 CCATTAGCAAGTAAGGCCAATGG + Intronic
970519668 4:16869918-16869940 CAAGTAGGAAAACAGGCTCAAGG - Intronic
974163527 4:58170520-58170542 CCATTAGAAAGTAAGATTCATGG + Intergenic
974941695 4:68477216-68477238 CAATTTGATAATAAGGCTCAGGG - Intronic
975186970 4:71414744-71414766 CCATTAGGAAAGAAAGGTTATGG - Intronic
978114150 4:104999323-104999345 AAATGAGGAAATAAGACTCAGGG + Intergenic
980019069 4:127686750-127686772 CCATTAGAACATAAGCTTCATGG + Intronic
981202271 4:141994624-141994646 CCATTATGAAAGAAGACTGAAGG + Intergenic
982607519 4:157533405-157533427 GGCTTATGAAATAAGGCTCATGG + Intergenic
983500356 4:168492857-168492879 CCACCAGGAAACAAGGATCACGG - Intronic
987829145 5:23073775-23073797 GCATTAGGAAATAAGGGCCCAGG - Intergenic
989624012 5:43412363-43412385 CGATCAGGAAATGAGGCTAAAGG + Exonic
989775148 5:45197603-45197625 CCTTTCAGAAAAAAGGCTCAAGG + Intergenic
993525024 5:88954724-88954746 CCATTTGGAAGTAAGTCTCTTGG - Intergenic
994679792 5:102871987-102872009 GCTTTAAGAAATTAGGCTCAAGG - Intronic
994726352 5:103440895-103440917 CCATTAGAAAATAAAACACAAGG + Intergenic
995062491 5:107826351-107826373 CCATCAGAAAACAAGGCCCATGG - Intergenic
995160393 5:108973741-108973763 CCATTAGGAAGTATCCCTCATGG - Intronic
1004608278 6:17214404-17214426 CAATGAGGAAATCAGGCTTAGGG + Intergenic
1008985035 6:57531979-57532001 CCATTAGTCAATAAGGCACCTGG + Intronic
1009322919 6:62313751-62313773 CGATTAGGAAAAAATGCTAAGGG + Intergenic
1010600051 6:77813653-77813675 CCCAAAGGAAATAATGCTCAGGG - Intronic
1010698430 6:79008517-79008539 CCAAAAGAAAATAAGCCTCAAGG - Intronic
1014514035 6:122360234-122360256 CCTATAGGAATTAGGGCTCAAGG + Intergenic
1017597084 6:156040195-156040217 CCATAAGGAAAAAAAGATCAGGG - Intergenic
1018308543 6:162484298-162484320 TCATTAGGGAATAAGTGTCAAGG + Intronic
1023135013 7:37042699-37042721 ACAGTTGGAAATGAGGCTCATGG - Intronic
1026762645 7:73137997-73138019 CAATTAGGCAACATGGCTCAAGG - Intergenic
1027039112 7:74947784-74947806 CAATTAGGCAACATGGCTCAAGG - Intergenic
1027084532 7:75254593-75254615 CAATTAGGCAACATGGCTCAAGG + Intergenic
1029392110 7:100282403-100282425 CAATTAGGCAACATGGCTCAAGG + Intergenic
1030842784 7:114376709-114376731 CCATTCGGAACTAACACTCAGGG + Intronic
1032413264 7:131715849-131715871 CCATTCGGAAATCAGACTTATGG + Intergenic
1033837738 7:145335777-145335799 CCATTATGAAATAGCCCTCATGG - Intergenic
1036284030 8:7427911-7427933 CTCTTAGGAAGAAAGGCTCAAGG - Intergenic
1036337446 8:7883619-7883641 CTCTTAGGAAGAAAGGCTCAAGG + Intergenic
1037440583 8:18912162-18912184 ACATTATGAAATAAGGATCTGGG - Intronic
1037897351 8:22666784-22666806 CCATCATTAAATAAGGCACATGG - Intronic
1043406018 8:79933704-79933726 CTATTAGGAAAGAAGTATCAAGG + Intronic
1044290270 8:90460244-90460266 TATTTAGGAAACAAGGCTCAAGG + Intergenic
1044757000 8:95473986-95474008 CCATGAGAAAAGAAGGCTCAGGG - Intergenic
1044934586 8:97280652-97280674 ACATGATGAAAAAAGGCTCAAGG - Intergenic
1048697919 8:137049346-137049368 CTAATAGGTATTAAGGCTCAAGG + Intergenic
1049558210 8:143294185-143294207 CCATTTAGAAAAAAGGCTTAAGG - Intronic
1051213095 9:14766145-14766167 GGATAAGGAAATAAAGCTCAAGG - Intronic
1054347095 9:63978044-63978066 ACATGAGGGAAAAAGGCTCAGGG + Intergenic
1054444827 9:65304383-65304405 ACATGAGGGAAAAAGGCTCAGGG + Intergenic
1054485444 9:65717122-65717144 ACATGAGGGAAAAAGGCTCAGGG - Intronic
1055013006 9:71587553-71587575 CCATTAGAGAAGAAGGCACAGGG + Intergenic
1059294825 9:113260958-113260980 ACATTAGAAAATAAGGTCCAGGG + Exonic
1059603920 9:115812648-115812670 CTTTAAGGAAATAGGGCTCAGGG - Intergenic
1061892760 9:133631396-133631418 AGATGAGGAAAGAAGGCTCAGGG + Intergenic
1062009255 9:134258439-134258461 CCTTCTGGAAATACGGCTCAGGG + Intergenic
1062108910 9:134771372-134771394 CCTTCCGGAAACAAGGCTCATGG - Intronic
1192823132 X:74665651-74665673 ACATTAGTAAACATGGCTCAAGG + Intergenic
1193719649 X:84972105-84972127 CCATCAGGAAATAATTTTCATGG + Intergenic
1194703218 X:97141168-97141190 CCATCAGAAAATAATTCTCAAGG - Intronic
1195974969 X:110516810-110516832 CAATCAGGAAACAAGGCTGAAGG - Intergenic
1196055867 X:111354426-111354448 ACATAAAGAAATAAGGCTGATGG + Intronic
1198217743 X:134571571-134571593 ACATTAAGAAATAGAGCTCATGG - Intronic
1199867244 X:151863272-151863294 CCATTGGGAAAGATGGCTCCTGG + Intergenic
1199995269 X:153020652-153020674 CCATTAGGAAATAAGTATGGAGG + Intergenic
1200759169 Y:7021079-7021101 CAATAAGGGAATAAGGTTCAAGG + Intronic
1202578411 Y:26352220-26352242 TCATTAGGAAATAAATTTCAAGG - Intergenic