ID: 952914410

View in Genome Browser
Species Human (GRCh38)
Location 3:38222395-38222417
Sequence AACCGAAATCTGCTTCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952914406_952914410 6 Left 952914406 3:38222366-38222388 CCTTGAGAAGATAAGATTGGCTG 0: 1
1: 0
2: 1
3: 14
4: 165
Right 952914410 3:38222395-38222417 AACCGAAATCTGCTTCTCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
952914402_952914410 17 Left 952914402 3:38222355-38222377 CCCCTTGGTTTCCTTGAGAAGAT 0: 1
1: 1
2: 0
3: 12
4: 214
Right 952914410 3:38222395-38222417 AACCGAAATCTGCTTCTCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
952914403_952914410 16 Left 952914403 3:38222356-38222378 CCCTTGGTTTCCTTGAGAAGATA 0: 1
1: 0
2: 2
3: 21
4: 325
Right 952914410 3:38222395-38222417 AACCGAAATCTGCTTCTCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
952914404_952914410 15 Left 952914404 3:38222357-38222379 CCTTGGTTTCCTTGAGAAGATAA 0: 1
1: 0
2: 3
3: 19
4: 249
Right 952914410 3:38222395-38222417 AACCGAAATCTGCTTCTCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952914410 Original CRISPR AACCGAAATCTGCTTCTCAG GGG Intronic
906532220 1:46530451-46530473 AACAGAAACCTGCCTCCCAGAGG + Intergenic
906949836 1:50325924-50325946 AACTGCAATCTGCCTCTCTGAGG - Intergenic
909239349 1:73192285-73192307 AACAGAAATTTGTTTCTCACAGG - Intergenic
911014087 1:93313525-93313547 AACCTAACTATGCTCCTCAGAGG + Intergenic
913997970 1:143667058-143667080 CACAGAAATCTCCTTGTCAGAGG + Intergenic
924462631 1:244272737-244272759 AACCCAAATGGGCTTGTCAGAGG - Intergenic
1062783949 10:244787-244809 AACTGAAATCTGATTATCACGGG - Intronic
1065138687 10:22699376-22699398 AACAGAAGTTTTCTTCTCAGGGG - Intronic
1068936380 10:62639349-62639371 AGCAGAAATCTGCTTCCCTGGGG - Intronic
1069707413 10:70467463-70467485 ACCCGACATCCACTTCTCAGTGG - Intergenic
1071781575 10:88852028-88852050 AATCAAAATCTGGTTTTCAGTGG + Intergenic
1073228845 10:101949284-101949306 AACCAAAAGCTGGTTCTCTGAGG + Intronic
1078268710 11:9774796-9774818 ATCAGGCATCTGCTTCTCAGAGG + Intergenic
1078348192 11:10570230-10570252 AACCCAAATGTGCTTCGAAGTGG - Intronic
1080090881 11:28347517-28347539 AATTGGCATCTGCTTCTCAGAGG + Intergenic
1080875783 11:36273165-36273187 AAGCCAGCTCTGCTTCTCAGTGG - Intergenic
1087829137 11:102799856-102799878 AAAGGAAATCCTCTTCTCAGAGG + Intergenic
1089332514 11:117699788-117699810 ATCAGACATCTGCTTCTTAGAGG + Intronic
1089881739 11:121780640-121780662 ATCCTAATTCTGCTCCTCAGGGG + Intergenic
1092574971 12:9772135-9772157 TATTGAAGTCTGCTTCTCAGGGG + Intergenic
1095621654 12:44263193-44263215 CTCAGAAATCTGCTTCTCTGTGG + Intronic
1101340760 12:103840661-103840683 GCCCGAAATCTGCATCTGAGGGG - Intronic
1102399560 12:112616689-112616711 AACCTAAGTCTGCTTTTCAATGG + Intronic
1106352485 13:28946594-28946616 AACCGAAAGTTGTTTTTCAGAGG + Intronic
1106927149 13:34624816-34624838 AAGCAAAAACTGCTTCTCAAAGG + Intergenic
1109313264 13:60720122-60720144 AACCAAAAACAGTTTCTCAGAGG - Intergenic
1123811412 15:23930061-23930083 AACCCAAATCGGTTTCTCATAGG + Intergenic
1125200447 15:37097578-37097600 AACCCAAAGTTGCTTCTCATCGG + Intronic
1131342831 15:91618942-91618964 AACTGAAATTTGATTCTCTGTGG - Intergenic
1131797243 15:96031642-96031664 AACTGAAAACTGCTTCTCTGAGG - Intergenic
1131954909 15:97724430-97724452 AAGCAAAATCTGCTTCTTTGAGG + Intergenic
1133650642 16:7809996-7810018 AACCAAAATCTGGTTCTTTGGGG + Intergenic
1135498306 16:22971821-22971843 AACCCAATTTTGGTTCTCAGCGG + Intergenic
1138025232 16:53517055-53517077 AACCTAGGTCTGCATCTCAGAGG - Intergenic
1148254462 17:46117064-46117086 GACAGAAATCTGCCTCTCATTGG - Intronic
1148473783 17:47913424-47913446 TACTGAAATCTGCTTTCCAGAGG + Intronic
1151140691 17:71989467-71989489 AACCGAAGACTGCTTCACAAGGG + Intergenic
1157990912 18:52495161-52495183 AACTCCATTCTGCTTCTCAGAGG + Intronic
1158632802 18:59131027-59131049 AGCCCAAATCTGATTCACAGTGG - Intergenic
1160367369 18:78338281-78338303 AACTGCAAGCTGCTTCCCAGTGG + Intergenic
1162675260 19:12294170-12294192 AACCGCATTCTGCTGCTGAGTGG - Intronic
1166352109 19:42204133-42204155 AAGTGAAATGGGCTTCTCAGTGG + Intronic
928922205 2:36537723-36537745 AACCAAAATCTGCCCCTCATCGG - Intronic
936061501 2:109298086-109298108 CACTCAAACCTGCTTCTCAGGGG + Intronic
937518528 2:122683438-122683460 AACAGAAATGTATTTCTCAGAGG - Intergenic
938559859 2:132462365-132462387 AACTGAAACCTACTTCTCAGGGG + Intronic
938753868 2:134362034-134362056 AACCAAAACCTGCTTTTTAGGGG - Intronic
938795435 2:134715146-134715168 AAATGAAATCTACTTCTCAAAGG - Intronic
939600627 2:144185412-144185434 TACTGAAATCTACTTCTTAGAGG - Intronic
941405902 2:165087619-165087641 AACCAAACTCTTATTCTCAGTGG - Exonic
942739554 2:179159310-179159332 AACAGACAACTGCTTCCCAGAGG + Intronic
948678132 2:239611086-239611108 ATCTGACAGCTGCTTCTCAGAGG + Intergenic
949066822 2:241996086-241996108 AAGCAGAATTTGCTTCTCAGAGG + Intergenic
1170491922 20:16886168-16886190 AACCCAGATCTGCTGCTCTGAGG + Intergenic
1174217616 20:48929200-48929222 AACAGAAATGAGCTTCTCACTGG - Intronic
1180111056 21:45651235-45651257 AACCCAAATCCACTTCTAAGGGG - Intronic
1180242249 21:46517637-46517659 AACCCCATTCTGCTTTTCAGAGG + Intronic
1183151475 22:36041249-36041271 ACCAGAAATCTCCTTCTCAGTGG + Intergenic
1183576931 22:38697082-38697104 AGCTGAGATGTGCTTCTCAGGGG + Intronic
1183644656 22:39117522-39117544 AACCGAAGGCTTCTTCTCAAAGG + Intergenic
1184155935 22:42667184-42667206 AACTGAAACCAGCTACTCAGGGG - Intergenic
951181600 3:19665517-19665539 AACAGAAAACTGCTTATAAGTGG + Intergenic
951488075 3:23236399-23236421 AACAGAACTCTGCTTCTCTAAGG - Intronic
951770857 3:26256294-26256316 ACCCAAGATCTGGTTCTCAGAGG + Intergenic
952914410 3:38222395-38222417 AACCGAAATCTGCTTCTCAGGGG + Intronic
955740886 3:62090765-62090787 AATCAGAATCTCCTTCTCAGAGG - Intronic
958860615 3:99441079-99441101 AACCTAAATCCTCTTCTCATGGG + Intergenic
966128159 3:176604639-176604661 GACCAAAATCTTCATCTCAGTGG + Intergenic
972914004 4:43853496-43853518 AACAGAAATTTACTTCTCATAGG + Intergenic
974632970 4:64518816-64518838 AACCGAAATTTGCTGCTTTGTGG + Intergenic
977207581 4:94180556-94180578 TACCCAAATATTCTTCTCAGTGG - Intergenic
979945339 4:126824265-126824287 AACCCAAATTTGTCTCTCAGAGG + Intergenic
983408590 4:167366161-167366183 ATCCAAAATCTTCTTCTCATTGG + Intergenic
987647384 5:20691402-20691424 AGCCGAAACCTGTTTCTCACAGG - Intergenic
988272136 5:29031159-29031181 AAATGAAATCTGCTACTAAGGGG + Intergenic
988905133 5:35780149-35780171 AAAAGAAATCTGCTTATGAGAGG - Intronic
990017318 5:51079828-51079850 AACAGCAATCTGCTGCTCTGAGG - Intergenic
992550525 5:77855493-77855515 CACCGGAATCTTCTTCTCTGTGG - Intronic
994689925 5:103005421-103005443 AACAGAAATTTGTTTCTCACAGG + Intronic
999036320 5:148354917-148354939 AACTGAAATCTGGATCTCAGAGG - Intergenic
1003180535 6:3787770-3787792 AACCAACTTCTGCTTCTGAGGGG + Intergenic
1005693579 6:28330441-28330463 TACCTAATTCTGCTTCCCAGAGG - Intronic
1005808288 6:29495441-29495463 ATACGAAGTGTGCTTCTCAGAGG + Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1009734252 6:67656021-67656043 AACAGAAATCTACTTCTGAGAGG - Intergenic
1011504489 6:88027387-88027409 CACCAGAATATGCTTCTCAGAGG + Intergenic
1015507408 6:134003515-134003537 ATCCTAAATCTGCCTTTCAGAGG + Intronic
1020376211 7:7490413-7490435 CACAGAAATGTGCTTGTCAGGGG - Intronic
1021561173 7:21970038-21970060 AATGGAAAGCTGCTTCTCTGTGG + Intergenic
1024112982 7:46165119-46165141 AAGCCAAATCTGCTTTTCTGGGG + Intergenic
1026521557 7:71122424-71122446 ACCTGAAGTCTGCTTGTCAGTGG - Intergenic
1029054632 7:97728962-97728984 ACCCGAAATCTGCCTTTAAGGGG - Intergenic
1030586465 7:111425936-111425958 AAGAGACATCTGCTTCTTAGAGG - Intronic
1034217587 7:149420355-149420377 TACCTAAATCTGCTCCTCAGGGG - Intergenic
1034930676 7:155160359-155160381 AGCCAAAATATGCTCCTCAGGGG - Intergenic
1036997128 8:13670948-13670970 AACTGAAATCAGAATCTCAGTGG + Intergenic
1037707519 8:21327615-21327637 ATCCAAAATCTGCATCTCAAAGG - Intergenic
1039027395 8:33272398-33272420 AATAGGAATCTGTTTCTCAGGGG - Intergenic
1039064131 8:33594701-33594723 AAATGAAATCTGCTTCCCTGGGG - Intronic
1040102430 8:43517658-43517680 AAACGAAAGCTGATTTTCAGAGG + Intergenic
1042510404 8:69605195-69605217 AACAGGAATCTTCTCCTCAGAGG - Intronic
1043529582 8:81134581-81134603 AGCAGAAATCTGATACTCAGAGG + Intergenic
1047714320 8:127581912-127581934 AACTGAAATCTTCATCTCACTGG + Intergenic
1049119667 8:140723391-140723413 AACCATAATTTGCTGCTCAGAGG + Intronic
1058136540 9:101314027-101314049 AATAGAAATCTGCATCTCTGAGG - Intronic
1059051301 9:110929275-110929297 AACAGAAAGTAGCTTCTCAGAGG + Intronic
1060436843 9:123600640-123600662 ATCAGAAATCAGTTTCTCAGAGG - Intronic
1186260692 X:7775946-7775968 TCCCAACATCTGCTTCTCAGTGG + Intergenic
1187794229 X:22984150-22984172 AACTGAAATCTGACTCTCAAGGG + Intergenic
1187895951 X:23979769-23979791 ACCAGAAAACTGCCTCTCAGGGG - Intergenic
1201636970 Y:16134080-16134102 AACACAAATCTGTTTCTCTGTGG + Intergenic