ID: 952915546

View in Genome Browser
Species Human (GRCh38)
Location 3:38236862-38236884
Sequence TGGGCGTCTTCATAAGACAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952915537_952915546 24 Left 952915537 3:38236815-38236837 CCCACTTCTCTTTCTAATGAGCA 0: 1
1: 0
2: 0
3: 28
4: 281
Right 952915546 3:38236862-38236884 TGGGCGTCTTCATAAGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 90
952915538_952915546 23 Left 952915538 3:38236816-38236838 CCACTTCTCTTTCTAATGAGCAG 0: 1
1: 0
2: 2
3: 34
4: 354
Right 952915546 3:38236862-38236884 TGGGCGTCTTCATAAGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 90
952915536_952915546 30 Left 952915536 3:38236809-38236831 CCATAACCCACTTCTCTTTCTAA 0: 1
1: 0
2: 2
3: 39
4: 352
Right 952915546 3:38236862-38236884 TGGGCGTCTTCATAAGACAGAGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952915546 Original CRISPR TGGGCGTCTTCATAAGACAG AGG Exonic