ID: 952911446

View in Genome Browser
Species Human (GRCh38)
Location 3:38191569-38191591
Sequence CAGGTTAAATATTTTGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952911442_952911446 26 Left 952911442 3:38191520-38191542 CCTCTATTTCTTGTATATTGAAA 0: 1
1: 0
2: 6
3: 36
4: 498
Right 952911446 3:38191569-38191591 CAGGTTAAATATTTTGTAGGAGG 0: 1
1: 0
2: 0
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952911446 Original CRISPR CAGGTTAAATATTTTGTAGG AGG Intronic
903503998 1:23819977-23819999 CAACTTAAATATTTAGTATGAGG - Intronic
903816856 1:26070269-26070291 CAGGTAAAATAACTTGTATGAGG + Intergenic
907596296 1:55723160-55723182 CAAGTTAAATAGTTTGTCTGTGG - Intergenic
907651296 1:56297249-56297271 CAGCTTAAATATTTTCTCTGTGG + Intergenic
908117972 1:60959626-60959648 CATTTTTAATATTTGGTAGGTGG + Intronic
908282503 1:62555840-62555862 TAGGGTAAGTATTTGGTAGGCGG + Exonic
908491648 1:64650396-64650418 CAGGATAAATAGGTTGTAAGCGG - Intronic
909124904 1:71655543-71655565 CAGAATAAAAATTTTGCAGGAGG + Intronic
909965431 1:81903949-81903971 CAATTTAAATATTTTTTTGGTGG + Intronic
910000085 1:82331063-82331085 GAGGTTAAATATTCTTTGGGTGG - Intergenic
910180503 1:84477907-84477929 CAGGGTAAGTCTTGTGTAGGTGG - Intergenic
910720059 1:90275838-90275860 AAGGTCAAAATTTTTGTAGGTGG - Intergenic
911297574 1:96136359-96136381 CTTGTGAAATATTTTATAGGAGG - Intergenic
917989696 1:180361219-180361241 AAGGTTTAATAAATTGTAGGTGG + Intronic
918192037 1:182185038-182185060 GAGGTTAGATATCTTGTACGAGG + Intergenic
918293634 1:183134068-183134090 CAGGTAAAATATTTTGGAATTGG + Intronic
918553252 1:185768876-185768898 GAGGTTAAATATTTTGTTCAAGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922488726 1:225998507-225998529 CAGGTTTAATATCTTATAGCTGG + Intronic
923022879 1:230178485-230178507 CAAGTTAAAACTTTTATAGGAGG + Intronic
924768950 1:247062429-247062451 AAGGTAAAATATTTTCGAGGAGG - Intronic
924827714 1:247558745-247558767 CAGGTAAAATATTATTTAGAGGG - Intronic
1064320646 10:14301314-14301336 CAGGTTCATTAGTTTGTAGAAGG - Intronic
1065992629 10:31028102-31028124 CTGGTGATATATATTGTAGGTGG - Intronic
1066325993 10:34358996-34359018 TAGTTTTATTATTTTGTAGGTGG - Intronic
1068899522 10:62251216-62251238 AAGGGTAAATATTTTGAAAGAGG + Intronic
1071044092 10:81352366-81352388 CAGTTTAATTCTTTTGTATGTGG + Intergenic
1074983002 10:118634679-118634701 CTGGTTAAATTTTTTGTTGTGGG + Intergenic
1075492461 10:122884092-122884114 TAGTCAAAATATTTTGTAGGAGG - Intergenic
1078170779 11:8927463-8927485 CAGGTCAAAAATTTGGTAGGAGG - Intronic
1078261544 11:9714304-9714326 CAGGTTAAATAATTTGTCCAAGG - Intronic
1079660107 11:23027206-23027228 CACATTTAATATTTTGTAGATGG + Intergenic
1080473416 11:32568238-32568260 TTGGTTAAATATTTTTTAAGTGG + Intergenic
1081511037 11:43773784-43773806 TAGGAAAAACATTTTGTAGGTGG - Intronic
1086051682 11:82599365-82599387 GAGGTTAAATAATTTGCATGAGG - Intergenic
1086188694 11:84051838-84051860 GAGGATTAATATTTTGTAAGTGG + Intronic
1086299114 11:85405668-85405690 GAGGTTAAATATTTTGTTCAAGG + Intronic
1086486940 11:87315351-87315373 CAGGTTTAAATTTTTGTAGGAGG + Intronic
1089980801 11:122770753-122770775 CAGCTTGAATATTTAGTGGGTGG - Intronic
1090420170 11:126569345-126569367 GAGGGTAAACATTTTGTTGGGGG + Intronic
1090821363 11:130345178-130345200 GAGGCTTAATATTTTGGAGGTGG + Intergenic
1092733199 12:11553877-11553899 AGAGTTAAGTATTTTGTAGGAGG + Intergenic
1092829623 12:12431209-12431231 CATGAAAAATACTTTGTAGGTGG - Intronic
1094546662 12:31410743-31410765 AAAGTTAAATATTTTGTCCGAGG + Intronic
1094784533 12:33831131-33831153 CAGGTTAATTATTTAATAAGAGG + Intergenic
1095181289 12:39149440-39149462 CAGTTCAAATAGTTTTTAGGTGG + Intergenic
1095701727 12:45197465-45197487 CAGGCTAATTATTTTGTAGAAGG + Intergenic
1095758901 12:45804752-45804774 AAGGTTAAATTTTTTGGAGGTGG - Intronic
1097538861 12:60910161-60910183 CAGCTTGAATATCTTGAAGGTGG + Intergenic
1097785793 12:63757466-63757488 CAGGTTATATATTTTAAAGCTGG + Intergenic
1098104284 12:67053125-67053147 TAGGTTAAATAGTCTGCAGGAGG + Intergenic
1098118062 12:67201832-67201854 GAGGTAAAATATTCTGAAGGAGG - Intergenic
1099240503 12:80132848-80132870 CAGGTTGAACATTATGAAGGTGG + Intergenic
1100729329 12:97446669-97446691 CAGGCTAAATAGTTGCTAGGTGG - Intergenic
1104036119 12:125098127-125098149 CAGATTAAATATTCTTTAGAGGG + Intronic
1105477681 13:20742644-20742666 CAGAATAATTATTATGTAGGAGG - Intronic
1106694135 13:32152573-32152595 GAGGTTCAGTATTTTGCAGGTGG - Intronic
1107116194 13:36748431-36748453 CAGTTTTAATATTTTGCATGTGG + Intergenic
1107619067 13:42206244-42206266 CATGTTAAATATTTTGCATTGGG + Intronic
1108073425 13:46653493-46653515 CATGTAAAAAATTTTATAGGAGG - Intronic
1108117396 13:47144526-47144548 CAGGTCACATGTTTTGTAAGTGG - Intergenic
1108176114 13:47794588-47794610 CAGGTTAAGTAGTTTCAAGGTGG - Intergenic
1108982113 13:56527977-56527999 CAGGTTAAAAATTGAGGAGGGGG - Intergenic
1110336135 13:74332863-74332885 CATGTTAAATAATTTGCAAGAGG - Intergenic
1111807903 13:93060790-93060812 CATCTTAAATATTTTGCACGTGG + Intergenic
1112235429 13:97631499-97631521 CAGGAAAAATATTTGGTAAGTGG - Intergenic
1113282840 13:108809240-108809262 CAGGTCAAATGTTTTGTAGCTGG - Intronic
1116851679 14:49915146-49915168 CAGGTTAAATAATTTGCATTTGG + Intergenic
1119078225 14:71666178-71666200 CAGATTTAATTTTTTTTAGGGGG - Intronic
1121578092 14:95004872-95004894 CATTTTCAATATTTTCTAGGTGG + Intergenic
1121805454 14:96816314-96816336 TTGGCTAAGTATTTTGTAGGTGG - Intronic
1121919789 14:97869963-97869985 CATTTAAAATATTTTGTAGATGG + Intergenic
1126157580 15:45579839-45579861 CAGATTAAATGGTTAGTAGGAGG - Intergenic
1126220553 15:46208220-46208242 CACGTAAAAAATTTTGCAGGAGG - Intergenic
1127635343 15:60864113-60864135 CATTTTTTATATTTTGTAGGAGG + Intronic
1127759747 15:62126998-62127020 CAGCAAAAATATTTTGGAGGGGG + Intergenic
1127924565 15:63526561-63526583 CACTTTAAAAATTGTGTAGGCGG + Intronic
1128113495 15:65091140-65091162 CATTTAAAATATTTTTTAGGAGG - Intergenic
1129284258 15:74511365-74511387 CAGGCCAGATATTTTGTATGAGG + Intergenic
1131303399 15:91219579-91219601 TAGGTTAAATATTTTTTTGGGGG + Intronic
1138740467 16:59303352-59303374 AAGGTTAAATAATTTGTCTGAGG - Intergenic
1139959764 16:70710816-70710838 CTGGTTAAATAATTTGGGGGAGG - Intronic
1140488697 16:75316089-75316111 CAGGTTAAATATTTTTGCTGAGG + Intronic
1147136590 17:38437625-38437647 CAGCTTTAATATTTTTTGGGGGG - Intronic
1149096192 17:52843857-52843879 CAAGTCAAACATTTTTTAGGGGG - Intergenic
1149177500 17:53891586-53891608 CAGATTAAATATTTTTGAGTTGG + Intergenic
1151136546 17:71951448-71951470 CAAGATAATTATTTTCTAGGTGG + Intergenic
1153840073 18:8999436-8999458 CAGGTTAAGTAATTTGCAGAGGG + Intergenic
1155012048 18:21789003-21789025 CAGGTTTAATATTGTTTAGATGG + Intronic
1155046522 18:22108378-22108400 CTGGCTAATTTTTTTGTAGGGGG + Intergenic
1155092179 18:22522985-22523007 AAAGTTAAGTATTATGTAGGAGG - Intergenic
1155991199 18:32281136-32281158 GAGGTTAAATATTTTGTGCAAGG + Intronic
1159792695 18:72802880-72802902 CAGTTTTAATATTCTGTAAGAGG + Intronic
1167172864 19:47844923-47844945 CAGGTTAAGATTTTTGTTGGGGG + Intergenic
925571718 2:5319386-5319408 CAGGTTACATGCTCTGTAGGGGG - Intergenic
925772760 2:7299484-7299506 CAGGTTGCATATTTTGGAAGAGG + Intergenic
927051056 2:19329684-19329706 TACGTTAAATATTTTTTGGGGGG - Intergenic
935837384 2:107069728-107069750 CATTTAAAATATTTTGCAGGTGG - Intergenic
937598008 2:123693218-123693240 CATGTTACATCTTTTGTAGCTGG - Intergenic
938835889 2:135103707-135103729 CAGGTTTAATTCTTTGTTGGCGG + Intronic
939970401 2:148652505-148652527 AAGGTTAAATAATTTCTACGCGG - Intronic
941185482 2:162317457-162317479 CAGGTTAAATAATTTGTCCAAGG - Intronic
944427319 2:199596847-199596869 CATTTTACATATTTTGTAGAAGG + Intergenic
945007108 2:205420405-205420427 AAGGTTAAATAATTTGTCCGTGG + Intronic
945276007 2:207988339-207988361 CAGGTTAAATAATTTGTCAGCGG - Intronic
945428117 2:209732940-209732962 CAGGTTAAATATCTTCTTGTGGG + Exonic
946886113 2:224225175-224225197 CAAGTTATATATTTAGAAGGTGG - Intergenic
1171306931 20:24114707-24114729 CAGGTGAAATATTTCAGAGGTGG - Intergenic
1173452526 20:43177689-43177711 TATGTTAAATATTTCGTATGTGG + Intronic
1173589570 20:44214068-44214090 AAGGTTACATAGTTTGTAAGTGG + Intergenic
1173673893 20:44817267-44817289 CACGTTAAGTATTTTATATGTGG - Intergenic
1175479989 20:59303967-59303989 CAGGTAAAATAATTTTTATGAGG + Intronic
1175752273 20:61507598-61507620 CGGGTCAGGTATTTTGTAGGAGG - Intronic
1177931439 21:27289147-27289169 CAGGGTAAATATGTTTTAGTTGG - Intergenic
1178015110 21:28335767-28335789 ATGTTTAAATATTTTGAAGGTGG + Intergenic
950877024 3:16285120-16285142 AAGGTTAGGTATTTTGCAGGAGG + Intronic
951075118 3:18381519-18381541 CAGGTTAAACAATTTGTTGGTGG + Intronic
951121920 3:18939087-18939109 CAGGTCAAATCTGTTATAGGTGG + Intergenic
951488804 3:23245885-23245907 CAGGTCAAATAATTGGTGGGAGG - Intronic
952083320 3:29787321-29787343 CTGGGTAAATATGTAGTAGGGGG - Intronic
952151842 3:30601834-30601856 AAGGTTAAATAATTTGCAGGTGG - Intergenic
952723657 3:36559510-36559532 AAGGTTAAATAATTTGTCCGAGG - Intergenic
952911446 3:38191569-38191591 CAGGTTAAATATTTTGTAGGAGG + Intronic
953330046 3:42045196-42045218 GAGGGTAAAAATTTTGAAGGAGG + Intronic
953343751 3:42157644-42157666 CAGGCCAACTATTTTGTAGAAGG - Intronic
955105614 3:55895126-55895148 AAGGTCAAAGATCTTGTAGGTGG - Intronic
956403015 3:68899921-68899943 AAGGTTAAATGTCTTTTAGGTGG - Intronic
957281860 3:78161258-78161280 CAGGCTGAAGATTTTGGAGGAGG - Intergenic
957828917 3:85489724-85489746 CACGTTAAATAATTTTTAGAAGG - Intronic
958884431 3:99709951-99709973 CAGGCTATTTATTTTGTTGGAGG + Intronic
960197039 3:114781389-114781411 CCTGTTAAACATTTTGCAGGGGG + Intronic
960855272 3:122096026-122096048 CAGGTTACATATTTTGGAAATGG - Intronic
960865548 3:122195699-122195721 CAGGTTAAGTGATTTGTATGAGG + Intronic
961099555 3:124186947-124186969 CAGGTGATTTATTTTGAAGGGGG + Intronic
961590134 3:127973159-127973181 CAAGTTAAGTATTTTGGTGGTGG - Intronic
963329061 3:143894071-143894093 CTGGTTAAATATGTAGTAAGAGG - Intergenic
964139015 3:153377056-153377078 CATTGTAAATATTTTGTATGTGG - Intergenic
964903415 3:161689136-161689158 CAGTATAAATATTTTGTTGCAGG - Intergenic
966568331 3:181408948-181408970 CACGTTAAATATCTTGTAGAAGG + Intergenic
968838562 4:2983056-2983078 CAGTTGAAATATTGAGTAGGGGG + Intronic
969380391 4:6792434-6792456 CATGTTAAAAATTTTCTTGGTGG + Intronic
969832619 4:9809933-9809955 CAGGTAACCTATTTTATAGGTGG + Intronic
974057562 4:56999255-56999277 GAGGTTTAATTTTTTGGAGGGGG + Intronic
974221175 4:58973596-58973618 CAGTTTAAATCTTCTGTATGTGG + Intergenic
976700429 4:87964528-87964550 CAGATCAAATATTGTGTGGGAGG - Intergenic
977173194 4:93787912-93787934 CAGGGAAAATATTTTGTATGTGG + Intergenic
977902989 4:102443793-102443815 CAGTCTAAATATTTAGTAGGAGG - Intergenic
978118079 4:105046101-105046123 CAGATTACTTACTTTGTAGGAGG - Intergenic
979007353 4:115317236-115317258 CAGATTTAACATTTTGTAAGTGG - Intergenic
979303089 4:119109858-119109880 TAGGTTAAATATGTTGTTAGTGG + Intergenic
981284552 4:143000771-143000793 AGGGTTAAATATTTTGTGAGAGG - Intergenic
981957831 4:150500933-150500955 CAAGCTTAATATTTAGTAGGAGG - Intronic
982010578 4:151102033-151102055 CAGTTCGAATATTTTGTATGTGG + Intronic
983709786 4:170699622-170699644 CAGGTTCCATATTTGGTAGACGG + Intergenic
985392769 4:189507825-189507847 CAGGTTTACTATTTTGCATGTGG + Intergenic
986454658 5:7904155-7904177 CTGGTCAGGTATTTTGTAGGAGG + Intronic
986697393 5:10369991-10370013 CAGGTTAAATATATATTAGTAGG + Intronic
986843075 5:11720588-11720610 CAAGTTACATATGTTGCAGGTGG - Intronic
989791224 5:45403909-45403931 CAGGGTTAAAATTTTGTAAGTGG + Intronic
990755439 5:59064241-59064263 AAAGTTTAATATTTTGAAGGGGG - Intronic
992112768 5:73511847-73511869 CATCTTAAATATTTTATAGTTGG + Intergenic
993318788 5:86445791-86445813 CAAGGTAAATATTGTGAAGGGGG + Intergenic
994831633 5:104790650-104790672 CAGATAAAACATTTTGGAGGTGG + Intergenic
995651098 5:114369392-114369414 CAGTTAAAAAATTTTGGAGGAGG + Intronic
996046589 5:118881105-118881127 CATGTTAAGTATTTTGTTGCAGG - Intronic
996201875 5:120685665-120685687 CAGGTTTCATATTTTATGGGTGG + Intronic
997534615 5:134609114-134609136 CAGGTCAGATATTTTGTAAAGGG - Intronic
998277343 5:140769357-140769379 AAGGTTAAAGAATTTGCAGGTGG - Intergenic
999859486 5:155630498-155630520 CAAGTTAAAAATTTTGCATGTGG + Intergenic
1001617394 5:173054077-173054099 CAGGTTAAACACTTTGGAAGTGG + Intergenic
1003781851 6:9437483-9437505 TAGGATATATATTTTTTAGGGGG + Intergenic
1004297298 6:14424849-14424871 AAGGTTAAATATTTTCTCTGGGG - Intergenic
1005343706 6:24868442-24868464 AAAGGTAAATATTTTCTAGGTGG + Intronic
1005720494 6:28596816-28596838 ATGGTTAAGTATTTTGTTGGGGG + Intronic
1007016129 6:38468902-38468924 AAAGTTAAATATTTTGGATGGGG - Intronic
1007541218 6:42646674-42646696 CAGATCAGATATGTTGTAGGGGG - Intronic
1008242805 6:49132498-49132520 GAGGTAAAACATTTTGTAAGTGG + Intergenic
1008247518 6:49196074-49196096 CAGATTAAATATGTTTTATGTGG + Intergenic
1008627010 6:53326661-53326683 CAGGTTAAATAATTTGTATTTGG - Intronic
1009883446 6:69597528-69597550 CAGGGTAATTATTTTGTTGAAGG - Intergenic
1010069581 6:71727643-71727665 AAGTTCAAATATTTTGTAAGTGG - Intergenic
1011966812 6:93169023-93169045 AAGGTCAAATATTTAGGAGGTGG - Intergenic
1012092874 6:94920953-94920975 CAGGCTGAATCTTTTGTTGGGGG + Intergenic
1012739555 6:102998648-102998670 CAGATAAAATATTTTGTCTGTGG + Intergenic
1013864135 6:114674112-114674134 CAGGTTAAATAATTTGTTCAAGG - Intergenic
1014148455 6:118025266-118025288 CAAGTTAGATATTTTGTAGAAGG + Intronic
1014886733 6:126791111-126791133 AAGGTGATATATTTTGAAGGGGG - Intergenic
1014926659 6:127279317-127279339 CAGCTTAATTATTTTGCATGTGG + Intronic
1016286830 6:142483084-142483106 CAGTTTAATTACTTAGTAGGGGG + Intergenic
1016828799 6:148413356-148413378 CAGAAGAAATATTTTGTTGGAGG + Intronic
1020360921 7:7325714-7325736 TAGGTTAGATATTATGTAGGAGG + Intergenic
1020479638 7:8642345-8642367 CATTTCGAATATTTTGTAGGTGG + Intronic
1022731327 7:33029065-33029087 AAAATTAAATATATTGTAGGTGG - Intronic
1027963114 7:84972110-84972132 GAGGTTAAATATCTTGTCTGAGG - Intergenic
1028356462 7:89916276-89916298 GAGGTTAAGTAATTTGTAGAAGG + Intergenic
1028513799 7:91654200-91654222 CAGGAAAAATATTTTTGAGGAGG + Intergenic
1028719222 7:94010632-94010654 CAGGGTAAATATTCTGTGGGTGG - Intergenic
1030881563 7:114886925-114886947 TATGTTATATATTGTGTAGGAGG - Intergenic
1031035285 7:116781727-116781749 CAGGCTAATTTTTTTGTGGGCGG + Intronic
1031544857 7:123038424-123038446 AAGGATAAAAATTTTTTAGGGGG + Intergenic
1032254539 7:130286547-130286569 CTTGTTACATATTTTTTAGGCGG + Intronic
1032862793 7:135896701-135896723 CAGATTAAACATTGTGTCGGGGG + Intergenic
1032910818 7:136427690-136427712 GAGGTTAAACTTTTTCTAGGAGG + Intergenic
1033788752 7:144766190-144766212 CTGGGTAAACTTTTTGTAGGGGG + Intronic
1034585408 7:152087228-152087250 CAGGTTTAATGTTTAGTGGGTGG + Intronic
1036039542 8:5060224-5060246 CTGGTTATTTTTTTTGTAGGGGG - Intergenic
1040578192 8:48672834-48672856 CATGTTACATTTTCTGTAGGAGG + Intergenic
1042140192 8:65670679-65670701 CAGGTTACATAATTTGAATGTGG + Intronic
1043999237 8:86858505-86858527 CAGCTTAATTATTTTGTGGAAGG + Intergenic
1044293821 8:90503889-90503911 CAACTTAAATATAGTGTAGGTGG - Intergenic
1045771551 8:105746416-105746438 AAGGTTAAATATTTTCTAGTGGG + Intronic
1045798617 8:106076353-106076375 CAGGTTAAATTTTTTGAAAATGG - Intergenic
1046088107 8:109464285-109464307 CAGTTTAAATCTTATGTAAGAGG + Exonic
1046202412 8:110944706-110944728 CATGGTAAATATTTTATAAGAGG + Intergenic
1047313900 8:123714892-123714914 CAGGTTAGATAATTTGTTTGAGG + Intronic
1047904790 8:129461001-129461023 CATGTTAATTATCTTGGAGGAGG + Intergenic
1047919448 8:129618844-129618866 AAGGATGAATATTTTGTTGGAGG - Intergenic
1051391139 9:16565256-16565278 CAGGTTAAGGATTTTGTGTGTGG - Intronic
1051654819 9:19369367-19369389 CAGGAAAAATATTTTTTAGTTGG + Intronic
1053030579 9:34773765-34773787 TTGGTCAAATATTTTGCAGGAGG - Intergenic
1057021191 9:91698917-91698939 CAGGTTAAATAATTTATTTGTGG - Intronic
1058218713 9:102268449-102268471 CAGTTTGAATATTTTTTTGGTGG + Intergenic
1058402244 9:104632829-104632851 CAGGGTAAAATTTTTATAGGGGG - Intergenic
1059647528 9:116282029-116282051 AAGGTTTCATATTTTGGAGGAGG - Intronic
1059661272 9:116404078-116404100 CAGTTTAAAAAATTTGGAGGGGG + Intergenic
1059691811 9:116692255-116692277 CAGGTAAAACAATTTCTAGGAGG + Intronic
1187118806 X:16383202-16383224 CACTTTAAATAATTTTTAGGTGG - Intergenic
1187808526 X:23148706-23148728 CACGTTAATTAGTTTGTTGGTGG + Intergenic
1188260508 X:28017291-28017313 CAGGGTAAATGTTTTCTTGGTGG + Intergenic
1189840941 X:45076939-45076961 CAGATTAAATAGTTTGGGGGCGG + Intronic
1191595553 X:62940135-62940157 CAGCTTAAATTTTTTTTGGGAGG - Intergenic
1193654310 X:84181093-84181115 CAGGTTAAAAAATTTGTATTGGG + Intronic
1195033857 X:100952948-100952970 CAACTTAATTATTTTGCAGGTGG - Intergenic
1195287236 X:103396985-103397007 GAGGTTAAATATATTTTACGAGG - Intergenic
1195981178 X:110580079-110580101 CAGGTACATTATTTTATAGGAGG + Intergenic
1197077359 X:122368223-122368245 CAGATTAAATTTTTTATAGAGGG - Intergenic
1197681053 X:129385825-129385847 GAGGTTAAATAATTTGTCGAAGG - Intergenic
1201722986 Y:17122339-17122361 CAGTTTAAATATTTGGTAATCGG + Intergenic