ID: 952906826

View in Genome Browser
Species Human (GRCh38)
Location 3:38144918-38144940
Sequence AACCTTTGATCACTTTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 820
Summary {0: 1, 1: 0, 2: 3, 3: 102, 4: 714}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952906826 Original CRISPR AACCTTTGATCACTTTTGAT GGG Intergenic
901971553 1:12912753-12912775 ATCCTTTAATCACTTTTTGTTGG - Intronic
902013614 1:13288987-13289009 ATCCTTTAATCACTTTTTGTTGG + Intergenic
903091058 1:20917717-20917739 AATATTTGATCACTTTTAACAGG - Intronic
905498146 1:38412442-38412464 ATCTTTTGCTCACTTTTTATTGG - Intergenic
905801462 1:40846564-40846586 ATCCTTTGCTCACTTTTTAATGG + Intergenic
906369859 1:45243778-45243800 ATCCTTTGCTCACTTTTTAATGG - Intronic
906570579 1:46834874-46834896 AACCCTTGTGCACTGTTGATGGG - Intergenic
906882017 1:49602018-49602040 ATCCTTTGCCCATTTTTGATGGG - Intronic
906883615 1:49620287-49620309 ATCCTTTGCCCATTTTTGATGGG - Intronic
908287902 1:62628905-62628927 AACCTTTGCTCATTTTTTAATGG - Intronic
908301936 1:62770674-62770696 AACCCTTGAACACTGTTGATGGG - Intergenic
908598680 1:65715506-65715528 AACCTTTGTACACTGTTGGTGGG - Intergenic
908600887 1:65738687-65738709 ATCCTTTGCCCACTTTTTATTGG + Intergenic
909431568 1:75593366-75593388 AACCCTTGTACACTTTTGGTGGG + Intronic
909818997 1:80034835-80034857 AACCCTTGAGCACTGTTGGTGGG - Intergenic
909890107 1:80994739-80994761 AACTTTTGTTCAATTCTGATTGG - Intergenic
910138567 1:84000108-84000130 TACCTTTAATCACATTTTATAGG - Intergenic
910628183 1:89330752-89330774 ATACTTTGCCCACTTTTGATGGG - Intergenic
911028813 1:93464112-93464134 AACCCTTGTGCACTTTTGGTAGG + Intronic
911170238 1:94763780-94763802 ATCCTTTGCCCAATTTTGATGGG - Intergenic
911277123 1:95875915-95875937 AACCTTTAATCTTTTTTGAATGG + Intergenic
911600187 1:99840186-99840208 AATCTTTGTGCACTGTTGATGGG + Intergenic
911961379 1:104307472-104307494 AACCCTTGTGCACTGTTGATGGG + Intergenic
912034260 1:105291471-105291493 ATCCTTTGCCCATTTTTGATGGG + Intergenic
912043509 1:105421574-105421596 AACCTTTCCTCATTTTTAATTGG - Intergenic
912127876 1:106562688-106562710 AACCCTTGTACACTGTTGATAGG + Intergenic
914560693 1:148816393-148816415 AACCCTTGTACACTGTTGATGGG - Intronic
914612141 1:149313822-149313844 AACCCTTGTACACTGTTGATGGG + Intergenic
914935840 1:151979603-151979625 CACCTCTGGTCACTGTTGATAGG - Intergenic
915382003 1:155450579-155450601 AACATTTGTACACTGTTGATGGG + Intronic
916645350 1:166779385-166779407 ATCCTTTGCCCATTTTTGATGGG + Intergenic
916714353 1:167436857-167436879 AACCCTTGAACACTCTTGGTGGG + Intronic
917020094 1:170577335-170577357 AACCCTTGATCATTGTTGGTGGG - Intergenic
917135775 1:171786882-171786904 AAGCTTTGATCCTTCTTGATAGG + Intronic
917211870 1:172639905-172639927 AACCTTTGGGCACATTTTATTGG - Intergenic
917302845 1:173595439-173595461 AACTTTTGTACACTTTTTATTGG + Intronic
917919318 1:179736878-179736900 AACCTTTGTACACTGTTGGTTGG + Intergenic
918801757 1:188981404-188981426 ATCCTTTGCTCATTTTTGATGGG + Intergenic
918867197 1:189917376-189917398 ATCCTTTGCTCACTTTTTAAAGG + Intergenic
919040773 1:192385408-192385430 AACCTCTGTGCACTTTTGTTGGG + Intergenic
919059626 1:192615173-192615195 AACCCTTGTACACTCTTGATGGG - Intergenic
919445796 1:197703683-197703705 AAACTTCAATCAATTTTGATGGG + Intronic
919492896 1:198227689-198227711 ATCCTTCGCCCACTTTTGATGGG + Intronic
919855100 1:201700256-201700278 ATCCTTTGCCCACTTTTGATGGG - Intronic
920836254 1:209513776-209513798 AAGCTTTGATCCCTTTTAACAGG + Intergenic
921186020 1:212670091-212670113 GGCTTTTGATCATTTTTGATTGG - Intergenic
921455121 1:215361884-215361906 AACCCTTGCACACTGTTGATGGG - Intergenic
922147556 1:222963095-222963117 ATCCTTTGCCCAATTTTGATGGG - Intronic
922893970 1:229086396-229086418 AACCCTTGTTCAGTGTTGATTGG + Intergenic
923175450 1:231459714-231459736 AATCTTTGTACACTGTTGATGGG + Intergenic
923421504 1:233820471-233820493 AACCTTTGTGCACTGTTGGTAGG - Intergenic
923440592 1:234016177-234016199 AACCCTTGTGCACTGTTGATGGG + Intronic
923910976 1:238443310-238443332 AACAGTTGACTACTTTTGATTGG + Intergenic
924510264 1:244724168-244724190 AACCCTTGTTCACTGTTGGTGGG + Intergenic
924649065 1:245906522-245906544 AACCCTTGTACACTGTTGATGGG + Intronic
1062869354 10:886339-886361 AACCTTTGCACACTGTTGGTGGG + Intronic
1062973652 10:1666864-1666886 AACCCTTGGTCAACTTTGATGGG - Intronic
1064241795 10:13636829-13636851 AACCTTTGTACACTTTAAATGGG - Intronic
1064497885 10:15933724-15933746 AACCCTTGTTCACTGTTGGTGGG - Intergenic
1064597176 10:16957608-16957630 AACCTTTACACACTATTGATGGG + Intronic
1065090066 10:22222930-22222952 AACCTTTGTGCACTGTTGATGGG - Intergenic
1065194144 10:23245734-23245756 AACCCTTGCACACTGTTGATGGG + Intergenic
1065200247 10:23305707-23305729 AACCCTTGTGCACTGTTGATGGG + Intronic
1065566093 10:27011449-27011471 AACTTTTGACCATTTTTGACTGG - Intronic
1065978702 10:30868423-30868445 AACTTATGATTACTTTTGTTTGG - Intronic
1066101722 10:32123625-32123647 AACAGTTGGTCACCTTTGATTGG - Intergenic
1066152182 10:32634829-32634851 AAGCTTTAATACCTTTTGATTGG + Intronic
1066393344 10:34996512-34996534 AACAGTTGACCACATTTGATTGG + Intergenic
1066599462 10:37089101-37089123 ATCCTTTGCCCACTTTTGATGGG + Intergenic
1067032476 10:42887562-42887584 AACCCTTGTCTACTTTTGATGGG - Intergenic
1068002454 10:51351576-51351598 ATCCTTTGCTCACTTTTCAATGG + Intronic
1068185327 10:53577886-53577908 ATCCTTTGCTCACTTTTTAATGG - Intergenic
1068240117 10:54293638-54293660 AGCCTTTGACCACTTTTTAATGG - Intronic
1068296119 10:55074533-55074555 GTCCTTTGATCACTTTTTAATGG + Intronic
1068697796 10:59986851-59986873 AACCCTTGTACACTGTTGATGGG - Intergenic
1068703463 10:60046286-60046308 AAACTTTCATTACTTTTTATTGG - Intronic
1069162066 10:65105053-65105075 AACCTTTGCCCACTTTTCAATGG - Intergenic
1069213781 10:65794240-65794262 AACAGTTGGCCACTTTTGATTGG - Intergenic
1070474438 10:76818123-76818145 ATCCTTTGCTCACTTTTTAATGG + Intergenic
1070673557 10:78395762-78395784 ATCCTTTGCCCACTTTTAATTGG + Intergenic
1072091718 10:92135331-92135353 ATCCTTTGCCCACTTTTTATTGG - Intronic
1072387447 10:94945685-94945707 ATCCTTTGTCCATTTTTGATGGG - Intronic
1072678348 10:97485855-97485877 AACCTTTGTACACTGTTGGTGGG + Intronic
1072775769 10:98191474-98191496 ATCCTTTGCCCGCTTTTGATGGG + Intronic
1072878536 10:99201746-99201768 AACCTTTGATCCCTTTTCTGAGG - Intronic
1073604196 10:104877344-104877366 AAACATTGATCACTGTGGATTGG - Intronic
1073702089 10:105938505-105938527 AACCCTTGAACACTGTTGGTGGG + Intergenic
1073823749 10:107295734-107295756 AACATTTGTACACTATTGATGGG + Intergenic
1073880017 10:107970303-107970325 AACCTTTGAGATCTTTTAATTGG + Intergenic
1074304086 10:112260504-112260526 AACCTTTGTACACTGTTGGTGGG + Intergenic
1074494333 10:113966355-113966377 AATCTTTGTGCACTGTTGATGGG - Intergenic
1075968642 10:126634010-126634032 AACCTTTGCACACTGTTGGTGGG + Intronic
1079687319 11:23376040-23376062 AACCCTTGAACACTCTTGGTGGG + Intergenic
1079696586 11:23489345-23489367 ATCCTTCGCCCACTTTTGATGGG - Intergenic
1079804835 11:24917154-24917176 ATCCTTTGCCCAATTTTGATGGG + Intronic
1079900247 11:26174095-26174117 ATCCTTTGCCCATTTTTGATGGG - Intergenic
1080215439 11:29834673-29834695 ATCCTTTGCCCACTTTTAATGGG - Intergenic
1080647371 11:34196873-34196895 ATCATTTGATCACTTTTGAATGG + Intronic
1081216795 11:40409761-40409783 AATCCTTGAACACTGTTGATGGG + Intronic
1082240966 11:49870214-49870236 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1082285409 11:50312497-50312519 ATCCTTTGCCCACTTTTGATGGG + Intergenic
1082938971 11:58683889-58683911 AACCTTTGCCCAATTTTGATGGG - Intronic
1083030532 11:59587708-59587730 AACCTTTGTGCACTGTTGGTGGG + Intronic
1083095779 11:60249597-60249619 ATCCTTTGACCACTTTTTGTTGG + Intergenic
1083127575 11:60586984-60587006 AACCTTTGTACACTGTTCATGGG + Intergenic
1083790460 11:64981742-64981764 AACCCTTGAACACTGTTGGTGGG - Intergenic
1085106922 11:73852627-73852649 AACCTTTATACACTGTTGATGGG + Intronic
1085888105 11:80545143-80545165 AATGTTTGCTCACTTTTGATTGG - Intergenic
1086247511 11:84771436-84771458 ATCTTTTGCTCACTTTTAATGGG + Intronic
1086860964 11:91924497-91924519 AAATTTTAATCACTTTTAATTGG - Intergenic
1087293748 11:96345740-96345762 ATCCTTTGCCCACTTTTTATGGG + Intergenic
1087422698 11:97950234-97950256 ATCCTTTGCCCATTTTTGATGGG + Intergenic
1087503244 11:98986858-98986880 ATATTTTGACCACTTTTGATTGG - Intergenic
1087617396 11:100503863-100503885 AACCCTTGTACACTTTTGATTGG + Intergenic
1088403338 11:109444831-109444853 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1088524919 11:110742050-110742072 AACATTTGTTCACTTGTGGTGGG - Intergenic
1089841582 11:121423460-121423482 AACCTTTGTGCAATCTTGATGGG - Intergenic
1090535941 11:127641737-127641759 AACATTTTATTACTTATGATTGG + Intergenic
1090567578 11:128011905-128011927 AACCTTTGCCCACTTTTTAATGG - Intergenic
1090597984 11:128340032-128340054 AACTTTTGTTCACTGTTGGTGGG + Intergenic
1091594562 12:1867995-1868017 AACCTTTGTACACTGTTGGTGGG + Intronic
1092452613 12:8617110-8617132 AACCTTTGTACACTGTTGGTGGG - Intergenic
1092465738 12:8729816-8729838 AACCCTTGTACACTCTTGATGGG - Intronic
1092498299 12:9020282-9020304 AAAATTTGATAAGTTTTGATAGG + Intergenic
1092511446 12:9161060-9161082 ATTCTTTGACCACATTTGATGGG + Exonic
1093717979 12:22405342-22405364 ATCCTTTGCCCACTTTTGATGGG - Intronic
1093891264 12:24524697-24524719 AACTTTTGTACACTGTTGATGGG + Intergenic
1095187080 12:39213051-39213073 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1095196922 12:39330303-39330325 AACATTGGATCTGTTTTGATTGG - Intronic
1095387203 12:41665020-41665042 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1095489714 12:42720677-42720699 GTCCTTTGCCCACTTTTGATGGG + Intergenic
1095823869 12:46510710-46510732 AACCTTTACACACTGTTGATGGG - Intergenic
1096040786 12:48514735-48514757 AACCTTTGTACATTGTTGATGGG - Intronic
1096990226 12:55795487-55795509 TTCCTTTGATCACTTTTCAAAGG - Intronic
1097257301 12:57688626-57688648 ATCCTTTGCTCACTTTTAATGGG - Intergenic
1097311621 12:58125155-58125177 ATCCTTCAACCACTTTTGATGGG + Intergenic
1097477632 12:60078264-60078286 AAACTTCGTTCACTGTTGATAGG - Intergenic
1097742145 12:63255706-63255728 AACCCTTGTTCACTGTTGATGGG + Intergenic
1098508747 12:71285876-71285898 AACCTTTGAATACTGTTGATGGG - Intronic
1098553649 12:71793912-71793934 CAGCTTTTAACACTTTTGATTGG - Exonic
1098700537 12:73619038-73619060 TACTTATGTTCACTTTTGATGGG - Intergenic
1098803828 12:74996515-74996537 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1098823661 12:75266452-75266474 AACCTTTGCACACTGTTGGTGGG + Intergenic
1099378442 12:81923574-81923596 AACCCTTGCGCATTTTTGATGGG - Intergenic
1099391368 12:82083665-82083687 AACCCTTGTATACTTTTGATGGG - Intergenic
1100410815 12:94317239-94317261 TTCCTTTGCCCACTTTTGATGGG + Intronic
1100663363 12:96724496-96724518 ATCCTTTGCCCATTTTTGATGGG + Intronic
1100755309 12:97744909-97744931 AACCTTTGTACACTGTTGGTGGG + Intergenic
1101069354 12:101057684-101057706 ATCCTTTGCCCACTTTTTATGGG + Intronic
1101503395 12:105325278-105325300 AACCTTTAATCACATTTCATTGG + Intronic
1102659777 12:114515825-114515847 AACCTTTGTACACTGTTGGTGGG + Intergenic
1103169796 12:118807099-118807121 AACCCTTTTACACTTTTGATGGG - Intergenic
1104058912 12:125251528-125251550 TATCTTTGAACTCTTTTGATAGG + Intronic
1105972462 13:25442356-25442378 AACCTTTGAGCACTGTTGGTGGG - Intronic
1106376893 13:29197880-29197902 ATCCTTTGCCCATTTTTGATGGG + Intronic
1106626852 13:31429453-31429475 AACCTTTGCACACTGTTGATGGG - Intergenic
1106807908 13:33330203-33330225 AACCCTTGTTCACTGTTGTTAGG - Intronic
1106873548 13:34047492-34047514 ATCCTTTGCTCATTTTTAATTGG - Intergenic
1106889737 13:34232024-34232046 ATCCTTTGCCCACTTTTTATGGG + Intergenic
1106974303 13:35188840-35188862 AACCCTTGCACACTGTTGATAGG - Intronic
1107841996 13:44467563-44467585 ATCCTTTGCTCACTTTTTAACGG - Intronic
1107842875 13:44477618-44477640 AATCTATGAGCACATTTGATAGG - Intronic
1107916864 13:45161423-45161445 AAGTGTTGATCACTTTTTATTGG + Intronic
1108109935 13:47058819-47058841 AAACTTTGTGCACTTTTGGTGGG - Intergenic
1108175554 13:47789081-47789103 AACCTTTGCACACTATTGGTGGG + Intergenic
1108239674 13:48449940-48449962 ATCCTTTGCCCACTTTTGAATGG + Intronic
1108264273 13:48689078-48689100 ATCCTTTGCCCACTTTTGATGGG + Intronic
1108892939 13:55284457-55284479 AACACTTGAACACTTTTGGTGGG + Intergenic
1108896662 13:55336925-55336947 AACTTTTGTTTACTGTTGATGGG - Intergenic
1108978841 13:56483967-56483989 AGCCTTTGATCACTTTTGGTGGG + Intergenic
1109087857 13:57999256-57999278 ATCCTTTGCCCACTTTTGATGGG + Intergenic
1109097395 13:58135115-58135137 AACCTTTGTTCTCATTTGAAAGG - Intergenic
1109282730 13:60375770-60375792 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1109381468 13:61567230-61567252 AAACGTTTATCACTTTAGATTGG + Intergenic
1109553403 13:63936363-63936385 ATCCTTTGACCACTTTTGGATGG + Intergenic
1109815985 13:67585503-67585525 ATCCTTTGCTCACTTTTTAATGG + Intergenic
1109970683 13:69764204-69764226 AACAGTTGATCACCTGTGATTGG - Intronic
1110231235 13:73169573-73169595 AACCTGTGATTTTTTTTGATGGG - Intergenic
1110513124 13:76376797-76376819 TACCCTTGTTCACTGTTGATGGG - Intergenic
1110976291 13:81840077-81840099 ATCCTTTGATAATTTTTAATTGG - Intergenic
1112483292 13:99796728-99796750 AACCTTGGCTCACTTCTGCTAGG - Intronic
1113342700 13:109442310-109442332 ATCCTTTGCCCATTTTTGATGGG + Intergenic
1114580787 14:23757536-23757558 ATCCTTTGCCCACTTTTGATGGG + Intergenic
1114694955 14:24618202-24618224 ATCCTTTGCTCATTTTTGATGGG + Intergenic
1114826873 14:26091433-26091455 ATCCTTTGCTCACTTTTTAATGG - Intergenic
1115021102 14:28682895-28682917 ATCCTTTGCCCACTTTTTATTGG + Intergenic
1115108058 14:29785030-29785052 ATCCCTTGATCACTTTTGAGCGG - Intronic
1115353802 14:32425672-32425694 ATCCTTTGCTCATTTTTAATGGG + Intronic
1115381082 14:32739984-32740006 AACTTTTGTTCACTGTTGGTGGG - Intronic
1116481690 14:45398634-45398656 AACCTTTGCACACTGTTGGTGGG + Intergenic
1116483242 14:45416724-45416746 ATCCTTCGCCCACTTTTGATGGG - Intergenic
1116493236 14:45530659-45530681 ATCCTTTGCTCACTTTTTAATGG - Intergenic
1116607714 14:47023268-47023290 AACCTTTGATCTCTTTCCCTTGG - Intronic
1116619453 14:47180511-47180533 AAACTTTGTCCACTTTTTATGGG - Intronic
1116660607 14:47706071-47706093 ATTCTTTGATAACTTTTGAGAGG - Intergenic
1116722722 14:48521099-48521121 AACCTCTGCTCACTATTAATGGG + Intergenic
1116843229 14:49840717-49840739 AACCTTTGCTTACTTTGGAAAGG - Exonic
1117232339 14:53733489-53733511 AACCCTTGTACACTGTTGATGGG + Intergenic
1119342864 14:73895297-73895319 AACCTTTGTACACTGTTGGTGGG + Exonic
1119954400 14:78780619-78780641 ATCCTTTGCTCATTTTTCATTGG - Intronic
1120059506 14:79965714-79965736 AAACTTTTATCACTTTGCATTGG - Intergenic
1121266554 14:92606577-92606599 ATCCTTTGCCCATTTTTGATTGG - Intronic
1123225374 15:17019113-17019135 AACATTTTTACACTTTTGATGGG + Intergenic
1123407791 15:20032754-20032776 ATCCTTTGCCCACTTTTAATGGG + Intergenic
1123517117 15:21039408-21039430 ATCCTTTGCCCACTTTTAATGGG + Intergenic
1123965737 15:25455439-25455461 AACCTTTGATAGCGTTTGATTGG + Intergenic
1124056693 15:26246935-26246957 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1124561736 15:30780560-30780582 ATCCTTTGCCCAATTTTGATGGG - Intergenic
1124692168 15:31833016-31833038 AGCCCTTGCTCACTGTTGATAGG - Intronic
1124843461 15:33266465-33266487 AACCTTTGTACACTGTTGGTAGG - Intergenic
1125309577 15:38363998-38364020 ATCCTTTGCCCACTTTTAATCGG + Intergenic
1125456018 15:39859547-39859569 AACCTTTGTGCACTGTTGGTGGG + Intronic
1125545935 15:40504970-40504992 ACCCTTTGCTCATTTTTTATTGG - Intergenic
1126710678 15:51452422-51452444 GTCCTTTGCTCGCTTTTGATGGG - Intronic
1126968305 15:54081947-54081969 ATCCTTTGATCATTTCTTATAGG + Intronic
1127476933 15:59343536-59343558 AAACTTTGATATCTTTTGTTTGG + Intronic
1127851635 15:62918151-62918173 ATCCTTTGATCATTTTTAATTGG - Intergenic
1129962571 15:79700848-79700870 AACCTTTGAACACTGCTGGTGGG + Intergenic
1130728231 15:86463258-86463280 ATCCTTTGCCCACATTTGATGGG + Intronic
1130957021 15:88634341-88634363 AACCCTTGTTCACTGTTGGTGGG - Intergenic
1131366683 15:91847437-91847459 AACCTTTGATGACCTGTTATGGG - Intergenic
1133162869 16:3923425-3923447 AACCTTTATGCACCTTTGATGGG + Intergenic
1133238233 16:4399017-4399039 AACCCTTGCACACTGTTGATGGG + Intronic
1133669335 16:8002605-8002627 ATCCTTTGCCCACTTATGATGGG - Intergenic
1134359034 16:13513178-13513200 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1135895036 16:26392874-26392896 ATCCTTTGCCCACTTTTAATGGG - Intergenic
1137470797 16:48756159-48756181 GTCCTTTGCCCACTTTTGATGGG - Intergenic
1137667025 16:50256739-50256761 AACCCTTGAGCACTGTTGGTGGG + Intronic
1137724221 16:50646221-50646243 AAGCTTTGAACATTTTTTATGGG + Intergenic
1138136584 16:54528748-54528770 TACCTTTGCTCACATTTCATTGG + Intergenic
1138792766 16:59927102-59927124 GTCCTTTGTTCACTTTTGAATGG + Intergenic
1139363870 16:66421393-66421415 ACCCTTTGGTCACAGTTGATTGG + Intergenic
1139901877 16:70334431-70334453 AACCTCAGATCACATTTGTTTGG - Exonic
1140333957 16:74085870-74085892 AACCTTTGCACACTGTTGATGGG - Intergenic
1140576149 16:76171600-76171622 AACCTTTGTTCACTGTTGTTGGG - Intergenic
1140854969 16:78969962-78969984 AAACTTTGAACACTTTAAATGGG + Intronic
1141350927 16:83295703-83295725 AACCCTTGCCCACTGTTGATGGG + Intronic
1143917317 17:10303325-10303347 AACCTATGGTCACTTCTGATGGG + Intronic
1144617072 17:16786599-16786621 GTCCTTTGCCCACTTTTGATGGG + Intronic
1144895620 17:18529075-18529097 GTCCTTTGCCCACTTTTGATGGG - Intergenic
1145136596 17:20415156-20415178 GTCCTTTGCCCACTTTTGATGGG + Intergenic
1145295239 17:21585955-21585977 AACCCTTGAACACTCTTGGTGGG + Intergenic
1148986169 17:51623612-51623634 AACCTTTGTACACTGTTGATGGG + Intergenic
1149131636 17:53309294-53309316 ATCCTTTGCCCAATTTTGATGGG - Intergenic
1149663451 17:58349086-58349108 AACCTTTGGGCACTGTTGGTGGG + Intronic
1150815532 17:68389407-68389429 AGCCTATGCTCACATTTGATGGG - Intronic
1150940076 17:69683178-69683200 ATCCTTTGCTCACTTTTTAATGG + Intergenic
1151240780 17:72756079-72756101 AACCCTTGAGCACTGTTGGTAGG + Intronic
1153118073 18:1685307-1685329 AACAGTTGACCACATTTGATTGG + Intergenic
1153397040 18:4635108-4635130 AACCTTTGTACACTGTTGGTGGG + Intergenic
1153430548 18:5011717-5011739 AACCCTTGTACACTGTTGATGGG + Intergenic
1153657329 18:7294716-7294738 ATCCTTTGCTCATTTTTAATTGG + Intergenic
1153704028 18:7726317-7726339 ATCCTTTGCTCATTTTTAATTGG + Intronic
1153821184 18:8833405-8833427 AACCCTTGAGCACTGTTGGTGGG + Intergenic
1154295950 18:13148366-13148388 AACCTTTGTACACTATTGGTGGG - Intergenic
1154396139 18:13991113-13991135 AACCTTTGTATACTTTTGCTGGG + Intergenic
1155113096 18:22735940-22735962 AACCCTTGAACACTGTTGGTGGG + Intergenic
1155765930 18:29632581-29632603 AAACTTTGTACACTGTTGATGGG - Intergenic
1155926798 18:31664416-31664438 AAACTTTGAAAACTTTTCATAGG - Intronic
1156146904 18:34193616-34193638 AACCTTTGCACACTGTTGATAGG + Intronic
1156732362 18:40209743-40209765 AACCTTTCAACTCTTTTTATGGG + Intergenic
1156771144 18:40727576-40727598 ATCCTTTGCCCACTTTTTATAGG - Intergenic
1157809166 18:50681229-50681251 ACCCTTTGTTCATTTTTAATTGG + Intronic
1158173649 18:54628269-54628291 AACCCTTGTACACTGTTGATGGG + Intergenic
1158196354 18:54889603-54889625 AATCTTTGATCATGTTTGAAAGG - Exonic
1158706267 18:59795148-59795170 AAAGTTTGATCTCCTTTGATAGG - Intergenic
1158760184 18:60375632-60375654 ATCCTTTGCTCATTTTTAATTGG + Intergenic
1159224511 18:65514882-65514904 AACCCTTGTACACTGTTGATGGG + Intergenic
1159321350 18:66854881-66854903 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1159594787 18:70372156-70372178 AACAGTTGACCACATTTGATTGG + Intergenic
1160305630 18:77732977-77732999 AACCCTTGAACACTGTTGGTGGG - Intergenic
1162176671 19:8835027-8835049 ACTCTTTGTTCACTTTTAATTGG - Intronic
1162664404 19:12197372-12197394 AACCTTTGTATACTGTTGATGGG - Intergenic
1162698246 19:12494136-12494158 AACCTTTGTACACTGTTGGTGGG + Intronic
1163015753 19:14453189-14453211 AACCTTTGTGCACTGTTGGTGGG + Intronic
1164467266 19:28498003-28498025 AACCCTTGTACACTGTTGATAGG + Intergenic
1166612371 19:44210302-44210324 AACATTTGCTAACTTTTTATAGG + Intronic
925335607 2:3097136-3097158 AGCCTTCAATCACTGTTGATAGG - Intergenic
926366176 2:12134916-12134938 ATCCTTTGCCCATTTTTGATGGG + Intergenic
926546537 2:14247903-14247925 ATCCTTTGCCCACTTTTTATGGG - Intergenic
926875002 2:17466158-17466180 ATCCTTTGACCACTTTTTGTTGG - Intergenic
927254762 2:21030983-21031005 AACAGTTAATCACTGTTGATGGG + Intronic
927309338 2:21611580-21611602 AACCCTTGTACACTGTTGATAGG - Intergenic
927547092 2:23963675-23963697 AACCCTTGAACACTGTTGATGGG + Intronic
927610175 2:24531119-24531141 AACCTTTGTACACTGTTGGTAGG + Intronic
928532155 2:32203532-32203554 GATCTTTGATCACCTCTGATAGG + Intronic
928754736 2:34510563-34510585 ATCCTTTGCCCACTTTTGATGGG - Intergenic
928882308 2:36111015-36111037 ATCCTTTGTCCACTTTTGAATGG + Intergenic
929621150 2:43355344-43355366 AACCTTTGTACACTGTTGGTGGG - Intronic
930083437 2:47473821-47473843 AACATTTGATCACTGTTGTGGGG + Intronic
930318235 2:49823165-49823187 ATCCTTTGACCACTTTTTAATGG + Intergenic
930591882 2:53337303-53337325 ATCCTTTGCCCACTTTTAATTGG + Intergenic
930700396 2:54454831-54454853 AACCTATGTTTACTTTTGATAGG - Intergenic
930951840 2:57152198-57152220 ATCCTTTGCTCACTTTTTAATGG - Intergenic
931053912 2:58446426-58446448 AACCTTTGATCCTATTTGTTAGG + Intergenic
931480904 2:62638874-62638896 ATCCTTAGCTCATTTTTGATGGG - Intergenic
932064730 2:68542688-68542710 AACCTTTGTGCATTGTTGATGGG + Intronic
932179735 2:69635324-69635346 AACCTTTGTGCACTGTTGATGGG + Intronic
932324400 2:70847483-70847505 ATCCTTTGCCCACTTTTTATGGG - Intergenic
932532822 2:72555576-72555598 ATCCTTTGCCCACTTTTTATGGG + Intronic
932869771 2:75387073-75387095 ATCCTTTGGTCACTTTTTAGTGG + Intergenic
932882966 2:75521214-75521236 AACCCTTGTGCACTGTTGATGGG + Intronic
933109633 2:78381284-78381306 ATCCTTTGCCCACTTTTTATGGG - Intergenic
933849425 2:86353613-86353635 AACTTTTGAACATTGTTGATGGG + Intergenic
935024364 2:99262145-99262167 ATTCTTTGATCACTTTTCACTGG + Intronic
936728686 2:115355381-115355403 AGCCTTTGCCCATTTTTGATGGG + Intronic
936880428 2:117243802-117243824 ACCCTTCGCCCACTTTTGATGGG - Intergenic
936900608 2:117477933-117477955 ATCCTTTGCCCACTTTTTATGGG - Intergenic
937432168 2:121848216-121848238 AACCCTGGAACACTGTTGATGGG - Intergenic
937504885 2:122525956-122525978 AACCTTTGCTCATATTTCATTGG - Intergenic
937674989 2:124580369-124580391 AACAGTTGACCACCTTTGATTGG - Intronic
937685843 2:124696176-124696198 AACATTTCTTCACTTTTAATAGG - Intronic
937817350 2:126266291-126266313 AACCTTTGTGCACTGTTGGTTGG - Intergenic
937902691 2:127034090-127034112 AAAGTTTCCTCACTTTTGATGGG + Intergenic
938106249 2:128532136-128532158 AACCCTTGTTCACTGTTGATGGG + Intergenic
938184737 2:129220141-129220163 ATCCTTTGCTCATTTTTAATTGG - Intergenic
938816566 2:134910567-134910589 TACCTTTTTTCAATTTTGATTGG - Intergenic
939033750 2:137106711-137106733 ATCCTTTGACCACTTTTTAATGG - Intronic
939080035 2:137648878-137648900 AACCCTTGAACACTGTTGGTGGG - Intronic
939380883 2:141435056-141435078 ATACTTTGATCACTTCTGAAAGG + Intronic
939418806 2:141938469-141938491 AACCTTTGTACACTGTTGGTGGG + Intronic
939781972 2:146460147-146460169 AACCTTTGCCCACTTTTTAATGG + Intergenic
939891485 2:147742189-147742211 CACCTTGGATCTCTCTTGATGGG - Intergenic
940382430 2:153031182-153031204 AACCCTTGGTCACTGTTAATTGG + Intergenic
940801049 2:158132903-158132925 AACCCTTGAATACTGTTGATGGG + Intronic
940965008 2:159827279-159827301 ATCCTTTGCCCAATTTTGATGGG - Intronic
941050148 2:160723478-160723500 ATCCTTTGCCCACTTTTGATGGG + Intergenic
941127211 2:161598695-161598717 GTCCTTTGCTCATTTTTGATGGG - Intronic
941238185 2:163002075-163002097 AACCCTTGAACACTGTTGGTGGG + Intergenic
942392344 2:175508752-175508774 ATCCTTTGCCCACTTTTTATGGG - Intergenic
942429530 2:175895654-175895676 ATCCTTTGCCCACTTTTTATGGG - Intergenic
942669523 2:178359429-178359451 AACCTTTGTACACTGTTGTTGGG + Intronic
942929255 2:181470113-181470135 AACCCTTGCCCACTGTTGATGGG + Intronic
943039040 2:182781784-182781806 ATCCTTTGCCCACTTTTAATGGG + Exonic
943076320 2:183199886-183199908 AACCTTTGTACACTGTTGGTGGG + Intergenic
943118384 2:183703912-183703934 ATCCTTTGTTCACTTTTTAATGG - Intergenic
943262427 2:185683194-185683216 ACCCTTTGCCCAATTTTGATGGG + Intergenic
944019822 2:195088652-195088674 ATCCTTTGATCACTTTTTGATGG - Intergenic
944045329 2:195404412-195404434 AAACTTTGTACACTGTTGATGGG + Intergenic
944849351 2:203701979-203702001 ATCCTTTGCCCACTTTTTATGGG - Intergenic
944858470 2:203791351-203791373 AACCTCTGCTCACATATGATTGG - Intergenic
944935915 2:204567822-204567844 AACCTTTGCTCACTGATGATGGG - Intronic
945295674 2:208168893-208168915 AGCCTTTGATCACTATAGACAGG + Intronic
945636594 2:212361034-212361056 AACTTTTGGTCACTTTTGTTTGG - Intronic
946105900 2:217369253-217369275 AACTTTTGCTCACTTTCCATTGG + Intronic
946205413 2:218103403-218103425 ATCCTTTGCCCACTTTTGATGGG + Intergenic
946680279 2:222207121-222207143 AACATTTGAACATTTTTGATTGG - Intronic
947090372 2:226503532-226503554 AACTGTTACTCACTTTTGATGGG + Intergenic
947330058 2:229019232-229019254 AACCCTTGCACACTTTTGGTGGG - Intronic
947350149 2:229235159-229235181 AACTTTTGATGGCTTTTGAGGGG - Intronic
947355654 2:229292579-229292601 ATCCTTTGCTCATTTTTAATTGG + Intergenic
947368463 2:229420799-229420821 AACCTTTGTGCACTGTTGGTAGG + Intronic
947476337 2:230451249-230451271 AACCTTTGTACACTGTTGGTGGG - Intronic
947891221 2:233622551-233622573 ATCCTTTGCCCACTTTTGATGGG + Intronic
947899467 2:233708778-233708800 AACCTGTGATCACTTTATTTGGG + Intronic
947940355 2:234049019-234049041 ATCCTTTGCTCACTTTTTAATGG - Intergenic
948379229 2:237541371-237541393 GACCTTTGTGCACTATTGATGGG - Intronic
1169468919 20:5866271-5866293 AAGCTTTTAACACTTTTTATTGG + Intergenic
1169513284 20:6289078-6289100 AACCCTTGTACACTGTTGATGGG + Intergenic
1169883742 20:10375233-10375255 AACAGTTGGTCACCTTTGATTGG - Intergenic
1170236521 20:14111740-14111762 AACCTTTGTACACTGTTGATGGG + Intronic
1171402702 20:24888466-24888488 AACCCTTGTACACTGTTGATAGG + Intergenic
1171856762 20:30351913-30351935 AACCATTAAACACTATTGATGGG - Intergenic
1172908301 20:38386135-38386157 AACAGTTGGCCACTTTTGATTGG - Intergenic
1173394411 20:42665265-42665287 ATCCTTTGCCCACTTTTGATGGG - Intronic
1173574484 20:44103030-44103052 AACCTTTGCTCATTTTTAATTGG - Intergenic
1174974161 20:55311975-55311997 AACCCTTGTACACTATTGATGGG - Intergenic
1174995742 20:55566504-55566526 GACCTTTGAACACTATTGTTAGG - Intergenic
1175462462 20:59162086-59162108 GACCTTTGCTCACTTTTTAATGG + Intergenic
1176182936 20:63760430-63760452 ATCCGTTGATCACTTTTCACAGG + Intronic
1177270405 21:18840779-18840801 ACCTTTTGATCTCTCTTGATGGG + Intergenic
1177577049 21:22971613-22971635 CACCTTTGAACACGGTTGATGGG - Intergenic
1177946849 21:27481032-27481054 AACCTGTGCTCAGTTTTGCTGGG - Intergenic
1178469948 21:32883429-32883451 AACCCATGTTCACCTTTGATGGG - Intergenic
1179158293 21:38870557-38870579 AACCCTTGTACACTGTTGATGGG - Intergenic
1180594856 22:16966473-16966495 AACTTTTGATCACCTTGGCTGGG + Intronic
1182173456 22:28257131-28257153 AACCTTTGTACACTGTTGGTGGG + Intronic
1182615676 22:31587887-31587909 AACCATTCATGACATTTGATGGG + Intronic
1182867400 22:33615839-33615861 ATCCTTTGCTCAATTTTTATTGG - Intronic
1184865674 22:47200719-47200741 CACCTTTGTCCAGTTTTGATTGG + Intergenic
949398541 3:3641204-3641226 GTCCTTTGCTCACTTTTCATTGG + Intergenic
949410764 3:3761622-3761644 AACTCTTGGTCACCTTTGATTGG + Intronic
949605079 3:5644102-5644124 GACCTTTGCCCACTTTTTATTGG - Intergenic
949816053 3:8059520-8059542 ATCCTTTGCCCACTTTTGATAGG + Intergenic
949907560 3:8871420-8871442 AACCCTTGTGCACTGTTGATGGG + Intronic
950061055 3:10071221-10071243 AACCTTTGTACACTGTTGGTGGG + Intronic
950302069 3:11889110-11889132 AACCTTTGTACACTGTTGGTGGG + Intergenic
950753217 3:15148082-15148104 AACCTTTGTCCACTGTTGGTGGG + Intergenic
950830399 3:15869391-15869413 AACCCTTGTACACTTTTGGTGGG + Intergenic
951296834 3:20947428-20947450 GTCCTTTGCTCACTTTTGAATGG + Intergenic
951361291 3:21727489-21727511 ATCCTTTGCCCATTTTTGATGGG - Intronic
951691601 3:25402333-25402355 AACCCTTGTACACTGTTGATGGG + Intronic
951968355 3:28415269-28415291 ATCCTTCGCCCACTTTTGATGGG + Intronic
951968739 3:28419253-28419275 ATCCTTCGCCCACTTTTGATGGG - Intronic
952060922 3:29509020-29509042 ATCCTTTGCCCACTTTTGATGGG + Intronic
952135932 3:30419616-30419638 AACCTTTGAATACTGTTGGTGGG + Intergenic
952136273 3:30425181-30425203 AGCCTTTGCTCATTTTTAATTGG + Intergenic
952738330 3:36711822-36711844 AAGCTTTCATCACTCTTTATGGG + Intergenic
952906826 3:38144918-38144940 AACCTTTGATCACTTTTGATGGG + Intergenic
953166761 3:40472006-40472028 AACCCTTGTACACTGTTGATGGG - Intergenic
953630664 3:44613938-44613960 ATCCTTTGCCCACTTTTAATTGG - Intronic
954281863 3:49585922-49585944 ATCTTTTGTTCATTTTTGATCGG + Intronic
954505253 3:51064718-51064740 AAGCTTTCATCATTTTTGCTAGG + Intronic
954856094 3:53644934-53644956 AAGCTTTGTACACTGTTGATAGG - Intronic
955014459 3:55056336-55056358 AAACTTTGTACACTTTTGGTGGG + Intronic
955049324 3:55393984-55394006 ATCCTTTGTTCACTTTTTGTTGG - Intergenic
955613540 3:60782348-60782370 AACCCTTGTTCACTACTGATGGG + Intronic
955929591 3:64043335-64043357 GTCCTTTGCCCACTTTTGATGGG + Intergenic
956356185 3:68395114-68395136 ATCCTTTGGCCATTTTTGATGGG - Intronic
956471436 3:69571084-69571106 TACCATTCATCACTTTTGTTTGG + Intergenic
956638292 3:71389125-71389147 AACATTCCATCACTTTTTATTGG + Intronic
957257484 3:77856830-77856852 AACCCTTGCTCACTGTTGGTGGG + Intergenic
957505822 3:81119150-81119172 GTCCTTTGCCCACTTTTGATGGG - Intergenic
957584645 3:82118188-82118210 ATCCTTTGCCCACTTTTTATGGG - Intergenic
959119392 3:102214643-102214665 AACCTTTGAGCATTCTTGATGGG - Intronic
959203374 3:103276428-103276450 ATTCTTTGCCCACTTTTGATGGG + Intergenic
959603516 3:108216505-108216527 AACCCTTGAACACTATTGGTAGG + Intronic
959625876 3:108450086-108450108 AACCCTTGTACACTGTTGATGGG + Intronic
960046308 3:113201708-113201730 AACCCTTGCACACTGTTGATGGG - Intergenic
960278071 3:115749701-115749723 ATCCTTTGCCCACTTTTGATGGG - Intergenic
960427662 3:117528785-117528807 AACCTTTGTACACTGTTGGTGGG - Intergenic
960468319 3:118026945-118026967 AACCCTTGTACACTGTTGATGGG - Intergenic
961331568 3:126145239-126145261 AACCTTTGTGCACTGTTGGTGGG + Intronic
961436470 3:126922018-126922040 AACCTTTGATGACCTTTTAAAGG + Intronic
961500944 3:127335327-127335349 AACCCTTGTACACTGTTGATGGG + Intergenic
961587325 3:127943300-127943322 AACCCTTGTACACTGTTGATGGG - Intronic
961839074 3:129693152-129693174 AACATTTAATCAGCTTTGATGGG + Intronic
961992585 3:131207786-131207808 ATCCTTTGCCCACATTTGATGGG + Intronic
962064847 3:131968524-131968546 ATCCTTTGCCCACTTTCGATGGG - Intronic
962237915 3:133724476-133724498 ATCCTTTGCCCACATTTGATGGG + Intergenic
962447014 3:135475297-135475319 AACCTTTGTACACATTTGGTAGG - Intergenic
962521649 3:136202608-136202630 ATCCTTTGAGCACTTTTTAATGG + Intergenic
962818889 3:139027443-139027465 ATCCTTTGCCCACTTTTGATGGG + Intronic
962822419 3:139063728-139063750 AACCATTTCTAACTTTTGATTGG + Intronic
963438036 3:145296990-145297012 AACCTTTGTACACTGTTTATAGG + Intergenic
963546701 3:146668662-146668684 AACACTTGCACACTTTTGATGGG - Intergenic
963771470 3:149390749-149390771 AACCTTTTATCACATTATATAGG + Intergenic
964208338 3:154199878-154199900 AATCTTTGCCCATTTTTGATTGG + Intronic
964589426 3:158343402-158343424 TGCCTTTGGTCATTTTTGATAGG - Intronic
964912334 3:161798591-161798613 ATCCTTTGCCCACTTTTTATGGG - Intergenic
964947324 3:162241945-162241967 AACCCTTGAACACTGATGATGGG + Intergenic
965987945 3:174779299-174779321 ATCCTTTGTCCACTTTTGATGGG + Intronic
966054312 3:175664848-175664870 AACCTTTGATAGGATTTGATAGG - Intronic
966126980 3:176589877-176589899 AATATTTAATCTCTTTTGATTGG - Intergenic
966148337 3:176837889-176837911 AATCTTTGCACACTGTTGATGGG + Intergenic
966395637 3:179499901-179499923 ATCCTTTGCCCACATTTGATGGG + Intergenic
967539858 3:190654529-190654551 AAGTTTTGAGAACTTTTGATTGG - Intronic
967974416 3:195024964-195024986 AACCCTTGCTCACTGTTGGTGGG - Intergenic
969039212 4:4281895-4281917 AACTTTTGATCACTTTAAAGGGG - Exonic
970736855 4:19181344-19181366 AACCTTTGGTCATTTTTTGTTGG - Intergenic
970910876 4:21273754-21273776 CACCTTTCATCACCTTTCATGGG - Intronic
971693891 4:29873030-29873052 ATCCTTTGACCACTTTTGGATGG + Intergenic
971809104 4:31400314-31400336 ATCCTTTGCCCACTTTTGACGGG + Intergenic
971883683 4:32414277-32414299 ATCCTTTGCTCACTTTTTAATGG - Intergenic
971891870 4:32534585-32534607 AACCATTGTACAGTTTTGATGGG + Intergenic
972180107 4:36454000-36454022 AACCTTTGTGCACTGTTGATAGG - Intergenic
972881380 4:43427395-43427417 ATCCTTTGCCCACTTTTGATGGG + Intergenic
972885984 4:43488461-43488483 ATCCTTTACCCACTTTTGATGGG + Intergenic
973017837 4:45163915-45163937 ACCCTTTGTACACTTTTGCTGGG - Intergenic
973129370 4:46631334-46631356 ATCCTTTGTCCACTTTTAATGGG + Intergenic
973307647 4:48671059-48671081 AACCCTTGTACACTATTGATGGG - Intronic
973730673 4:53819414-53819436 AACCCTTGTACACTGTTGATGGG + Intronic
974311198 4:60211446-60211468 AATCTTTAATCCATTTTGATTGG - Intergenic
974335444 4:60538322-60538344 AAATTATGCTCACTTTTGATTGG - Intergenic
974515263 4:62899690-62899712 GTCCTTTGTTCACTTTTAATGGG - Intergenic
974801109 4:66819243-66819265 AACCCTTGTACACTGTTGATGGG + Intergenic
975100168 4:70503750-70503772 AATCTTTGTGCACTATTGATGGG + Intergenic
976013566 4:80522078-80522100 AACCCTTATGCACTTTTGATGGG - Intronic
976138867 4:81968678-81968700 AACCTTTGTACACTGTTGGTGGG + Intronic
976162415 4:82217488-82217510 GACCTCTGTTCACTTTTTATTGG + Intergenic
976459694 4:85295389-85295411 AACCTTTGCGCACTGTTGGTGGG + Intergenic
976459768 4:85296399-85296421 AACCTTTGTATACTGTTGATGGG + Intergenic
976460738 4:85309155-85309177 GTCCTTTGCCCACTTTTGATGGG + Intergenic
976532740 4:86173796-86173818 GTCCTTTGGCCACTTTTGATGGG - Intronic
976669995 4:87641560-87641582 ATCCTTTGCTCACTTTTGATGGG - Intergenic
977192380 4:94017075-94017097 AACCCTGGAACACTGTTGATGGG - Intergenic
977650592 4:99464298-99464320 AACCCTTGTACACTGTTGATGGG - Intergenic
977690648 4:99905706-99905728 ATTCTTTGATCATTTTTTATAGG - Exonic
977845937 4:101766963-101766985 AACCCTTGCTCACTGTTGTTGGG - Intronic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978587119 4:110285245-110285267 AACCTTTGTCCACTGTTGATAGG + Intergenic
978600481 4:110422111-110422133 ATCCTTTGCTCACTTTTGAATGG - Intronic
979423144 4:120531203-120531225 ATCCTTTGTCCATTTTTGATGGG + Intergenic
979712234 4:123793152-123793174 ATCCGTTGCCCACTTTTGATAGG + Intergenic
979879152 4:125932184-125932206 AACATTTATTCACTGTTGATGGG - Intergenic
979916202 4:126437195-126437217 AACCTTTGCACACTATTGGTGGG - Intergenic
979991910 4:127384937-127384959 ATCCTTTGCTCACTTTTTAATGG - Intergenic
980323642 4:131311235-131311257 ATCCTTTGAACACTTTTGGTGGG + Intergenic
980334713 4:131456533-131456555 ATCCTTTGCCCACTTTTGGTGGG - Intergenic
980391394 4:132152371-132152393 AACCTTTGATCCATCTTGAGTGG + Intergenic
980477714 4:133340070-133340092 AACTTTTGTACACTGTTGATGGG - Intergenic
980683226 4:136191006-136191028 AACCCTTGTACACTGTTGATGGG + Intergenic
980814352 4:137923615-137923637 AACATTTGGTCACCTTTGATTGG - Intergenic
980850709 4:138378001-138378023 AACCCTTGTACACTGTTGATGGG + Intergenic
981234083 4:142394096-142394118 AACTTTTGAACACTGTTGGTGGG - Intronic
981357169 4:143802740-143802762 ATCCTTTGCCCATTTTTGATGGG - Intergenic
982315944 4:154032017-154032039 AACCTTTGTACACTGTTGGTGGG - Intergenic
982339576 4:154282554-154282576 AACCTTTGTGCACTGTTGCTGGG + Intronic
982361749 4:154525865-154525887 AACCCTTGTGCACTGTTGATGGG + Intergenic
982525255 4:156469738-156469760 AACCTTTGTGCCCTATTGATGGG + Intergenic
982581945 4:157189639-157189661 AACCTTTGTTCACTATTGGTGGG - Intergenic
982587110 4:157255826-157255848 ATCCTTTGTCCACTTTTTATAGG - Intronic
982752984 4:159184562-159184584 ATCCTTTGCCCACTTTTAATGGG + Intronic
982952696 4:161720393-161720415 AACATTTGTACACTATTGATGGG + Intronic
982989005 4:162246685-162246707 ATCCTTTGCCTACTTTTGATGGG + Intergenic
983083836 4:163419257-163419279 AACCTCTGATCACATTGCATTGG - Intergenic
983736244 4:171065471-171065493 AAACTTTGTACACTGTTGATGGG + Intergenic
983750302 4:171260081-171260103 ATCCTTTGCCCAATTTTGATGGG + Intergenic
984239288 4:177198380-177198402 AACCTTTGTACACTGTTGGTGGG - Intergenic
984354916 4:178645574-178645596 AACCCTTGTACACTGTTGATGGG - Intergenic
984823141 4:183901524-183901546 AACCTTTGTGCACTGTTGGTAGG - Intronic
985214674 4:187638302-187638324 GTCCTTTGCTCACTTTTGATGGG + Intergenic
985374948 4:189325197-189325219 AACCCTTGTACACTGTTGATAGG - Intergenic
985564772 5:610003-610025 CACATTTGATCACTGTTCATGGG - Intergenic
985774897 5:1836373-1836395 TACCTTTGATGACTGTTGAATGG + Intergenic
986288699 5:6380296-6380318 AACCCTTGTACACTGTTGATGGG + Intergenic
987013890 5:13797374-13797396 ATCCTTTGCCCACTATTGATGGG - Intronic
987773771 5:22337950-22337972 AACCTTTGTACACTGTTGGTGGG + Intronic
988290288 5:29275591-29275613 ATCCTTTGCCCACTTTTGTTGGG - Intergenic
988780795 5:34519964-34519986 AACCTTTGTACACTGTTGGTGGG + Intergenic
988862027 5:35291664-35291686 GACCTTTGTACACTGTTGATGGG - Intergenic
989303229 5:39919016-39919038 AACCATTGATCATTGTTGACAGG - Intergenic
989403561 5:41035639-41035661 GTCCTTTGTTCACTTTTTATTGG - Intronic
989511611 5:42294552-42294574 AACTAGTGATCACTTTTTATAGG - Intergenic
989795680 5:45468743-45468765 ATCCTTTGAACATTTTTGGTAGG + Intronic
990504200 5:56428540-56428562 GGCCATTGATCAATTTTGATGGG - Intergenic
990774554 5:59290961-59290983 AACCCTGGTACACTTTTGATGGG + Intronic
990801035 5:59603526-59603548 AACCCTTGTACACTGTTGATGGG + Intronic
990928905 5:61063924-61063946 ACCATTCTATCACTTTTGATTGG - Intronic
991233748 5:64368630-64368652 ATCCTTTGCCCATTTTTGATGGG - Intronic
992586077 5:78241546-78241568 AACCTTTGCTTTCTTTTCATAGG + Intronic
992956960 5:81920048-81920070 ATCTTTTGGTCAATTTTGATGGG + Intergenic
993496942 5:88618269-88618291 ATCCTTTGACCACTTTTGGATGG + Intergenic
993537805 5:89108316-89108338 AACCCTTGTACACTGTTGATGGG + Intergenic
993578131 5:89626844-89626866 ATCCTTTGACCACTTTTGGATGG - Intergenic
993922101 5:93818008-93818030 ATCCTTTGCTCAATTTTAATTGG - Intronic
994309733 5:98255040-98255062 AACCTTTGCCCACTTTTTAATGG + Intergenic
994387698 5:99151526-99151548 ATCCTTTGCCCACTTTTGACGGG - Intergenic
994671657 5:102768959-102768981 AACCTTTGAACACTGTTGGTGGG - Intronic
994924084 5:106091165-106091187 AACCTTTGTACACTGTTGGTGGG - Intergenic
995711890 5:115044252-115044274 ATCCTTTGCTCACTTTTTATTGG - Intergenic
995771016 5:115670196-115670218 AACCCTTGTACACTGTTGATGGG + Intergenic
995898207 5:117039410-117039432 AACATTTGATTCCCTTTGATTGG + Intergenic
996076003 5:119195126-119195148 AATCTTTGTGCACTTTTGGTGGG + Intronic
996136874 5:119853814-119853836 AACCTTTGCACACTATTGGTGGG - Intergenic
996204330 5:120712853-120712875 AACCTTTGCACACTGTTGATAGG + Intergenic
996279197 5:121707159-121707181 AACATTTGATTAATTTTGGTGGG - Intergenic
996292524 5:121868956-121868978 AACCTTTGTCCACTGTTGGTGGG + Intergenic
996390606 5:122956644-122956666 AACCCTTGCTCACTGTTGGTCGG - Intronic
996475822 5:123919418-123919440 AACCTTTGTACACTGTTGGTGGG - Intergenic
996957897 5:129207314-129207336 AACCTTTGTACACTGTTGGTGGG - Intergenic
996966537 5:129312806-129312828 ATCCTTTGCCCACTTTTGATGGG - Intergenic
996969530 5:129346999-129347021 GTCCTTTGCTCACTTTTGATTGG + Intergenic
997015016 5:129922445-129922467 AACCCTTGTACACTTTTGGTGGG - Intronic
997222756 5:132182602-132182624 AATCTTTGATCAGTCTTGAAAGG + Intergenic
997775805 5:136603205-136603227 GTCCTTTGATCACTTTTTAATGG + Intergenic
998274982 5:140743923-140743945 AACCTTTGTGCACTATTAATGGG - Intergenic
998629061 5:143878322-143878344 CACCTTTGATCCCTTTCTATTGG - Intergenic
998656355 5:144184621-144184643 AACCTTTGTGCACTGTTGGTGGG - Intronic
998670355 5:144346677-144346699 ATCTTTTGACCATTTTTGATTGG + Intronic
998678824 5:144441086-144441108 ATCCTTTGTTCATTTTTCATTGG + Intronic
998688414 5:144557211-144557233 ATCCTTTGCCCATTTTTGATGGG + Intergenic
998963817 5:147515910-147515932 AACATTTGAGCCATTTTGATTGG - Intergenic
1000699008 5:164424752-164424774 ATCTTTTGCTCACTTTTAATTGG - Intergenic
1000776429 5:165425703-165425725 AACAGTTGGTCACCTTTGATTGG - Intergenic
1000970260 5:167706706-167706728 AACCCTTTAACACTATTGATGGG - Intronic
1001161346 5:169318407-169318429 AACCCTTGTACACTTTTGGTGGG + Intergenic
1001760301 5:174202668-174202690 AACCCTTGTTCACTGTTGATGGG - Intronic
1002890756 6:1329724-1329746 AACCCTTGTACACTGTTGATGGG - Intergenic
1003126237 6:3358100-3358122 AACCTTTAAACACTGTTGGTAGG + Intronic
1004091858 6:12511564-12511586 AACTTTTGGACACTGTTGATGGG + Intergenic
1004440547 6:15647168-15647190 ATCCTTTGCTCACTTTTTAATGG - Intronic
1004825797 6:19419665-19419687 TTCCTTTGCTCACTTTTCATTGG + Intergenic
1005846594 6:29784998-29785020 ATCCTTTGCCCACTTTTTATGGG - Intergenic
1006274308 6:32989585-32989607 AACAGTTGATCACCTTTGATTGG - Intergenic
1007637876 6:43310549-43310571 ATACTTTGCTCACTTTTAATTGG - Intronic
1007847708 6:44774079-44774101 AACCTTTGTACACTTTTGGTGGG - Intergenic
1008108963 6:47471879-47471901 AACCTTTGTACACTGTTGGTGGG + Intergenic
1008204568 6:48638832-48638854 ATCCTTTGTTCACTTTTTAAAGG - Intergenic
1009341899 6:62565892-62565914 AACCTTTGATCTCTATGGGTAGG - Intergenic
1009647625 6:66426798-66426820 ATCCTTTGCCCAATTTTGATGGG - Intergenic
1009756592 6:67947975-67947997 ATCCTTTGCCCACTTTTGATGGG + Intergenic
1010031529 6:71275824-71275846 ATCCTTTGCTCACTTTTGGATGG - Intergenic
1010315879 6:74449685-74449707 GTCCTTTGCCCACTTTTGATGGG + Intergenic
1010344431 6:74795116-74795138 ATCCTTAGTCCACTTTTGATGGG - Intergenic
1010464257 6:76148553-76148575 ATCCTTTGCCCACATTTGATGGG - Intergenic
1010588531 6:77684961-77684983 AACCTTTGTACACTGTTGGTGGG - Intergenic
1010611262 6:77956314-77956336 AACCCTTTTACACTTTTGATGGG + Intergenic
1010852575 6:80796042-80796064 ATCCTTTGCCCATTTTTGATGGG + Intergenic
1010923126 6:81709130-81709152 AATCTTTTGCCACTTTTGATTGG + Intronic
1010939830 6:81903644-81903666 ATCCTTTGCTCACTTTTTAATGG - Intergenic
1010952254 6:82050591-82050613 AAGCTTTGTTCATTTTTGAATGG + Intergenic
1010994492 6:82517585-82517607 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1011234492 6:85201240-85201262 AACCTTTGCCCACTTTTTAATGG + Intergenic
1011637776 6:89390335-89390357 ATCCTTTGCTCATTTTTTATTGG - Intronic
1011856937 6:91704861-91704883 AATGTTTTAACACTTTTGATGGG + Intergenic
1012038353 6:94171986-94172008 ATCCTTTGCCCATTTTTGATGGG - Intergenic
1012801529 6:103835215-103835237 ATCCTTTGATCATTTTTTAATGG + Intergenic
1012882287 6:104805027-104805049 ATCCTTTGCCCAATTTTGATGGG - Intronic
1013023224 6:106241374-106241396 AACCTTTGTGCACTGTTGGTGGG + Intronic
1013340963 6:109215289-109215311 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1013676314 6:112466984-112467006 GACAGTTGACCACTTTTGATTGG - Intergenic
1013724828 6:113081579-113081601 AACCTATGATAACTTTTCACTGG + Intergenic
1014066315 6:117130713-117130735 ATCCTTTGCTCACTTTTTAATGG - Intergenic
1014081947 6:117297539-117297561 ATCCTTTGCTCACTTTTTAATGG - Intronic
1014354917 6:120396033-120396055 AAAATTTGCTCAGTTTTGATGGG - Intergenic
1014359698 6:120462368-120462390 AACTTTTGCTCAGTTTTAATTGG + Intergenic
1014391411 6:120870894-120870916 AACCCTTAAACACTGTTGATGGG + Intergenic
1014588035 6:123225261-123225283 AACTCTTGTTCACTTTTGATGGG + Intronic
1014730650 6:125027764-125027786 AACCTTTGTACACTTTTGGTGGG - Intronic
1014739909 6:125137102-125137124 TACCTTTGACCACTTTTATTAGG + Intronic
1014782700 6:125583089-125583111 AACCCTTGTACACTGTTGATGGG - Intergenic
1015080769 6:129223163-129223185 ATCCTTTGCCCAATTTTGATGGG + Intronic
1015673780 6:135722310-135722332 AACCTTTGATTACTTAACATTGG + Intergenic
1016366073 6:143320246-143320268 AACCCTTGTACACTGTTGATGGG + Intronic
1017415092 6:154211719-154211741 GACATTTGTTCACTTTTAATAGG + Intronic
1017477177 6:154808945-154808967 AACCTTTGTTCTGTTTTAATTGG + Intronic
1018250077 6:161860750-161860772 ATCCTTTGTCCTCTTTTGATGGG - Intronic
1020504762 7:8970724-8970746 AACATTTTATCACTTTAGAAAGG + Intergenic
1021042034 7:15873885-15873907 AACATTTGCTCACTTTTGAGGGG - Intergenic
1021093301 7:16508036-16508058 AACACTTGTACACTTTTGATGGG + Intronic
1021192322 7:17635345-17635367 GAACTTTGAGCACCTTTGATAGG - Intergenic
1021227123 7:18041301-18041323 AATCTTTGTTTACTTTTCATTGG + Intergenic
1022139333 7:27479558-27479580 ATCCTTTGCCCACTTTTGAATGG - Intergenic
1022749534 7:33209552-33209574 AACCTTCTAACACTATTGATGGG - Intronic
1022762944 7:33376867-33376889 ATCCTTTGCTCACTTTTTAATGG + Intronic
1023041248 7:36175079-36175101 AACCGTTGATCCCCTTTGACTGG + Intronic
1023206422 7:37755280-37755302 AACCTTTGTACACTATTGGTGGG - Intronic
1024029008 7:45440695-45440717 AACCTTTGTACACTGTTGGTGGG + Intergenic
1024498769 7:50077772-50077794 AACCCTTGTACACTGTTGATGGG + Intronic
1024683696 7:51720895-51720917 AACCCTTGAGCACTGTTGGTGGG - Intergenic
1025621260 7:63173485-63173507 ATCCTTTGCCCACTTTTGAATGG + Intergenic
1026563441 7:71469615-71469637 AACACTTGACCACTGTTGATTGG + Intronic
1027421964 7:78025651-78025673 GAACTTTGATCAGTTTTGAGAGG + Intronic
1027808578 7:82862330-82862352 AACCCTTGTTCACTGTTGGTGGG + Intronic
1027820620 7:83039045-83039067 AGCCTTTGCTCATTTTTGAGTGG + Intronic
1028081241 7:86579714-86579736 ATTCTTTGCCCACTTTTGATGGG - Intergenic
1028167727 7:87557632-87557654 AAAATTTGATCATTTTTGCTAGG + Intronic
1028787169 7:94808660-94808682 ATCCTTTGACCACTTTTTAATGG - Intergenic
1029009799 7:97247296-97247318 AACCCTTGCACACTGTTGATGGG + Intergenic
1029808496 7:103021653-103021675 ATCCTTTGCCCATTTTTGATGGG - Intronic
1031185912 7:118480188-118480210 AAATTTTTTTCACTTTTGATAGG + Intergenic
1031234426 7:119155725-119155747 ATCCTTTGCTCACTTTTTAATGG - Intergenic
1031433598 7:121705003-121705025 AACCCTTGTACACTGTTGATGGG + Intergenic
1031472742 7:122186679-122186701 AACCTTTGTACACTATTGGTGGG + Intergenic
1031645038 7:124214723-124214745 AAACTTTGTTCAGTTTTTATGGG + Intergenic
1031756556 7:125651107-125651129 AACCCTTGTTCACTGTTGGTGGG + Intergenic
1031853425 7:126892981-126893003 GTCCTTTGCCCACTTTTGATGGG - Intronic
1032541237 7:132704866-132704888 AACCCATGAGCACTTTAGATTGG + Intronic
1032768351 7:135022485-135022507 ATCCTTTGCTCACTTTTGGATGG + Intronic
1033372355 7:140721449-140721471 AACCTATTTTCACTTTTGTTTGG - Intronic
1034033400 7:147792811-147792833 AACCTTTATACACTGTTGATGGG - Intronic
1035018370 7:155785983-155786005 AACCCTTGAGCACTGTTGGTGGG - Intergenic
1036055002 8:5241967-5241989 GTCCTTTGCTCACTTTTAATGGG - Intergenic
1036273312 8:7327600-7327622 ATCTTTTGCTCACTTTTGATGGG - Intergenic
1036348036 8:7982752-7982774 ATCTTTTGCTCACTTTTGATGGG + Intergenic
1036510954 8:9399691-9399713 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1036843331 8:12143228-12143250 ATCTTTTGCTCACTTTTGATGGG + Intergenic
1036864695 8:12385543-12385565 ATCTTTTGCTCACGTTTGATGGG + Intergenic
1037170574 8:15886901-15886923 AACCTTGGATCACTTCTGAAAGG - Intergenic
1037997258 8:23361914-23361936 AACCCTTGTGCACTGTTGATGGG + Intronic
1038135940 8:24785842-24785864 AACCCTTGTGCACTATTGATGGG + Intergenic
1038878020 8:31573692-31573714 AACCCTTGTTCACTGTTGGTGGG + Intergenic
1039160809 8:34617259-34617281 AACCCTTGCACACTTTTGTTTGG - Intergenic
1040048772 8:42990944-42990966 AATCTTTGATCCATTTTGATTGG + Intronic
1040883853 8:52237883-52237905 GTCCTTTGCCCACTTTTGATTGG - Intronic
1041077367 8:54181282-54181304 AACCCTTGCACACTTTTGATAGG + Intergenic
1041154425 8:54970565-54970587 AACCCTTGAACACTGTTGGTGGG + Intergenic
1041364562 8:57087865-57087887 AACCCTTGTACACTGTTGATAGG + Intergenic
1041747133 8:61219969-61219991 ATCCTTTGCCCACTTTTTATGGG + Intronic
1042366049 8:67938059-67938081 ATCTTTTGTCCACTTTTGATGGG + Intergenic
1042615692 8:70646369-70646391 ATCCTTTGCCCACTTTTGATGGG - Intronic
1042726334 8:71881672-71881694 AACCTTTGTACACTTTTGATGGG - Intronic
1043307363 8:78812505-78812527 AACATTTGAACACTGTTGGTAGG - Intergenic
1043567848 8:81568509-81568531 AACCCTTGAACACTGCTGATGGG + Intergenic
1043814943 8:84790850-84790872 AACAGTTGACCACCTTTGATTGG + Intronic
1044268322 8:90209485-90209507 ATCCTTTGCCCACTTTTTATAGG - Intergenic
1044269049 8:90218758-90218780 AACTTTTGTGCACTGTTGATGGG - Intergenic
1044468209 8:92532880-92532902 ATCCTTTGGTCACTTTTTAATGG - Intergenic
1044471927 8:92580560-92580582 AACTTTTGATGACTTTTCATTGG + Intergenic
1044584058 8:93852585-93852607 AACCTTTGCACACTGTTGGTGGG + Intergenic
1044766356 8:95579449-95579471 GTCCTTTGATCATTTTTAATTGG - Intergenic
1044767190 8:95588849-95588871 ATCCTTTGTTCACTTTTTCTTGG + Intergenic
1045646573 8:104305386-104305408 AACCTATGATCATTTTAGAGAGG + Intergenic
1045718774 8:105080908-105080930 ATCCTTTGCCCACTTTTAATGGG - Intronic
1045851263 8:106701329-106701351 AACTTTTTTTCACTTGTGATTGG + Intronic
1046086394 8:109441682-109441704 AAGCTATGATCAATTTTAATTGG - Intronic
1046148557 8:110193516-110193538 ATCCTTTGCTCACTTTTTAATGG + Intergenic
1046620092 8:116520078-116520100 AACATTTGGCCACTTTTGAGAGG - Intergenic
1046882805 8:119328899-119328921 AACCCTTGAACACTTTGGATGGG + Intergenic
1047158245 8:122346581-122346603 AACCCTTGTGCACTGTTGATGGG + Intergenic
1047382873 8:124380207-124380229 AACCCTTGTACACTGTTGATGGG - Intergenic
1047681824 8:127261510-127261532 AACCTTTGCACGCTTTTGATGGG - Intergenic
1048470691 8:134701621-134701643 AACCTTTGTTCACTGTTTGTTGG - Intronic
1048582161 8:135738420-135738442 AGCCTTTGCCCTCTTTTGATGGG + Intergenic
1048858933 8:138708958-138708980 ATCCTTTGCCCATTTTTGATGGG - Intronic
1048933066 8:139331563-139331585 AACCTTTGGACACTGTTGGTGGG - Intergenic
1049161086 8:141098338-141098360 ATCCTTTGCTCACTTTTTAATGG + Intergenic
1050041102 9:1494712-1494734 AACCCTTGTACACTGTTGATGGG - Intergenic
1050047859 9:1566897-1566919 AACCTTTGTACACTGTTGGTGGG - Intergenic
1050186191 9:2976946-2976968 AACCCTTGAGCACTGTTGGTGGG + Intergenic
1050293209 9:4178368-4178390 GACCTATGATCACTTATGAACGG + Intronic
1050400706 9:5250577-5250599 ACCCTTAGCCCACTTTTGATGGG - Intergenic
1050645795 9:7718218-7718240 ATCCTTTGCCCACTTTTGATGGG - Intergenic
1050898917 9:10920190-10920212 AACCGTTGTACACTTTTGGTGGG + Intergenic
1050924421 9:11245677-11245699 ATCCTTTGCCCACTTTTTATTGG + Intergenic
1051642206 9:19233879-19233901 AGCCTTTGAAAACTTTTTATTGG + Intronic
1051985862 9:23086259-23086281 ATCCTTCCCTCACTTTTGATGGG - Intergenic
1052118989 9:24685347-24685369 ATCATTTGATCATTTTTAATTGG + Intergenic
1052250045 9:26387668-26387690 AACCTTTGCCCACTTTTAAATGG + Intergenic
1052262473 9:26533446-26533468 AACCCTTGCACACTGTTGATGGG + Intergenic
1052381801 9:27779676-27779698 ATCCTTTGCCCATTTTTGATGGG + Intergenic
1052507994 9:29379889-29379911 AACCTTTTATAATTTTTGTTAGG - Intergenic
1052611312 9:30777856-30777878 AACCTTTGTACACTGTTGGTGGG + Intergenic
1053436415 9:38078035-38078057 AACCTCTGCACACTGTTGATGGG - Intergenic
1054853098 9:69869026-69869048 AACCCTTGAACACTGTTGGTGGG + Intronic
1055395743 9:75873198-75873220 AACCTTTGTACACTGTTGGTGGG + Intergenic
1055556471 9:77478848-77478870 ATCCTTTGCCCATTTTTGATGGG + Intronic
1055674911 9:78648275-78648297 AACGTTTGTACACTGTTGATGGG + Intergenic
1055888797 9:81099825-81099847 ATCCTTCGCTCATTTTTGATTGG + Intergenic
1056012826 9:82350465-82350487 CACCTTTGATCACCTTGGGTGGG - Intergenic
1056033490 9:82579312-82579334 AATCTTTGATCCATTTTGAGTGG + Intergenic
1056147825 9:83751854-83751876 AACCTTTGTTCACTCCTGGTGGG + Intronic
1056228785 9:84523897-84523919 AACCTTTGTACACTGTTAATGGG - Intergenic
1056349459 9:85734636-85734658 AATCTTTGTGCACTATTGATAGG + Intronic
1056680550 9:88714036-88714058 AACCTTTAAAAATTTTTGATGGG + Intergenic
1058042953 9:100324348-100324370 ATCATTTTATCACTTTTCATAGG - Intronic
1058044832 9:100346615-100346637 AACCATTGATGACTGTTGGTGGG - Intronic
1058093581 9:100833508-100833530 AAGCTTGTATCTCTTTTGATGGG + Intergenic
1058557821 9:106188755-106188777 ATCCTTTGCTCACTTTTTAATGG + Intergenic
1058631863 9:106997205-106997227 AACCCTTGTGCACTGTTGATAGG + Intronic
1060026728 9:120178423-120178445 ATCCTTTGCTCACTTTTTAATGG + Intergenic
1060034773 9:120245341-120245363 AACCCTTGCCCACTTTTGATGGG + Intergenic
1060253902 9:122008591-122008613 AACCTTTGCACACTGTTGGTGGG + Intronic
1060425505 9:123501574-123501596 AACCTTTGGGTACTGTTGATGGG - Intronic
1060714895 9:125916278-125916300 AAGCTTTAATCACTTTTGAAGGG + Intronic
1062153903 9:135035491-135035513 AACCTTTGGGCACTGCTGATGGG - Intergenic
1186369594 X:8932984-8933006 ATCCTTTGCCCATTTTTGATGGG + Intergenic
1186564237 X:10645423-10645445 AACAGTTGGTCACCTTTGATTGG + Intronic
1187201434 X:17137445-17137467 ACCCTTTGCCCACTTTTAATTGG + Intronic
1187571103 X:20503035-20503057 AACCCTTGCACACTATTGATGGG - Intergenic
1187630945 X:21171308-21171330 AACCTTTGCACACTGTTGGTAGG + Intergenic
1187640282 X:21280276-21280298 GTCCTTTGACCACTTTTGAATGG + Intergenic
1187936383 X:24340232-24340254 AACCTTCAAACACTGTTGATAGG + Intergenic
1187941710 X:24388942-24388964 AACCCTTGTGCACTGTTGATGGG - Intergenic
1188036616 X:25325100-25325122 AACCCTTGAACACTGTTGGTGGG - Intergenic
1188287724 X:28348660-28348682 AACCATTGCTCACTGTTGCTAGG - Intergenic
1188428908 X:30082985-30083007 AACGTTTGTTCATTTTTAATTGG + Intergenic
1188990212 X:36809720-36809742 AACCTTTGTACACTGTTGGTGGG - Intergenic
1190373997 X:49771083-49771105 AACCTTTGCACACTGTTGGTGGG - Intergenic
1190530846 X:51374538-51374560 AACCTTTGTACACTGTTGGTGGG + Intergenic
1190854702 X:54282383-54282405 AACCCTTGTACACTGTTGATGGG - Intronic
1190893235 X:54589848-54589870 AACCCTTGCACACTGTTGATGGG - Intergenic
1191074936 X:56442773-56442795 ATCCTTTGCCCACTTTTTATGGG - Intergenic
1191261473 X:58326732-58326754 ATCCTTCGCCCACTTTTGATGGG - Intergenic
1191608407 X:63085823-63085845 AACTTTTGATGACTTTCCATTGG - Intergenic
1191881959 X:65851519-65851541 ACCCTTTGCCCACTTCTGATGGG + Intergenic
1191961220 X:66704365-66704387 ATCCTTTGCCCACTTTTAATTGG - Intergenic
1192074191 X:67974273-67974295 AACCTTCGTACACTTTTGATGGG + Intergenic
1192091851 X:68167377-68167399 AACCTTTGTACACTCTTGGTAGG + Intronic
1192507283 X:71696151-71696173 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192512580 X:71732380-71732402 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1192514117 X:71749129-71749151 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192519413 X:71785401-71785423 AACCTTTGTGCACTGTTGGTGGG - Intergenic
1192526823 X:71853634-71853656 AACCTTTGTGCACTGTTGGTGGG + Intergenic
1192696922 X:73426587-73426609 ATCCTTTGCACACTTTTTATGGG - Intergenic
1193190530 X:78564796-78564818 AACCTTTGTACACTGTTGGTGGG - Intergenic
1193356583 X:80526087-80526109 ATCCTTTGACCACTTTTGGATGG + Intergenic
1193430781 X:81401511-81401533 ATCTTTTGATCATTTTTAATAGG + Intergenic
1193754981 X:85397648-85397670 ACTCTTTAATCAATTTTGATTGG + Intergenic
1193782360 X:85719310-85719332 ATCCTTTGCCCACTTTTGGTTGG - Intergenic
1193989858 X:88293269-88293291 AACCCTTGTACACTTTTGGTAGG + Intergenic
1194245407 X:91505390-91505412 ATCCTTTGTTCACTTTTTATTGG - Intergenic
1194599220 X:95899917-95899939 AACATTTGGCCACTTCTGATTGG + Intergenic
1194631043 X:96284435-96284457 AACCCTTGAACACTGTTGGTGGG + Intergenic
1195097607 X:101519780-101519802 AACCCTTGCACACTGTTGATGGG - Intronic
1195163224 X:102191880-102191902 ATCCTTTGCCCATTTTTGATGGG + Intergenic
1195169706 X:102254484-102254506 AACCCTTGTACACTGTTGATGGG - Intergenic
1195189151 X:102432616-102432638 AACCCTTGTACACTGTTGATGGG + Intronic
1195355460 X:104035412-104035434 ATCCTTTGCCCACATTTGATGGG + Intergenic
1195547641 X:106130881-106130903 TACCCTTGAACACTGTTGATGGG + Intergenic
1195632699 X:107075761-107075783 AACCCTTGTGCACTGTTGATGGG + Intronic
1195894948 X:109736212-109736234 TGCCTTTGATCATTTTTGAAAGG - Intergenic
1195953189 X:110300139-110300161 AACCTTTGTACACTGTTGGTTGG - Intronic
1196362735 X:114884684-114884706 AACCCTTGCACACTTTTGGTGGG + Intronic
1196387708 X:115176279-115176301 AACCATTGTACACTATTGATGGG - Intronic
1196982004 X:121224759-121224781 AACCCTCGTGCACTTTTGATAGG - Intergenic
1196985741 X:121268271-121268293 AACCCTTGTACACTCTTGATGGG - Intergenic
1197003857 X:121472755-121472777 ATCCTTTGCTCATTTTTGATGGG + Intergenic
1197044822 X:121982737-121982759 AGCCTTTGCTCACTGTTGATGGG + Intergenic
1197126271 X:122949767-122949789 AACCCTGGTACACTTTTGATGGG - Intergenic
1197320531 X:125023900-125023922 ATCCTTTGCCCACTTTTTATTGG - Intergenic
1197430281 X:126354224-126354246 AATCTTTGTGCACTGTTGATGGG + Intergenic
1197430554 X:126358074-126358096 ATCCTTTGCCCAATTTTGATGGG - Intergenic
1197442111 X:126504506-126504528 AATATTTTATCACTTTTCATAGG + Intergenic
1197526765 X:127574358-127574380 AACCCTTGTACACTGTTGATGGG - Intergenic
1197587072 X:128361846-128361868 AACCGTTGAACATTTTTGGTGGG - Intergenic
1197862005 X:130980666-130980688 AACCTTTGTACACTGTTGGTGGG + Intergenic
1197948546 X:131868946-131868968 AACCCTTGTGCACTTTTGGTAGG + Intergenic
1198008729 X:132527800-132527822 GTCCTTTGCCCACTTTTGATGGG + Intergenic
1198228353 X:134667345-134667367 ATCCTTTGATCATTTTTAATTGG - Intronic
1198570437 X:137949517-137949539 AACCCTTGAACACTGTTGGTGGG - Intergenic
1198890041 X:141384057-141384079 AACCCTTGTACACTTTTGATGGG + Intergenic
1199003800 X:142672676-142672698 ATCCTTAGCCCACTTTTGATGGG + Intergenic
1199004860 X:142683759-142683781 ATCCTTAGCCCACTTTTGATGGG + Intergenic
1199346214 X:146744486-146744508 AACTCTTGCTCACTGTTGATGGG - Intergenic
1199446855 X:147934401-147934423 ATCCTATTATCACATTTGATAGG - Intronic
1199752972 X:150838656-150838678 AACCTCTGGTGACTTTTGTTGGG - Intronic
1199939050 X:152606653-152606675 ATCCTTTGCCCACTTTTGAAGGG + Intergenic
1200280338 X:154771966-154771988 AACCTTTGTACACTGTTGATGGG - Intronic
1200359484 X:155588652-155588674 ATCCTTTGTTCACTTTTTAACGG - Intronic
1200359697 X:155591727-155591749 AACCCTTGTACACTTTTGGTGGG + Intronic
1200564376 Y:4746694-4746716 ATCCTTTGTTCACTTTTTATTGG - Intergenic
1201167605 Y:11224151-11224173 ATCCTTTGCCCACTTTTCATTGG + Intergenic
1201459426 Y:14206003-14206025 ATCCTTTGCCCACTTTTGATGGG + Intergenic
1201737215 Y:17281050-17281072 ATCCTTTGCTCAGTTTTGAATGG + Intergenic
1201932487 Y:19366870-19366892 TTCCTTTGACCCCTTTTGATGGG - Intergenic
1202011966 Y:20351291-20351313 ATCCTTTGCTCACTTTTTAGTGG + Intergenic
1202332943 Y:23773822-23773844 ATCCTTTGACCAATTTTGATGGG + Intergenic
1202537826 Y:25896241-25896263 ATCCTTTGACCAATTTTGATGGG - Intergenic