ID: 952921521

View in Genome Browser
Species Human (GRCh38)
Location 3:38288059-38288081
Sequence GTAGGTACAGAATTTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 13, 3: 102, 4: 527}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952921521_952921526 17 Left 952921521 3:38288059-38288081 CCAAGCTGAAATTCTGTACCTAC 0: 1
1: 0
2: 13
3: 102
4: 527
Right 952921526 3:38288099-38288121 TTTCCTCCTCCCTCAGTCCCTGG 0: 1
1: 2
2: 34
3: 288
4: 1827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952921521 Original CRISPR GTAGGTACAGAATTTCAGCT TGG (reversed) Intronic
900976805 1:6022606-6022628 ATGGGGACAGAATTTCAGTTTGG - Intronic
901136311 1:6999036-6999058 GTGGGCACAGAGTTTCAGTTTGG - Intronic
901150474 1:7097880-7097902 ATGGGTACAGCGTTTCAGCTGGG + Intronic
901162365 1:7188432-7188454 ATGGGTACAGAGTTTCAGTTTGG - Intronic
902853584 1:19181921-19181943 GTGGGTACAGTGTTTCAGTTTGG - Intronic
903505408 1:23831247-23831269 ATGGGTACAGAATTTCAGTTTGG + Intronic
904323764 1:29713753-29713775 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
904668523 1:32143722-32143744 GTGGGTACAGAATTTCTGTTAGG - Intronic
905836624 1:41129320-41129342 ATAGGTACAGAGTTTCAGTTGGG - Intronic
906465901 1:46078995-46079017 ATGGGTACAGAATTTCTGTTAGG + Intronic
907138788 1:52164957-52164979 ATAGGTAGAGAGTTTCAGTTTGG + Intronic
907177873 1:52542217-52542239 ACGGGTACAGAGTTTCAGCTTGG + Intronic
907538365 1:55186791-55186813 ATGGGTACAGAGTTTCAGCTGGG + Intronic
907736722 1:57120575-57120597 ATAGGTACAGAGTTTCAGTTTGG - Intronic
908217469 1:61968811-61968833 ATAGGTATAGAATTTCAGTTTGG - Intronic
908266382 1:62383442-62383464 ATGGGTACAGAATTTCAGTTTGG + Intergenic
908345732 1:63230419-63230441 GTGGGTACAGAGTTTCAGTTTGG - Intergenic
908366503 1:63429331-63429353 ATGGGTACAGAATTTCTTCTGGG - Intronic
908944444 1:69476575-69476597 TTGGCTACAGAATTTCTGCTTGG - Intergenic
910316439 1:85889867-85889889 ATGGGTACAGAGTTTCAGTTTGG - Intronic
910329367 1:86052602-86052624 TTGGGTACAGAGTTTCAGTTTGG + Intronic
910340304 1:86179620-86179642 ATGGGTACAGAATTTTAGTTTGG - Intergenic
911130625 1:94383804-94383826 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
911316322 1:96360873-96360895 GTAGATACAGTATTTAAGGTTGG - Intergenic
911345193 1:96688449-96688471 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
911632424 1:100198359-100198381 GTAAGTGCAGAGTTTCAGTTTGG + Intronic
911747602 1:101456773-101456795 CTAGGTACAGAATTTTAAGTTGG - Intergenic
912448473 1:109755262-109755284 ATGGGTACAGAATTTCTGTTTGG + Intronic
912548651 1:110469488-110469510 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
912781652 1:112555004-112555026 ATGGGTATAGAATTTCAGTTTGG + Intronic
913485439 1:119329038-119329060 GTAGGGACTGAAATTCAGCCTGG - Intergenic
914340987 1:146760311-146760333 CTGGGTACAGAGTTTCAGTTCGG + Intergenic
914723498 1:150308501-150308523 ATGGGTACAGAGTTTCAGTTTGG + Exonic
914973916 1:152340014-152340036 ATGGATACAGAGTTTCAGCTTGG + Intergenic
915859043 1:159422549-159422571 GTAGGTACAGAATGTCAGTGGGG + Intergenic
916178011 1:162058796-162058818 ATAGGTACAGAGTTTCTGTTTGG - Intergenic
916617729 1:166459942-166459964 ATGAGTACAAAATTTCAGCTAGG - Intergenic
917525953 1:175788712-175788734 GTAGGTCCAAAATGTGAGCTGGG - Intergenic
917891584 1:179443519-179443541 ATGGGTACAGAATGTCAGTTTGG - Intronic
917985796 1:180317374-180317396 ATGGGTACAGAGTTTCAGTTTGG + Intronic
918012532 1:180601451-180601473 GTATCTACAGAATTTCTTCTAGG - Intergenic
918092425 1:181308961-181308983 ATAGGTACAGAGTTTCTGTTGGG + Intergenic
918187189 1:182138510-182138532 GTAGGAATAGAATTTCCACTGGG - Intergenic
918966073 1:191350125-191350147 ATAGGTACAGAGTTTCAGCATGG + Intergenic
920121549 1:203662426-203662448 ATGGGTACAGAGTTTCAGTTTGG - Intronic
920169433 1:204061611-204061633 GTAGGTACGAAATTTCACTTTGG - Intergenic
920416732 1:205804002-205804024 ATAGGTACAGAGCTTCAGCTGGG + Intronic
920739856 1:208570320-208570342 ATAGGTACAGAGTTTCAATTTGG - Intergenic
920808257 1:209255493-209255515 ATGGGTACAGAGTTTCAGCTTGG - Intergenic
921856276 1:219988684-219988706 GCAGGTTCAGAATTTCTGGTTGG + Exonic
923067741 1:230535140-230535162 CTAGGCATAGAATTCCAGCTTGG - Intergenic
923090141 1:230734415-230734437 ATGGGCACAGAATTTCAGTTGGG + Intergenic
923246951 1:232141411-232141433 ATAGGAACAGAGTTTCAGTTTGG + Intergenic
923275402 1:232391136-232391158 GTGGGTCCAGAGTTTCAGTTTGG - Intergenic
923416728 1:233769834-233769856 GTAGGTACACAAAGCCAGCTGGG - Intergenic
923651890 1:235881889-235881911 ATGGGTACAAAATTTCAGCTGGG + Intronic
923720575 1:236463691-236463713 ATGGGTACAGAATTTCAGTTTGG - Intronic
924045025 1:240020187-240020209 GTGGGCACAGAATTTCACTTTGG - Intronic
924199881 1:241647646-241647668 TTGGGTACAGAATTTTAGGTTGG - Intronic
924422521 1:243923052-243923074 GTGGGTGCAGAGTTTCAGTTTGG - Intergenic
924545493 1:245022864-245022886 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1063910834 10:10828535-10828557 ATGGGGACAGAATTTCAGTTTGG + Intergenic
1064448799 10:15422755-15422777 ATGGGTACAGAATTTCTGTTTGG + Intergenic
1064573716 10:16723113-16723135 GTTGGCACATAATTTGAGCTGGG + Intronic
1065095990 10:22281447-22281469 TTATTTACAGATTTTCAGCTGGG - Intergenic
1065661136 10:28005207-28005229 ATAAGTACAGAGTTTCAGTTTGG + Intergenic
1066252999 10:33652336-33652358 ATGAGTACAGAGTTTCAGCTTGG - Intergenic
1067221749 10:44348840-44348862 GTAAGTAGTGAATGTCAGCTTGG - Intergenic
1067856867 10:49801929-49801951 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1067924910 10:50498443-50498465 ATAGGTACAGAATTTCTCTTTGG - Intronic
1068359755 10:55962031-55962053 GAGTGGACAGAATTTCAGCTGGG - Intergenic
1068888728 10:62126175-62126197 GTAGCTACAGAGTTTCAGTTTGG + Intergenic
1068984317 10:63093050-63093072 GTGGATACAAAATTTCAGTTAGG - Intergenic
1069860810 10:71470401-71470423 ATGGGTACAGAATTTCTGTTTGG - Intronic
1070294110 10:75144364-75144386 ATAGGTACAGAATTTCAGTTTGG - Intronic
1070681710 10:78453492-78453514 GTACACACAGAATTTTAGCTAGG - Intergenic
1071512991 10:86277088-86277110 ACAGGTACAGAGTTTCAGTTTGG + Intronic
1072136501 10:92551730-92551752 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1072201905 10:93167750-93167772 ATTGGTACAGAGTTTCAGTTGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072651326 10:97298082-97298104 CTAGGTACAGAGTGTCAGCCTGG + Intergenic
1073144225 10:101269371-101269393 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1073316743 10:102586821-102586843 GTGGGTACAGAGTTTAAGTTGGG - Intronic
1073564984 10:104527306-104527328 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1073910827 10:108341957-108341979 GTAGGTAAAGAATTAAAGCATGG - Intergenic
1074499505 10:114010904-114010926 ATAGGTACAGAGTTTCTGTTTGG - Intergenic
1074736431 10:116439052-116439074 ATGGGTACAGAATTTTAGTTTGG + Intronic
1075200461 10:120398894-120398916 ATAGGTACAGAGTTTCTGTTTGG + Intergenic
1075525381 10:123180653-123180675 ATGAGTACAGAATTTCAGTTTGG + Intergenic
1075535352 10:123266947-123266969 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1075803377 10:125167214-125167236 ATTGGTACAGAGTTTCAGTTTGG + Intergenic
1076064025 10:127434537-127434559 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1076805484 10:132856094-132856116 CTGGGTACAGAATTCCAGGTTGG + Intronic
1077432157 11:2521185-2521207 ATGGGTGCAGAATTTCAGTTTGG - Intronic
1077979932 11:7289339-7289361 ATAGGTACAGAGTTTCAGCATGG + Intronic
1078219006 11:9335891-9335913 GTAGAGACAGAGTTTCACCTCGG - Intergenic
1078882893 11:15470245-15470267 CTAGGTACAGAATTTCAGTTTGG - Intergenic
1079667081 11:23119758-23119780 GAACCTACAGAATTTCTGCTAGG - Intergenic
1079773456 11:24493993-24494015 GTAGGTACAGGATTTCTTCTGGG + Intergenic
1080040619 11:27755898-27755920 ATGGGTACAGGATTTCAGTTTGG - Intergenic
1080570940 11:33556743-33556765 GTGGGTACAGAGTTTCTGTTTGG + Intronic
1080688000 11:34531573-34531595 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1080809292 11:35686912-35686934 ATGGGTACCGAATTTCAGTTTGG - Intronic
1080899606 11:36476302-36476324 ATAGGTACAGAATTTCTGTTGGG - Intergenic
1080908655 11:36573346-36573368 GTGGGTGCTGAATTTCATCTGGG - Exonic
1082892003 11:58149583-58149605 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1083029292 11:59577262-59577284 GAACGTAGATAATTTCAGCTGGG - Intronic
1083058047 11:59842178-59842200 GCAGCTACAGAATCTCCGCTGGG - Intronic
1083495343 11:63047275-63047297 GTAGATAAAGAATTCCAGCTTGG - Intergenic
1084281539 11:68098527-68098549 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1084874634 11:72121892-72121914 TTAATTACAGAGTTTCAGCTGGG - Intronic
1085240939 11:75054776-75054798 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1085738469 11:79059709-79059731 ATGGGTACAGATTTTCAGTTTGG - Intronic
1085802664 11:79604788-79604810 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1086975284 11:93125197-93125219 ATGGGTACAGATTTTCAGTTTGG - Intergenic
1087053740 11:93911293-93911315 ATAGGTACAGAGTTTCAATTTGG - Intergenic
1087330960 11:96779351-96779373 GGAGATACAGAATTTTAGGTTGG - Intergenic
1087745522 11:101941259-101941281 ATGGGTACAGAATTCCAGTTGGG - Intronic
1088377262 11:109155517-109155539 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1088412637 11:109552231-109552253 GTAGGTAAAGAGTATCAGATAGG + Intergenic
1088430275 11:109751104-109751126 ATGGGTACAAAATTTCAGTTTGG + Intergenic
1088642514 11:111887072-111887094 ATAGGTACAGAGTTTTAGTTCGG - Intergenic
1088791995 11:113234407-113234429 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1088888128 11:114023586-114023608 GCAGGTCCAGAATATCAGCTTGG + Intergenic
1088898651 11:114097330-114097352 GTGGGTACAGAGTTTCAGTTGGG + Intronic
1089977574 11:122745812-122745834 GAAGGGACAGGATTTGAGCTGGG - Intronic
1090151494 11:124389117-124389139 GTAGATAAAGAATTTAGGCTGGG - Intergenic
1090289271 11:125527853-125527875 ATAGCTACAGATTTTCAGTTGGG - Intergenic
1091164550 11:133463274-133463296 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1091547935 12:1516820-1516842 ATAGATACAGAATTCCAGTTGGG - Intergenic
1091983819 12:4890771-4890793 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1092156240 12:6283450-6283472 ATGGGTTCAGACTTTCAGCTTGG + Intergenic
1092611076 12:10173990-10174012 GTGGGTATAGAGTTTCAGTTGGG - Intronic
1092729125 12:11511802-11511824 ATGGGTACAGAATTTCAGGTTGG + Intergenic
1092749018 12:11701248-11701270 CTGGGGACAGAGTTTCAGCTGGG - Intronic
1093259740 12:16920721-16920743 TTAAGTACAGAATTTGAGGTTGG - Intergenic
1094244360 12:28271083-28271105 GTAGGTACCGCATTATAGCTAGG + Intronic
1094426049 12:30318335-30318357 ATAGGTAGAGAGTTTCAGTTTGG + Intergenic
1095248452 12:39949842-39949864 GGAAGTATAGAATTGCAGCTAGG - Intronic
1095669762 12:44844975-44844997 GTATGTAAAAAATTTCAGCAAGG - Intronic
1096014669 12:48258775-48258797 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1096381878 12:51165628-51165650 ATAGGTACAGCATTTCACTTTGG + Intronic
1096410066 12:51370719-51370741 ATAGGTACAGAATTTCAGTTTGG + Intronic
1096442264 12:51653297-51653319 GTTGGTACAGAGTTTCAGTTTGG - Intronic
1097158757 12:57030780-57030802 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1097400499 12:59122869-59122891 GTAGGTAAAGAATTTTATCCAGG - Intergenic
1097745032 12:63292080-63292102 GTAGGTACAGACCTGCTGCTTGG + Intergenic
1097877528 12:64657301-64657323 GGCGATACAGAGTTTCAGCTGGG + Intronic
1098009809 12:66038716-66038738 GTAGGTATAGAATTCCAGGCTGG + Intergenic
1098766625 12:74498545-74498567 GTCAGTAAAGAATTTCAGATTGG - Intergenic
1099340868 12:81432225-81432247 ATGTGTACAGAATTTCAGTTTGG - Intronic
1099731180 12:86505451-86505473 GTATGTATAGAATTTTAGGTGGG - Intronic
1100454992 12:94742989-94743011 ATGGGTACAGAATTTCAGTTTGG - Intergenic
1100625708 12:96329165-96329187 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1101584875 12:106076875-106076897 GTGGGGACAGCGTTTCAGCTGGG + Intronic
1101708918 12:107247033-107247055 ATAGGAACAGAGTTTCAGCTTGG + Intergenic
1102138895 12:110598231-110598253 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1102725082 12:115056057-115056079 GTAGGAACAAAATTACAGATAGG - Intergenic
1102796102 12:115690041-115690063 GCAGGTACAAAATTTCAGTTTGG + Intergenic
1103038427 12:117675142-117675164 GTAAATGCAGAATTCCAGCTGGG - Intronic
1103069363 12:117927951-117927973 ATGGGTACAGAATTTCATTTTGG - Intronic
1103114981 12:118320214-118320236 ATAGGTACAGAATTTCTGCTTGG + Intronic
1103127895 12:118440223-118440245 GTGGGTACAGAATTTCTGTTTGG + Intergenic
1103168559 12:118792823-118792845 ATGGGTACACAATTTCAGTTAGG - Intergenic
1104695195 12:130858202-130858224 AAAGGTACAGATTTTCAGATGGG - Intergenic
1105401623 13:20101133-20101155 ATGGGTGCAGAATTTCAGTTTGG + Intergenic
1106397149 13:29392183-29392205 ATAGGTACAAAGTTTCAGTTTGG - Intronic
1106702178 13:32241525-32241547 GTGGGTACAGAATTTCAGTTTGG + Intronic
1107392936 13:39986107-39986129 ATGGGTGGAGAATTTCAGCTAGG + Intergenic
1107842905 13:44477824-44477846 GTAGAGACAGGATTTCACCTTGG + Intronic
1108090827 13:46847913-46847935 GGAGATACAGAAGTTTAGCTTGG - Intronic
1108224169 13:48270585-48270607 GTAGTTTCAGAATTTCATCTGGG + Intergenic
1108522222 13:51256808-51256830 GTGGGTACAGACTTTCAGTTTGG - Intronic
1108560919 13:51643204-51643226 ATGGATACAGAATTTCCGCTTGG - Intronic
1108567387 13:51713983-51714005 GTGGGTAAAGAGTTTCAGTTTGG + Intronic
1109144518 13:58761704-58761726 TTTGGTACAGAATTTAATCTTGG - Intergenic
1109329309 13:60907993-60908015 AAAGGTACAGAGTTTCAGTTAGG + Intergenic
1110188991 13:72707848-72707870 ACAGGTACAGAGTTTCAGTTTGG + Intergenic
1110992165 13:82055899-82055921 ATGGGTACAGAATTTCAGCTGGG + Intergenic
1111691983 13:91576133-91576155 AAAGGTACAAAATTTCAGTTAGG + Intronic
1111941360 13:94611654-94611676 GTGGGGGCAGAATTACAGCTAGG - Intronic
1112022422 13:95383283-95383305 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1112023052 13:95388475-95388497 ACAGGTACAGAGTTTCAGTTTGG - Intergenic
1112025655 13:95408644-95408666 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1112441846 13:99430094-99430116 GTGGGTACAGAGTTTCTGTTTGG - Intergenic
1112526137 13:100149423-100149445 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1113471103 13:110547038-110547060 TGTGGTACAGAAGTTCAGCTTGG - Intronic
1113736516 13:112682439-112682461 ATAGGCACAGAGTTTCAGTTTGG - Intronic
1114324288 14:21573375-21573397 AAAGGTACAAAGTTTCAGCTGGG + Intergenic
1115115687 14:29878782-29878804 ATAGGTACACAATTTCTGATTGG + Intronic
1115321812 14:32088595-32088617 CTAGGTACAGATTTTCAGTTGGG + Intronic
1115674551 14:35656472-35656494 GTAGCAATATAATTTCAGCTGGG + Intronic
1116380081 14:44256305-44256327 ATAGGTACAAAGTTTCAGTTAGG + Intergenic
1116981184 14:51172508-51172530 ATGGGTACAGAATTTTAGTTGGG - Intergenic
1117125776 14:52623968-52623990 GTGGATACAGAATTTCAGTATGG - Intronic
1118613620 14:67560487-67560509 GCAGGTACAGAGTTTCTGTTTGG - Intronic
1118704123 14:68464552-68464574 GAATGTACAGAATTCTAGCTTGG - Intronic
1118728120 14:68645113-68645135 ATGGGTACAGAATTTCAGGTTGG - Intronic
1118794028 14:69123642-69123664 TTGGGTACAGTATTTCAGTTTGG - Intronic
1118885434 14:69861827-69861849 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1120157726 14:81112534-81112556 GCAAGAAAAGAATTTCAGCTGGG - Intronic
1121032408 14:90670376-90670398 ATGGGTACAGAATTTCTGTTTGG + Intronic
1121193605 14:92050518-92050540 CTAGGTTTGGAATTTCAGCTGGG - Exonic
1121235311 14:92387674-92387696 ATGGGTACAGAGGTTCAGCTTGG - Intronic
1121475846 14:94201764-94201786 GTAGGTACAGAATCACAGAATGG - Intronic
1121849200 14:97204016-97204038 GGAGGGACAGGATTTCAGGTAGG - Intergenic
1122158445 14:99765343-99765365 GTGGGCACAGAGTTTCCGCTTGG - Intronic
1123706123 15:22952253-22952275 GTGGATACAGAGTTTCGGCTTGG + Intronic
1124026003 15:25966462-25966484 GGAGCTACAGAATGTCAACTAGG - Intergenic
1124463755 15:29917950-29917972 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1125035856 15:35122625-35122647 GTGGGTACAGAGTTTCAGTTTGG + Intergenic
1125043198 15:35215665-35215687 GTTGTTAAAGATTTTCAGCTGGG - Intergenic
1126296398 15:47141503-47141525 ATGGATACAAAATTTCAGCTAGG + Intergenic
1126330981 15:47531258-47531280 ATATGTGCAGAATATCAGCTTGG + Intronic
1126779578 15:52127413-52127435 GTATCTACAGGATTTCAACTTGG + Intronic
1127220584 15:56876305-56876327 ATTGGTACAGAGTTTCAGTTTGG + Intronic
1127573771 15:60270611-60270633 GAAGGTACAGAATGGCAGATTGG - Intergenic
1128165425 15:65460126-65460148 ATGGGTACAGAATTTCTGTTTGG - Intronic
1128466129 15:67913889-67913911 GTGGGTATAGAGTTTCAGTTTGG + Intergenic
1128473339 15:67975114-67975136 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1128636668 15:69306803-69306825 CTGGGTACAGAGTTTCATCTGGG - Intronic
1129517736 15:76166811-76166833 GCGGGTACAGAGTTTCAGTTTGG + Intronic
1130084028 15:80762262-80762284 GTGGGTACAGAGTTTCAGTTTGG - Intergenic
1130254700 15:82320533-82320555 GGAGGTAGAGAAGTTCACCTGGG + Intergenic
1130600273 15:85269473-85269495 GGAGGTAGAGAAGTTCACCTGGG - Intergenic
1131575111 15:93581550-93581572 GTAGGTGCAGAATTTTACCTGGG - Intergenic
1131644341 15:94325772-94325794 GTAGGTTCAGAATTTCGGTAAGG - Intronic
1132057980 15:98666770-98666792 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1132093898 15:98967882-98967904 ATAGGTACAGAGTTTCAGTTTGG + Intergenic
1132154758 15:99487484-99487506 GTGGGGACAGAGTTTCAGTTTGG + Intergenic
1132303528 15:100791132-100791154 ATGAGTACAGAATTTCAGTTTGG + Intergenic
1132360700 15:101211885-101211907 CTAGGTATAGAATTCCAGATTGG - Intronic
1135031639 16:19043526-19043548 ATGGGTACAGAATTTCTGTTGGG - Intronic
1135357165 16:21778994-21779016 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135377571 16:21962038-21962060 ACAGGTACAGAATTTCAGGTGGG - Intronic
1135455669 16:22595110-22595132 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1137295376 16:47087470-47087492 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1137390542 16:48077614-48077636 GTGGGCACAGAGTTTCAGTTTGG + Intergenic
1137497314 16:48980646-48980668 TTAGGTTCAGAATCCCAGCTTGG - Intergenic
1137878853 16:52025287-52025309 ATGGGTGCAGAATTTCTGCTTGG - Intronic
1137980988 16:53069393-53069415 ATGGGGACAGAGTTTCAGCTTGG - Intronic
1138133451 16:54501468-54501490 ATGGGGACAGAATTTCAGTTTGG - Intergenic
1138291538 16:55852074-55852096 ATAGGTACTGATTTTCAGTTTGG + Intronic
1139098542 16:63735581-63735603 GTAGCTTCAGAACTTCAACTAGG + Intergenic
1139766697 16:69236519-69236541 GTGGGTATAGAGTTTCAGTTTGG + Intronic
1139791260 16:69438030-69438052 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1139935298 16:70566175-70566197 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1139993298 16:70957095-70957117 ATGGGTACAGAGTTTCAGTTCGG - Intronic
1140627212 16:76808535-76808557 GTGGGTACAGAGTTTCAGCTTGG - Intergenic
1141633222 16:85300412-85300434 ATGGGTACAGAATTTCTGTTTGG - Intergenic
1141729905 16:85815157-85815179 GTGGGGACAGAGTTTCAGTTTGG - Intergenic
1141823115 16:86461315-86461337 GTTGGTGCTGAATGTCAGCTGGG + Intergenic
1142119242 16:88377736-88377758 GTGGGTACAGGATGCCAGCTGGG - Intergenic
1142824944 17:2504245-2504267 ATAGGTACAGAGTTTCACTTTGG + Intronic
1142941335 17:3382123-3382145 GTAGGAAGAGTATTTCAGGTAGG + Intergenic
1143673869 17:8416148-8416170 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1144053688 17:11519517-11519539 TTGGGGACAGAGTTTCAGCTAGG + Intronic
1144322558 17:14144002-14144024 GGAGTTGCAGTATTTCAGCTGGG - Intronic
1144392448 17:14807200-14807222 ATAGGTATAGAGTTTCAGCTTGG + Intergenic
1146171698 17:30639440-30639462 ATAGGTACAGAGTTTCAATTTGG - Intergenic
1146250166 17:31333678-31333700 TTTGTTACAGAATTTCAGTTTGG + Intronic
1146557211 17:33836294-33836316 GTAGAGACAGAATTTCACCATGG + Intronic
1147197389 17:38776378-38776400 ATGGGTATAGAGTTTCAGCTGGG + Intronic
1148636922 17:49156130-49156152 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1148833210 17:50449878-50449900 ATGGGTACAGAATTTCAGTTGGG - Intronic
1149510367 17:57236310-57236332 ATGGGTATAGAATTTCAGTTTGG - Intergenic
1149676715 17:58471090-58471112 GCAGGTACAGAGTTTCGGTTGGG + Intronic
1150188048 17:63206748-63206770 ATGGATACAGAATTTCAGTTGGG + Intronic
1153041956 18:821318-821340 GTGGGTACAGGATTTCTTCTTGG + Intergenic
1153709380 18:7782555-7782577 ATAGGTACAGAGTTTCAGTTGGG - Intronic
1153797668 18:8639937-8639959 CTGGGTGCAGAGTTTCAGCTGGG + Intergenic
1153883474 18:9440762-9440784 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1154000880 18:10481557-10481579 GTGGGTGCAGATTTTCAGCTGGG + Intronic
1154942468 18:21128462-21128484 AAAGGTAAAGAATTTCAGGTGGG - Intergenic
1155150000 18:23115685-23115707 ATGGGTACAGAGTTTCAGCTGGG - Intergenic
1155157313 18:23168487-23168509 CTAGGTGCAGAGTTTCAGCCTGG + Intronic
1155531356 18:26770290-26770312 ATGGGTACAGAGTTTCACCTGGG - Intergenic
1157321249 18:46636337-46636359 GTAGGCACAGAAGGTGAGCTGGG - Intronic
1157593479 18:48849984-48850006 ATGGGGACAGAGTTTCAGCTGGG - Intronic
1157822814 18:50786272-50786294 ATAGGTACAGAGTTTCACTTTGG - Intergenic
1158425402 18:57335532-57335554 GTGGGTACAGAGTTTCAGTTTGG + Intergenic
1158876254 18:61737207-61737229 GTGGGTTCAGAGTTTCAGCTGGG + Intergenic
1159444585 18:68525757-68525779 GAAGATACAAAATTTCAGTTAGG - Intergenic
1160073200 18:75646522-75646544 GTGGGTACAGAATTTTAAGTTGG + Intergenic
1160624479 18:80193511-80193533 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1161164111 19:2776556-2776578 ATGGGGACAGAATTTCAGCCTGG + Intronic
1161491105 19:4562149-4562171 ATGGGGACAGAATTTCAGTTTGG - Intergenic
1161491347 19:4563623-4563645 ATGGGGACAGAATTTCAGTTTGG - Intergenic
1161635057 19:5383157-5383179 ACAGGTACAGAGTTTCTGCTTGG - Intergenic
1162889678 19:13723446-13723468 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
1163278147 19:16298729-16298751 ATAGGGACAGAGTTTCAGTTTGG + Intergenic
1164403178 19:27917270-27917292 GTGAGTACAGAATTTCTGTTGGG + Intergenic
1165220511 19:34312411-34312433 GCAGGTACAGAGTTTCAGTTTGG - Intronic
1166441773 19:42822001-42822023 ATGGGTACAGAATTCCAGTTGGG + Intronic
1166478499 19:43150266-43150288 ATGGGTACAGAATTCCAGTTGGG + Intronic
1167002597 19:46755082-46755104 ATAAGTACAGAGTTTCAGTTTGG - Intronic
1167174362 19:47855209-47855231 ATAGGTACAAAGTTTCAGTTTGG - Intergenic
1167764554 19:51472703-51472725 GTGGGTACAGAGTTTCAATTTGG - Intergenic
1168081153 19:54011655-54011677 ACAGGTATAGAATTTCAGCTGGG - Intronic
1168274939 19:55272507-55272529 ACGGGTACAGAATTTCTGCTTGG + Intronic
1168500701 19:56890480-56890502 GTGGGGACAGAGTTTCAGTTGGG - Intergenic
925338082 2:3113307-3113329 GAAGGTTCAGAGCTTCAGCTGGG + Intergenic
926175529 2:10588349-10588371 ATGGGTACAGAGTTTCAGGTTGG - Intronic
929169268 2:38915208-38915230 GTAGTTACAAAATTTTAGGTAGG + Intronic
929715876 2:44309177-44309199 GTGGGTACAGATTTTCTGTTTGG - Intronic
929892800 2:45932751-45932773 GTGGGTACGGAATTTCAACTTGG - Intronic
930899011 2:56481070-56481092 GGAGGTACAGCATTTGAGCTAGG - Intergenic
930996050 2:57719751-57719773 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
931752872 2:65346473-65346495 ATAGGTACAGAGTTTCAGTTTGG - Intronic
932057713 2:68462931-68462953 AGAAGTACAGGATTTCAGCTTGG + Exonic
932200514 2:69822790-69822812 GTGGGTACAGAGTTTCTGTTTGG + Intronic
932399999 2:71473830-71473852 ATGGGTATAGAGTTTCAGCTGGG - Intronic
932427987 2:71655359-71655381 GAAGAGACAGAATTTGAGCTGGG + Intronic
933867790 2:86538295-86538317 ATAGGTACAGAGTTTCAGTATGG + Intronic
935137195 2:100317715-100317737 TCAGGTAAAGAATTCCAGCTAGG + Intronic
935611450 2:105029950-105029972 ATAGGTACAGAGTTGCAGTTTGG + Intergenic
937895239 2:126972793-126972815 GTGGGTGCAGAGTTTCAGTTTGG - Intergenic
937924715 2:127158756-127158778 GTAGGTAGTGAACTTCCGCTGGG + Intergenic
938223570 2:129594859-129594881 ATGGGTACAGAATTTCTGTTTGG - Intergenic
938368322 2:130753385-130753407 ATGGGTACAGAATTTCTGTTGGG + Intergenic
939790278 2:146564385-146564407 GCAGGTACGGCATCTCAGCTTGG - Intergenic
940212743 2:151272959-151272981 ATGGGTACAGAGTTTCAGTTTGG + Intronic
940981577 2:160009556-160009578 ATGGGTACAGAGTTTCAGTTTGG + Intronic
941002283 2:160214640-160214662 GAAGGGACAGAATTCCATCTTGG + Intronic
941099200 2:161278381-161278403 CTAGCTACAGAATTGCAGCTAGG + Intergenic
941105093 2:161343183-161343205 ATGGGTACAGAGTTTCAGTTTGG - Intronic
941328549 2:164147430-164147452 GTAGGTTCAGTATTTTGGCTTGG + Intergenic
941820000 2:169835044-169835066 ACAGGTACAGAGTTTCAGTTTGG + Intronic
942148983 2:173056215-173056237 ATGGGCACAGAATTTCAGTTTGG - Intergenic
942364174 2:175205415-175205437 ATGGATACAGAATTTCAGTTTGG - Intergenic
942617492 2:177809133-177809155 ATGGGTACAGAGTTTCAGTTTGG + Intronic
942682540 2:178492777-178492799 GTGGGTACAGACCTTCAGCTGGG + Intronic
943921952 2:193719005-193719027 ATGGGTACTGAATTTCAGATAGG + Intergenic
944005398 2:194898274-194898296 GAATGTACAGAATTTCAAATAGG - Intergenic
944246044 2:197531438-197531460 ATATGTATAGAATTTCAGTTGGG - Intronic
944733392 2:202537540-202537562 ATGGGTACAGAGTTTCAGTTTGG + Intronic
946366300 2:219251183-219251205 GTAGATGGAGAATTCCAGCTTGG + Exonic
946484731 2:220090059-220090081 GTAGATTGACAATTTCAGCTGGG + Intergenic
946993691 2:225365991-225366013 ATAGGTACAGAGTTTCAGCTTGG - Intergenic
948399874 2:237676090-237676112 ATGTGTACAGAATTTCAGTTTGG - Intronic
948582158 2:238995692-238995714 ATAGGTACAGAGGTTCAGTTAGG + Intergenic
1168906609 20:1409000-1409022 AAAGGTACAGAGTTTCAACTGGG - Intergenic
1169101357 20:2952681-2952703 ATGGGTACAGAATTTCAGTCAGG - Intronic
1169107384 20:3008490-3008512 GTGGGTACAGAGTTTCATCTGGG + Intronic
1169791056 20:9411172-9411194 GGGGCTACAGAATTTAAGCTGGG + Intronic
1169996244 20:11560242-11560264 GTGGGTACAAAATTACAGTTAGG + Intergenic
1170315169 20:15033096-15033118 ATAGGTACAGAGTTTCAGTACGG + Intronic
1170462590 20:16591273-16591295 ATGGGTACTGATTTTCAGCTTGG - Intergenic
1170650210 20:18232583-18232605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1172321242 20:33996749-33996771 ATGGGTACAGAATTTCAGTTGGG - Intronic
1172405305 20:34684065-34684087 ATAGGTACGGAGTTTCAGCTGGG + Intergenic
1172488224 20:35312928-35312950 ATAGGGACAGAGTTTCAGTTTGG + Intronic
1172651595 20:36506783-36506805 ATGGGTACAGAATTTCAGCTGGG - Intronic
1172942348 20:38663194-38663216 ATGGGTACAGAATTTCTGTTTGG - Intergenic
1174525409 20:51166571-51166593 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1174796494 20:53526955-53526977 ATAGGGACAGAGTTTCAGTTTGG + Intergenic
1174825341 20:53763465-53763487 GTAGGTACAGAAATTCAAGGAGG - Intergenic
1177310913 21:19391411-19391433 CTAGTTACAGCATTTCAGATGGG + Intergenic
1178307478 21:31502562-31502584 CTAAGGACAGGATTTCAGCTAGG + Intronic
1179268983 21:39833931-39833953 ATGGGTACAGAATTTCAATTAGG - Intergenic
1179458735 21:41518745-41518767 ATGGGTAGAGAATTTCAGTTTGG + Intronic
1180911269 22:19452433-19452455 GTTGGTACAGAATTTTAGGTTGG + Intronic
1180943664 22:19677663-19677685 ATGGGGACAGAATTTCAGTTTGG + Intergenic
1181506111 22:23358798-23358820 ATAGGTACTGAGTTTCAGTTTGG + Intergenic
1184016465 22:41789603-41789625 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1184267014 22:43353627-43353649 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1184576620 22:45373050-45373072 GTAGATTCAGAGTTTCTGCTTGG - Intronic
1184674545 22:46033841-46033863 GTAGGTATGGAGTTTCAGTTTGG - Intergenic
949752607 3:7372048-7372070 GTAGGTACAGAATGTCTGACTGG - Intronic
949795785 3:7849284-7849306 GTAGGAAGAGAAATTAAGCTTGG + Intergenic
949958951 3:9295762-9295784 ATGGGTACAGAGTTTCAGTTTGG - Intronic
951210201 3:19966160-19966182 GTGGGTGCAGAGTTTCAGCTAGG - Intronic
951448389 3:22808661-22808683 ATAGGTACAGAGTTTCAGTTGGG + Intergenic
952796838 3:37246639-37246661 GTGGGTACAGAGTTTTAGTTTGG + Intronic
952921521 3:38288059-38288081 GTAGGTACAGAATTTCAGCTTGG - Intronic
953266621 3:41395648-41395670 ATAGGCACAGAGTTTCAGTTTGG + Intronic
953408695 3:42675161-42675183 ATATGTACAGAGTTTCAGTTTGG - Intergenic
953520130 3:43634538-43634560 GTAGGACAAGAATTTCAGGTAGG - Intronic
953806117 3:46068947-46068969 CTTGGTACAGATTTTCAGCATGG - Intergenic
953812785 3:46129024-46129046 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
954175259 3:48839983-48840005 ATAGGTACAGAGTTTCAGTTTGG - Intronic
954657016 3:52200287-52200309 ATGGGTATAGAATTTCAGTTTGG - Intronic
955915248 3:63901370-63901392 AAAGGTACAAAATTTCAGTTAGG - Intronic
956175141 3:66465823-66465845 GTGAGTACAGACTTTCAGTTTGG - Intronic
957890896 3:86356147-86356169 ATAGATACAGAATTCCATCTTGG - Intergenic
958673710 3:97238079-97238101 GCATGTACATAATTTTAGCTTGG - Intronic
959036823 3:101376224-101376246 ATAGATACAGAGTTTCAGTTTGG + Intronic
959037117 3:101380197-101380219 ATAGATACAGAGTTTCAGTTTGG + Intronic
959231817 3:103664066-103664088 GTGGGTATAGAGTTTCAGTTTGG + Intergenic
960101855 3:113750582-113750604 GTAGGGCCAGAACTTCAACTAGG - Intronic
960385271 3:117015288-117015310 CTAGATACAGAATTTCAGAGTGG - Intronic
961401586 3:126649869-126649891 ATGGGTATAGAATTTCAGTTTGG + Intronic
961528311 3:127523154-127523176 ATAGGTACAGAGTCTCAGTTTGG + Intergenic
961617107 3:128191582-128191604 ATGGGTACAGAGTTTCAGTTTGG - Intronic
961676636 3:128571475-128571497 ATGGGTGCAGAATTTCAGTTTGG + Intergenic
961747378 3:129073152-129073174 GTGGGGACAGAGTTTCAGTTTGG + Intergenic
963677144 3:148326606-148326628 ATTGGTACAGAATTTCAATTGGG + Intergenic
963777973 3:149458876-149458898 ATGGGTATAGAATTTCAGCTTGG + Intergenic
963823608 3:149927106-149927128 ACAGGTACAGAGTTTCAGTTTGG - Intronic
964003340 3:151803277-151803299 GAAGGAAAAGAATTTCAACTTGG - Intergenic
964015228 3:151937025-151937047 GAAGGTTCAGAATTTCAACCTGG - Intergenic
964704710 3:159605812-159605834 GTAGCTACAGGATCTCAGCGGGG + Intronic
965209466 3:165766878-165766900 TTAGCTCCAGAATTTCTGCTTGG + Intergenic
965505370 3:169509465-169509487 TTGGGTACAGAGTTTCAGTTTGG - Intronic
965616207 3:170595255-170595277 ATGGGTACAGAACTTCAGTTTGG - Intronic
965675323 3:171189042-171189064 ATAGGTACAAAGTTTCAGCTGGG - Intronic
966742421 3:183246309-183246331 ATAGGTACAGAGATTCAGTTTGG - Intronic
966819344 3:183912751-183912773 GTGGGTACAGAGTTTCAGTCTGG + Intergenic
966838881 3:184072098-184072120 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
966963693 3:184967995-184968017 ATAGGTACAGATTTTCAGTTTGG - Intronic
967425162 3:189318418-189318440 GAAGATACAGGATTTAAGCTTGG + Intronic
967893123 3:194377178-194377200 TTAGGGACAGAGTTTCAGTTTGG + Intergenic
968215051 3:196882349-196882371 ATGGGTACAGAATTTCAGTTTGG - Intronic
968428889 4:542896-542918 GCAGCTCCAGAATTTCTGCTTGG - Intergenic
968819748 4:2841891-2841913 ATGGGTACAGAGTTTAAGCTTGG - Intergenic
969136391 4:5032755-5032777 ATGGGGACAGAGTTTCAGCTTGG - Intergenic
969395597 4:6918640-6918662 GCAGAGCCAGAATTTCAGCTGGG + Intronic
969848298 4:9936877-9936899 GAAGGTACTGAATTTCAAGTTGG + Intronic
970220654 4:13806984-13807006 GTCGATTCAGAATGTCAGCTTGG + Intergenic
970797799 4:19935095-19935117 ATAGGTACAGAATTTCAGTTTGG + Intergenic
971368527 4:25996379-25996401 ATGGATACAGACTTTCAGCTGGG - Intergenic
971434290 4:26603926-26603948 ATGGGTACAGAGTTTCAGCTTGG - Intronic
972258597 4:37385275-37385297 GTTGGTTCAGAATTTAAGCAGGG - Intronic
972338146 4:38127140-38127162 GGAGGTAAACAATGTCAGCTGGG - Intronic
972544436 4:40066829-40066851 CTGGGTACAGAGTTTCAGTTTGG - Intronic
972669605 4:41202181-41202203 ATATGTACAGAATTTTAGTTGGG - Intronic
973578721 4:52319489-52319511 ATAAGTACAAAATTACAGCTTGG - Intergenic
973931665 4:55799268-55799290 GTGGGTACAGGGTTTCAGTTTGG + Intergenic
973952245 4:56027885-56027907 ATGGGTACAGAATTTCTGTTTGG - Intronic
974441241 4:61920873-61920895 GTAGGTGCAGCTTTGCAGCTGGG + Intronic
974446506 4:61990435-61990457 GTGGGTACAGAGTTTCATTTTGG + Intronic
974852863 4:67424755-67424777 GTAGGTATAAAATTTCTGTTGGG + Intergenic
974970254 4:68815451-68815473 GTGGGTGCAGAAATTCAGGTGGG + Intergenic
975715046 4:77197441-77197463 CTAGGTAAAGCATTTCAGTTTGG - Intronic
976066654 4:81195508-81195530 ATAGGTACAGAGTTCCAGTTTGG - Intronic
976167926 4:82274945-82274967 GCAGGTGCAGAAGTTCAGCAGGG + Intergenic
976252236 4:83064471-83064493 ATAGGTACAGAGTTTCAGTTTGG - Intronic
976280751 4:83324793-83324815 ATGGGTACAGAGTTTCAGTTTGG + Intronic
976384802 4:84444471-84444493 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
976564057 4:86533276-86533298 ATGGGTACAGAGTTTCAGCATGG + Intronic
976599118 4:86921794-86921816 ATGGGTACAGGATTTCAGTTTGG - Intronic
976645710 4:87385452-87385474 ATGGGTACAGATTTTCATCTTGG + Intronic
976746045 4:88403971-88403993 ATAGTTACAGAATTTCTGTTTGG - Intronic
978141278 4:105319979-105320001 GTGGGTACAGAGTTTCTGTTTGG + Intergenic
978344687 4:107755014-107755036 GTAAGTACAGAATTTAGGTTGGG - Intergenic
978477892 4:109152906-109152928 ATGGGTACAGAGATTCAGCTGGG + Intronic
978851682 4:113344939-113344961 ATAGATACAGAATTTCAGTTAGG + Intronic
978921433 4:114187833-114187855 GCAGATCCAGAATGTCAGCTTGG + Intergenic
981237112 4:142431367-142431389 CTAGGTACAGAATTTCAGAGTGG - Exonic
981575492 4:146200075-146200097 AAAGGTACAAAATTTCAGTTAGG + Intergenic
982151251 4:152460012-152460034 GTAGGTACAGAGTTTCTGTTTGG + Intronic
982253960 4:153434554-153434576 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
982895391 4:160915597-160915619 ATAAGTACACAATTTCAGATGGG + Intergenic
983187905 4:164721726-164721748 ATGGGTACAGAGTTTCAGATTGG - Intergenic
983430091 4:167638660-167638682 CTGGGTACAGAATTTTAGTTTGG + Intergenic
983870002 4:172814151-172814173 ATAGGTACACAATTTCAACAGGG - Intronic
984223880 4:177011147-177011169 GTAGGTACACAATTTGAGCAGGG + Intergenic
984608362 4:181810457-181810479 GTAGCTCCTGAATTTCTGCTTGG + Intergenic
984896532 4:184546510-184546532 GTATGTACATGGTTTCAGCTGGG + Intergenic
984897151 4:184551446-184551468 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
985107791 4:186515738-186515760 ATGGGTACAGAGTTTCAGCTGGG + Intronic
985172457 4:187166447-187166469 ATGGGTATAGAGTTTCAGCTGGG + Intergenic
985243827 4:187959311-187959333 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
989246734 5:39263710-39263732 GTAAGTACAGAATTTCTGAGGGG - Intronic
989309300 5:39995808-39995830 GTAGGTACAAACCTTCAGATTGG - Intergenic
989444906 5:41516102-41516124 ACAGGTACAGAGTTTCAGTTTGG + Intergenic
991137806 5:63203676-63203698 ATAGATACAAAATTACAGCTGGG - Intergenic
991351529 5:65724219-65724241 ATAGGTACAGGGTTTCAGTTTGG - Intronic
991656250 5:68906545-68906567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
991921998 5:71666230-71666252 ATAGGTACAGAGTTCCAGTTTGG - Intergenic
992454081 5:76900552-76900574 TTAGCTTCAGAATTTCTGCTTGG + Intronic
992908044 5:81367082-81367104 GTAGGTATAGAATTCTAGCCTGG - Intronic
993321135 5:86468389-86468411 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
993994524 5:94706742-94706764 GTAGGTATAAAAATTCAGATAGG + Exonic
994088117 5:95782404-95782426 TTGGGTACAGAGTTTCAGTTTGG + Intronic
994673358 5:102789661-102789683 ATAGGTACAGAGTTTCAGTTTGG + Intronic
994727842 5:103457393-103457415 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
996632585 5:125652252-125652274 GTGGGTACAAAGTTTCAGTTAGG + Intergenic
996721855 5:126638052-126638074 ATATGTACAGAATTTCATATTGG + Intergenic
996886803 5:128366185-128366207 GTAGATACACATTTTCATCTTGG - Intronic
997073711 5:130646890-130646912 GTAGGAGCAGACTTTCAGTTCGG + Intergenic
997112094 5:131086611-131086633 ATAGGTACACAGTTTCAGATTGG - Intergenic
997169844 5:131706114-131706136 ATGGATACAGAGTTTCAGCTGGG + Intronic
997205635 5:132047545-132047567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
998043789 5:138970333-138970355 TTAGGTACAGGATTTCACCAGGG + Intronic
998237663 5:140413461-140413483 ACAAGTACAGAATTTCAGTTTGG - Intronic
998332044 5:141337646-141337668 ATAAGTACAGAGTTTCAGTTGGG + Intronic
999185909 5:149708728-149708750 GTTGGTAAAGAAATTGAGCTAGG + Intergenic
999695807 5:154188128-154188150 ATGGGTACAGAGTTTCAGTTGGG + Intronic
999795248 5:154982802-154982824 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1000202679 5:159027105-159027127 GTATGTCCAGCATTTCAGCAGGG + Intronic
1002147929 5:177200535-177200557 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1002156381 5:177284110-177284132 GTAGGTATAGAGTTTTAGCAGGG - Intronic
1003090871 6:3101909-3101931 GCAGGTACAGAGTTTCAGTTTGG - Intronic
1003320338 6:5045487-5045509 AAAGGTACAGAGTTTCAGTTTGG + Intergenic
1003531843 6:6943633-6943655 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1003549329 6:7088193-7088215 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1003587519 6:7406460-7406482 ATGGGTACAGAATATCAGTTTGG - Intronic
1003597207 6:7484697-7484719 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1004200613 6:13544357-13544379 ATGGGTACAGAATTTCTGTTTGG - Intergenic
1005062529 6:21790345-21790367 ATGGGTACAGAGTTTCAGGTTGG - Intergenic
1005320840 6:24651986-24652008 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1006381463 6:33700306-33700328 GTAGCTTCAGAATTTCCTCTGGG + Intronic
1006614460 6:35316834-35316856 GTAGGTACAGAGTTTCTGTTTGG - Intronic
1006792195 6:36710164-36710186 ATGGGTGCAGAATTTCAGTTTGG - Intronic
1008006140 6:46411354-46411376 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1008057294 6:46958394-46958416 GTGTGTACAGAGTTTCAGTTAGG + Intergenic
1009044670 6:58223905-58223927 ATAGGTACAGAGTTTCAGTATGG + Intergenic
1010475958 6:76287583-76287605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1011152844 6:84293381-84293403 ATAGGTACAGAGTTTCAGTTTGG - Intergenic
1011869419 6:91873821-91873843 GCTGGTACAGAGTTTCAGTTTGG + Intergenic
1012501542 6:99893649-99893671 TTAGGTACAGAATTATAGATTGG + Intergenic
1012573735 6:100764286-100764308 GTAAATACAGAATTTGAACTGGG + Intronic
1012879764 6:104772878-104772900 ACGGGTACAGAATTTCTGCTTGG + Intronic
1013420616 6:109963244-109963266 ATGGGTACAAAATTACAGCTAGG + Intergenic
1015599566 6:134899368-134899390 ATAGGAACAGAGTTTCAGTTTGG - Intergenic
1015607461 6:134973470-134973492 ATGGGTACAGATTTTCAGTTTGG + Intronic
1016063262 6:139652495-139652517 GTGGGTACAGAATCACAGATTGG - Intergenic
1016950600 6:149576087-149576109 GTAGGTCGAGAATCTGAGCTTGG + Intronic
1017469812 6:154728499-154728521 ATAGGTACAGAACTTCAGGTTGG - Intergenic
1017548138 6:155473549-155473571 ATAATTACAGAATTTCTGCTTGG - Intergenic
1018601212 6:165543721-165543743 GTGGGTACAGAGTTTCTACTGGG + Intronic
1020667699 7:11068556-11068578 AGGGGTACAGAGTTTCAGCTGGG + Intronic
1020898802 7:13976237-13976259 ACAGGTACAGAACTTCAGCTTGG + Intronic
1021115510 7:16742188-16742210 GTAGGTAAGGAATTTAAGCAGGG - Intergenic
1021848638 7:24786682-24786704 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1021922767 7:25503249-25503271 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1022322755 7:29302721-29302743 ATCGGTACAGAGTTTCAGTTTGG - Intronic
1022877696 7:34552311-34552333 GTAGGGACAGAACTGCAGCCAGG + Intergenic
1023017694 7:35983505-35983527 ATAGGTACAGAATTTCTGTTTGG + Intergenic
1023341238 7:39222526-39222548 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1023751129 7:43373753-43373775 GTGGGGACAGAATTTCAGTTTGG - Intronic
1023877892 7:44299403-44299425 GTGGGTACAGAGTTTCAGTTGGG + Intronic
1024205535 7:47156541-47156563 GTGGGTACAGCATTTCAGTTTGG + Intergenic
1024836774 7:53529891-53529913 ATGGGTAAAGAATCTCAGCTGGG - Intergenic
1024960163 7:54966035-54966057 ATGGGTACAGAGTTTCTGCTTGG - Intergenic
1025962660 7:66237246-66237268 GTAGGTACAGAGGTTCTGCAAGG - Intronic
1025968102 7:66294148-66294170 ATGGGTACAGAATTTCAGTTTGG - Intronic
1027879243 7:83812375-83812397 GTGGGTACAGAATTCTAGGTTGG + Intergenic
1027936040 7:84603699-84603721 TTAGCTCCAGAATTTCTGCTTGG - Intergenic
1028180834 7:87722315-87722337 AAAGGTACAAAATTTCAGTTAGG - Intronic
1028193947 7:87883297-87883319 ATGGGTACAGACTTTCAGTTTGG + Intronic
1028619285 7:92805950-92805972 GTGAGTACAAAATTTCAGTTTGG + Intronic
1030043726 7:105475808-105475830 ATGGGTATAGAGTTTCAGCTGGG - Intronic
1030199103 7:106884436-106884458 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1030259272 7:107544954-107544976 TTAGTTCCAGAATTTCAGTTTGG - Intronic
1030619324 7:111772122-111772144 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1032025866 7:128441944-128441966 GAAGGTATAGAATCTGAGCTGGG - Intergenic
1032805162 7:135347018-135347040 GTGGGTACAGAGTTCCAGTTTGG - Intergenic
1033432572 7:141302522-141302544 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1034068963 7:148164319-148164341 GCAGGTACAGAATTGCAACTTGG + Intronic
1034572887 7:151971620-151971642 TCAGGTACAGAATTTCAGTTTGG - Intronic
1034853103 7:154514511-154514533 ATAGGGACAGAGTTTCAGTTTGG - Intronic
1036117800 8:5978631-5978653 ATAGGTACAGAATTTCAGTTTGG + Intergenic
1036137710 8:6176860-6176882 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1036399696 8:8396788-8396810 GTGGGTACAGAACTGCAGTTTGG + Intergenic
1036772827 8:11590865-11590887 ATGGGTACAGAATTTCAGTTAGG + Intergenic
1037120101 8:15273696-15273718 AAAGGTACAGAATTTTTGCTTGG - Intergenic
1037766027 8:21772799-21772821 TTAGGTAAAGATTTTCTGCTAGG + Intronic
1038155549 8:24985983-24986005 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1038277381 8:26133224-26133246 ATGGGTACAGAATTTCTGTTTGG + Intergenic
1038371306 8:26994578-26994600 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1038566996 8:28627956-28627978 ATGGGTACAGAGTTTCAGCCTGG + Intronic
1039015608 8:33145740-33145762 ATAATAACAGAATTTCAGCTAGG + Intergenic
1039086566 8:33786116-33786138 GTAGGAGCAGAAAATCAGCTCGG + Intergenic
1039398946 8:37252171-37252193 ATAGGTACAGAGTTTCTGTTTGG + Intergenic
1039592578 8:38762240-38762262 ATGGGTACAGAATTTCTGTTTGG - Intronic
1039677946 8:39690652-39690674 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1039721225 8:40166655-40166677 GTGGGTGCAGCATTTCAGTTTGG + Intergenic
1040594167 8:48821710-48821732 GCAGGTCCAGATTTTCAGGTGGG - Intergenic
1041061889 8:54042545-54042567 GTGGGTACAGGGTTTCAGTTTGG + Intergenic
1041206294 8:55501417-55501439 ATGGGTACAGAATTTCAGTTTGG - Intronic
1041339325 8:56825580-56825602 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1042285779 8:67108871-67108893 GAAGGGACAGAAAATCAGCTTGG - Intronic
1042811019 8:72825014-72825036 GTGGGTTCAGACTTTCAGTTTGG - Intronic
1043429569 8:80181821-80181843 ACAGGTACAGAGTTTCAGTTGGG + Intronic
1043470874 8:80561211-80561233 GTATATACAGGATTTCTGCTGGG - Intergenic
1044117658 8:88354288-88354310 GTAGAGACAGAATTTCACCGTGG + Intergenic
1044667384 8:94643539-94643561 ATGAGTACAGAATTTCAGTTTGG + Intronic
1044985707 8:97754822-97754844 GTAGAGACAGCGTTTCAGCTGGG + Intergenic
1045119446 8:99019600-99019622 ATGGATACAGAATTTCAGTTTGG - Intronic
1045194752 8:99919233-99919255 ATGGGTACAGAATTTCAGCTTGG + Intergenic
1045289467 8:100820143-100820165 GTGGGTACAAAGTTTCAGCTTGG + Intergenic
1045431543 8:102119438-102119460 GTGGAAACAGAGTTTCAGCTGGG + Intronic
1045485088 8:102624849-102624871 ATAGATACAGAGTTTCAGTTTGG - Intergenic
1046168753 8:110476636-110476658 ATAGGTACAGAGTTTTAGTTGGG - Intergenic
1046926457 8:119794523-119794545 GTAGGCCCAGGATTCCAGCTTGG - Intronic
1047269354 8:123340817-123340839 ATAGGTACAGAGTTTCTGCTTGG + Intronic
1047857835 8:128931743-128931765 GTAGGTTTAGAATGTCATCTGGG + Intergenic
1048103866 8:131385825-131385847 ATGGGTACAGAATTTCAGCTTGG + Intergenic
1048439270 8:134447948-134447970 GAAGGTACAGAGATCCAGCTGGG - Intergenic
1048462642 8:134635219-134635241 GGAGGCCCAGAAGTTCAGCTGGG - Intronic
1048586007 8:135774752-135774774 GCAGATACAAAATTACAGCTAGG + Intergenic
1048816776 8:138341450-138341472 GTGGGTTCAGAGTTTCAGCTGGG + Intronic
1049233925 8:141499331-141499353 CTAGGTATGGAATTCCAGCTTGG - Intergenic
1049986481 9:956297-956319 ATGGGTACAGAATTTCAGTTTGG + Intronic
1051330106 9:16015741-16015763 ATAGGTACAGAGTTTCAGTTGGG - Intronic
1051544381 9:18257987-18258009 CTGGGTACAGAATTTCTGTTTGG + Intergenic
1052497335 9:29244202-29244224 GTAGGAACTGAATTACTGCTGGG - Intergenic
1052887528 9:33664690-33664712 GCAGGTACAGGATCTCAGATGGG - Intergenic
1053041502 9:34877500-34877522 GTAGGTACAGAGTTTCTGTTTGG + Intergenic
1053176934 9:35932892-35932914 GTTGGTACAGAGTTTCACTTTGG - Intergenic
1053317360 9:37063337-37063359 CTGGGTACAGAGTTTCAGTTTGG + Intergenic
1056083719 9:83123926-83123948 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1057673425 9:97116508-97116530 ATGGATACAGAATTTCAGTTTGG + Intergenic
1057710233 9:97434376-97434398 GGACGTACACAATTTCAGTTAGG + Intronic
1058004111 9:99896972-99896994 TTAGCTTCAGAATTTCTGCTTGG - Intergenic
1058912065 9:109530200-109530222 ATGGGTACAGAATTTTAGTTTGG - Intergenic
1058957833 9:109965602-109965624 ATGGGTACAGAATTTCAGTTTGG + Intronic
1058970989 9:110082819-110082841 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1059182053 9:112225433-112225455 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1059275491 9:113093217-113093239 GTAGGTACAAAGTTGCAGTTAGG + Intergenic
1059457209 9:114406978-114407000 GTGGGGACAGAATTCCAGCTGGG - Intronic
1059621371 9:116009349-116009371 ATGGGTACAGAGTTTCAACTGGG - Intergenic
1059631918 9:116134214-116134236 ATGGGTATACAATTTCAGCTGGG + Intergenic
1060699205 9:125736148-125736170 ATGGGTACAGGTTTTCAGCTTGG + Intergenic
1060762642 9:126268825-126268847 GTAGGCACAGCATTTCAGAAGGG - Intergenic
1062383479 9:136298812-136298834 GTGGGGACAGAGTTTCAGTTTGG + Intronic
1186031449 X:5373570-5373592 ATGGATACAGAGTTTCAGCTGGG - Intergenic
1187394662 X:18908814-18908836 GAATGTACAGAATGTCTGCTTGG + Exonic
1188071161 X:25719974-25719996 TAAGATACAGAATGTCAGCTGGG - Intergenic
1188435842 X:30157596-30157618 ATGGGTACAGAATTTCAGTTTGG + Intergenic
1188868085 X:35339523-35339545 ATAGGTACAGAGATTCAGTTTGG + Intergenic
1188952539 X:36393952-36393974 CTGGGTACAGAGTTTCAGCTTGG - Intergenic
1189430366 X:40940967-40940989 AAAGGTACAGAATTTCAGACAGG - Intergenic
1190401644 X:50042130-50042152 TTGGGTACAGAATTTCTGTTTGG + Intronic
1192268073 X:69554030-69554052 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1193131015 X:77919889-77919911 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1193220113 X:78914175-78914197 ATGGATACAGAATTTCAGTTTGG - Intergenic
1195635607 X:107111901-107111923 ATAAGTACAGAGTTTCAGTTTGG + Intronic
1195677588 X:107519097-107519119 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1195972165 X:110484802-110484824 ATGGCTACAGAATTTCAGTTTGG - Intergenic
1196136361 X:112213755-112213777 ATTGGTACAGAGTTTCAGTTTGG - Intergenic
1197047693 X:122019149-122019171 ATAGGTACAGATTTTTAGTTTGG - Intergenic
1197231083 X:124004313-124004335 ATGGGTATAGAGTTTCAGCTGGG - Intronic
1197740031 X:129884181-129884203 GTGGGTACAGAGTTTCAGTATGG - Intergenic
1198542045 X:137650216-137650238 AAGGGTACAGAATTTCGGCTAGG + Intergenic
1199287879 X:146074096-146074118 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1199388202 X:147247947-147247969 GTAGGTAGAGAATTTGACATCGG + Intergenic
1199426787 X:147711625-147711647 GGGGGTACAAAATTTCAGTTAGG - Intergenic
1199440446 X:147862077-147862099 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1200293592 X:154894841-154894863 GTTGGTACTGACTGTCAGCTAGG - Intronic
1201350978 Y:13041002-13041024 GTAAGTACAGAGTTTCTGTTTGG + Intergenic