ID: 952922231

View in Genome Browser
Species Human (GRCh38)
Location 3:38293433-38293455
Sequence CTTAAAAACCCTATTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 3, 1: 57, 2: 47, 3: 17, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952922231_952922235 0 Left 952922231 3:38293433-38293455 CCAAGTTCAATAGGGTTTTTAAG 0: 3
1: 57
2: 47
3: 17
4: 170
Right 952922235 3:38293456-38293478 TTTTGCTCCGGGCCTAAGGCAGG 0: 2
1: 0
2: 0
3: 10
4: 102
952922231_952922234 -4 Left 952922231 3:38293433-38293455 CCAAGTTCAATAGGGTTTTTAAG 0: 3
1: 57
2: 47
3: 17
4: 170
Right 952922234 3:38293452-38293474 TAAGTTTTGCTCCGGGCCTAAGG 0: 16
1: 69
2: 25
3: 9
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952922231 Original CRISPR CTTAAAAACCCTATTGAACT TGG (reversed) Intronic
904705655 1:32388630-32388652 CTTACAAAGCCTATATAACTTGG + Intronic
905950378 1:41945949-41945971 CTTAGAAACCCTACTGAACTTGG + Intronic
906507310 1:46389666-46389688 CTTAGAAACCCTATTGAACTTGG - Intergenic
907037371 1:51228566-51228588 CTTAGAAACCCTATTGAACTGGG + Intergenic
907505605 1:54915802-54915824 CTTAGAAACCCTATTGAACTTGG - Intergenic
907602540 1:55785329-55785351 CTTAGAAACCCTATTGAACTTGG - Intergenic
909023521 1:70458582-70458604 TTTAAAACCCTTATTGCACTTGG + Intergenic
910591025 1:88928309-88928331 CTTAGAAACCCTATTGAACTTGG + Intergenic
912190400 1:107332296-107332318 CTTAAAAAATCTATGGCACTAGG - Intronic
912463922 1:109856216-109856238 CTTAGAAACCCTACTGAACTTGG - Intergenic
912535091 1:110361888-110361910 CATAAAAACCATATTTAAATAGG + Intergenic
912618544 1:111132198-111132220 CATAAAAACCCAAATGGACTGGG + Intronic
915068637 1:153246909-153246931 CTTAAAGACCCTAAGAAACTGGG - Intergenic
917271997 1:173287020-173287042 TTTAAAAACCATAATGAGCTGGG + Intergenic
918940994 1:190996511-190996533 CTTAAAGACCTGATTGACCTAGG + Intergenic
919366466 1:196668018-196668040 ATTAAAAACACTATTAAACATGG + Intronic
920425222 1:205869545-205869567 CTTAAAAACCCTAATGAACTTGG - Intergenic
921092633 1:211858093-211858115 CTTAGAAACCCTATTGAACTTGG + Intergenic
922227411 1:223657457-223657479 CTTAAAAACTCTCTTAAAATAGG + Intronic
922684699 1:227630018-227630040 CTTAGAAACCCTAGTGAACTTGG - Intronic
923649714 1:235863090-235863112 CTTAAAAAAAATCTTGAACTTGG + Intronic
1063749716 10:8929584-8929606 TTTATAAAGCCTATTGCACTGGG - Intergenic
1064809844 10:19183617-19183639 CTTAATAACCCGTTTGAAGTAGG - Intronic
1065199621 10:23300444-23300466 CTTAGAAACTCTATTGAACTTGG - Intronic
1068246819 10:54382675-54382697 CATAACAACCTGATTGAACTTGG + Intronic
1068791833 10:61037720-61037742 CTTAAAAACCCTATTGAACTTGG - Intergenic
1069767901 10:70877319-70877341 CTCCAAAACCCCACTGAACTTGG + Exonic
1071327024 10:84527705-84527727 CTTAGAAACCCTATTAAACTTGG - Intergenic
1072471930 10:95720984-95721006 TTAAAAAACCCTATTGAACTTGG - Intronic
1073621907 10:105058862-105058884 CTTAAAAAATATATTGTACTTGG + Intronic
1074993463 10:118733266-118733288 CTTAAAAACCAAATTGAAAAAGG + Intronic
1079399863 11:20098006-20098028 CTTAATAACCCTGTTGAAATAGG + Intronic
1079601324 11:22315708-22315730 ATTAGAAACCCTATTGAACTTGG - Intergenic
1079887143 11:26003105-26003127 CTTAGAAGCCCTATTGAACTTGG + Intergenic
1079933746 11:26593919-26593941 CTTAGAAACCCTATTTAACTTGG - Intronic
1081070563 11:38604880-38604902 CTTAGAAACCCTATGGAAATTGG + Intergenic
1081347950 11:42013423-42013445 TTTAAAAGCCCTAATGAACTTGG - Intergenic
1081383531 11:42444735-42444757 CTTTAAAATCCAATTTAACTGGG + Intergenic
1085601780 11:77861859-77861881 CTTAGAAACCCTGTTGAACTTGG - Intronic
1089122766 11:116149785-116149807 TTTAAAAAGTCTATTAAACTGGG + Intergenic
1092294063 12:7184335-7184357 CTTAGAAACCCTATTGAACTTGG + Intergenic
1092469462 12:8765008-8765030 CTTAGAAACCCTATTGAACTTGG - Intronic
1093348549 12:18069771-18069793 CTTAGAAACCCTATTGAACTTGG + Intergenic
1095138964 12:38639619-38639641 CTTAGAAACCCTATTTAACTTGG + Intergenic
1095283915 12:40387398-40387420 CTTAGAAACCCTATTGAACTTGG + Intergenic
1096352082 12:50908808-50908830 CTTAGAAACCCTATTGAACTTGG - Intergenic
1096914994 12:55021731-55021753 CTGAAAGACCCTATAGAACGAGG + Intronic
1097092779 12:56520518-56520540 TTTAACATCCCTATTGCACTTGG + Intergenic
1097149675 12:56967284-56967306 CTTAGAAACCCTATTGAACTTGG - Intergenic
1097377274 12:58855874-58855896 CTTAGAAACCCTATTGAACTTGG - Intergenic
1098641930 12:72849392-72849414 CTTCACAATCCTAGTGAACTTGG - Intergenic
1099605252 12:84795613-84795635 CTTAGAAACCCTGTTGAACTTGG + Intergenic
1100154699 12:91784323-91784345 CTTAAGAAACTTATTCAACTTGG - Intergenic
1100564769 12:95784800-95784822 ATTAAAAACACTTATGAACTAGG + Intronic
1100645310 12:96523060-96523082 CTTCAAAACGATATAGAACTGGG - Intronic
1101238171 12:102811132-102811154 GGTTAAAACCCTATTTAACTTGG + Intergenic
1103803037 12:123552005-123552027 CTTAGAAACCCTATTGAACTTGG + Intergenic
1104851558 12:131877519-131877541 CTTAGAAACCCTATTGAACTTGG - Intergenic
1105455596 13:20538538-20538560 TTTAAAAACCCAATTAAATTGGG + Intergenic
1105750222 13:23416412-23416434 CTTAAAAACACTACTAAAATTGG + Intronic
1106241371 13:27916223-27916245 CTTAAAAACCGAATTGAATTGGG - Intergenic
1107727114 13:43309906-43309928 CTTAAAAATCCTCTGCAACTGGG + Intronic
1108876669 13:55057488-55057510 TTTAGAAACCCTATTGAACTTGG + Intergenic
1109606737 13:64706489-64706511 CTTAGAGACCCTATTGAACTTGG - Intergenic
1111806174 13:93042620-93042642 CTTAGAAACCCTACTGAACTTGG + Intergenic
1111866543 13:93775818-93775840 CTTTAAAACTCTGTTGAAATTGG - Intronic
1112592578 13:100777093-100777115 CTTAAAAACCCAAGAGGACTGGG - Intergenic
1112942288 13:104878348-104878370 ATTAAAAACAATATTGCACTGGG + Intergenic
1114384308 14:22240118-22240140 CTTAGAAACCCTACTGAACTTGG + Intergenic
1115672730 14:35633417-35633439 CATAAATACACTATTGAAATAGG - Intronic
1117748904 14:58900454-58900476 CTTAAAAAGCCATGTGAACTTGG - Intergenic
1118290835 14:64520533-64520555 TTTAAAAACCCTATTAAGCCTGG - Intronic
1119045965 14:71319583-71319605 CGTAAAAACCCTATTCACCATGG - Intergenic
1122677275 14:103425949-103425971 TTTAAAAACCCTGCTTAACTTGG - Intronic
1127074302 15:55310720-55310742 CTTAGAAAACCTATTGAACTTGG - Intronic
1127176812 15:56366914-56366936 CTTAAGTACACTTTTGAACTGGG - Intronic
1128362640 15:66973082-66973104 CTTAGAAACCCTATTGCACTTGG - Intergenic
1129576820 15:76758163-76758185 CAGAAAAACCTTATTGATCTTGG - Intronic
1129992761 15:79979065-79979087 CTTAAAAGTCCTATTCAAATAGG - Intergenic
1130008033 15:80120960-80120982 ATAAAAAACCCTAGTGAACTGGG - Intronic
1130804699 15:87307474-87307496 CTGAAATACCCTCTTTAACTAGG - Intergenic
1131454416 15:92571936-92571958 CCTGGAAACCCTATTGGACTAGG - Intergenic
1131959236 15:97771550-97771572 TTTAAAAATTCTATTTAACTTGG - Intergenic
1134648961 16:15893177-15893199 CATAAAAACCCAAGAGAACTGGG + Intergenic
1135054894 16:19223298-19223320 CTTAGTAACCCTATTGGAATTGG + Intronic
1135224724 16:20646036-20646058 CTTAGAAACCCTATTGAACTTGG + Intronic
1140491654 16:75342035-75342057 CTTAAAAAAGCTATTTAACTTGG - Intronic
1140682002 16:77394186-77394208 TTTAAAAACCCTTTGGAAATGGG - Intronic
1142515610 17:426423-426445 CTTAAACTCCCTATAGAACAGGG - Intergenic
1148827082 17:50401621-50401643 TTTAGAAACCCTATTGAACTTGG - Intergenic
1149268270 17:54951362-54951384 ATTAAAAACCCTAGAGGACTGGG - Intronic
1149274101 17:55014986-55015008 CTTAGAAACCCTATTGAACTTGG - Intronic
1151895504 17:76977801-76977823 CTTCAAAGCCCTCTAGAACTAGG + Intergenic
1153081616 18:1232928-1232950 GTTAAAAACTCTAATAAACTAGG - Intergenic
1153401536 18:4688452-4688474 CTTAGAAACCCTATTGAACTTGG + Intergenic
1153954182 18:10082178-10082200 TTTAAAAACCAAATTCAACTGGG + Intergenic
1156427368 18:37028705-37028727 CTTAAAAACCCTCAACAACTAGG - Intronic
1156740968 18:40327263-40327285 CAGAAAAACGCTATTGAAATTGG + Intergenic
1157702375 18:49770256-49770278 CCTAAAAAACCTATTGAAATAGG - Intergenic
1158176355 18:54661235-54661257 CATTAAAACACTATTGAAATTGG + Intergenic
1159608386 18:70498933-70498955 CTTAAAATCCCTACTGGACTTGG + Intergenic
1164057344 19:21632960-21632982 CTTAGAAACCCTATTGAACTTGG + Intergenic
1164173548 19:22748495-22748517 CTTAGAAACCCTGTTGAACTTGG + Intergenic
1164323150 19:24168502-24168524 CTTAGAAACCCTATTGAACTTGG - Intergenic
1164848698 19:31460884-31460906 CATATAAACCTTAGTGAACTTGG + Intergenic
1165535685 19:36442482-36442504 CCTAAAACCCCTTTTTAACTGGG + Intergenic
1167737272 19:51303038-51303060 CTTAAAAACCCAAAGGGACTGGG - Intergenic
1168449966 19:56458679-56458701 CTTAAAAACTCCAGTGGACTGGG + Intronic
928050030 2:27982598-27982620 CTTAAAAAACCCATTTAATTGGG + Intronic
928125052 2:28609751-28609773 CTTGAAAACCCTAATGAAGTTGG - Intronic
928476442 2:31632153-31632175 CTTAGAAACCCTATTGAACTTGG + Intergenic
928677034 2:33660567-33660589 CTTAGAAACCCTGTTGAACTTGG + Intergenic
929987587 2:46750970-46750992 CTTAATGACACTATTGTACTTGG + Intronic
930368897 2:50479330-50479352 CTTCAAAATCCTACTCAACTTGG + Intronic
930631537 2:53759500-53759522 CTTAGAAACCCTACTGAACTTGG + Intronic
932689787 2:73902435-73902457 CTCAAATACCCCATTGAACACGG + Exonic
932917662 2:75875474-75875496 CTGAGAAACCCTATTGAACTTGG + Intergenic
933175270 2:79166733-79166755 CTTAGAAACCCTACTGAACTTGG - Intergenic
933986863 2:87599392-87599414 CTTAAAAACCAAAGTGACCTGGG - Intergenic
934672076 2:96220520-96220542 CTTAGAAACCCTATTGAATTTGG - Intergenic
935748676 2:106211759-106211781 CTTAGATACCCTATTGAACTTGG + Intergenic
936306981 2:111351416-111351438 CTTAAAAACCAAAGTGACCTGGG + Intergenic
936387312 2:112041711-112041733 CTTAGAAACCCTATTGAACTTGG - Intergenic
936390871 2:112071964-112071986 GTTAAAAACTCTAATAAACTAGG - Intronic
939229664 2:139410032-139410054 CTTAAAAACCCTAAGCATCTGGG + Intergenic
939378918 2:141408442-141408464 CTTAAAAACCTTATGAAACCTGG - Intronic
939493662 2:142904029-142904051 CTTAGAAACCCTATTGAACTTGG - Intronic
939813596 2:146866757-146866779 ATTAAAAACACTATTGGCCTAGG + Intergenic
940158478 2:150684453-150684475 CTTAAAACCCCTAGTAAATTTGG - Intergenic
940328716 2:152452553-152452575 CTTAAAAACACTCTTGTAATGGG + Intronic
940775335 2:157877673-157877695 CTTACAAACTGTTTTGAACTGGG + Intronic
942580434 2:177411146-177411168 CTTAGAAACCCTACTGAACTTGG - Intronic
942816486 2:180059438-180059460 CTTAGAAACCCTATTGAACTCGG + Intergenic
942830792 2:180236077-180236099 CTTAGAAACCCTGTTGAACTTGG + Intergenic
943568779 2:189547386-189547408 CTTATAAACTCTATTGAAAGTGG + Intergenic
944039354 2:195336554-195336576 CTTAGAAACCCTATTGAACTTGG - Intergenic
945048961 2:205805717-205805739 GTTAAAAACCCAAGGGAACTGGG - Intergenic
948318401 2:237048213-237048235 ATTATAAACCCTATTGTAGTAGG - Intergenic
1173380081 20:42532209-42532231 CTCAAAGAACCTAATGAACTTGG - Intronic
1174567285 20:51474401-51474423 CTGAAAAACTCTATGTAACTGGG + Intronic
1177263516 21:18756763-18756785 CTTAGAAACCCTATTGATCTTGG - Intergenic
1177640358 21:23836839-23836861 CTAAAAAGCCATTTTGAACTTGG - Intergenic
1177896250 21:26858483-26858505 CTTAGAAACCCCATTGAACTTGG + Intergenic
1178248666 21:30979289-30979311 ATTAAAAATGCTATTGAAGTGGG - Intergenic
1178737223 21:35163257-35163279 CTTATTAACCTTATTGATCTGGG + Intronic
1179259137 21:39742849-39742871 CTTAGAAACCCTATTGAACTTGG - Intergenic
1182570040 22:31230143-31230165 CTTGTAAACACTATTGTACTTGG + Intronic
951037142 3:17945898-17945920 CTGAAAACCCCTAATTAACTTGG - Intronic
951200691 3:19873001-19873023 CTTAGAAACCCTATTGAACTTGG - Intergenic
951837863 3:27002702-27002724 CTTAGAAACCCTATTGAACTTGG + Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952313560 3:32212161-32212183 CTTAAAAACACTATTGGGCCAGG - Intergenic
952922231 3:38293433-38293455 CTTAAAAACCCTATTGAACTTGG - Intronic
953499219 3:43416962-43416984 TTTTAAAATCCTATTGAAATTGG - Intronic
955293587 3:57715183-57715205 CATAAAAACCCTAAAGAACAAGG + Intergenic
955758735 3:62254899-62254921 TTTAAAAACCATATTTAACCTGG + Intronic
956230236 3:67006691-67006713 CTTGAAAACTGTTTTGAACTAGG - Intronic
957000287 3:74876409-74876431 CTTAGAAACCCCATTGAACTTGG - Intergenic
957329852 3:78748143-78748165 CTTTTAAAACCTATTGAATTGGG + Intronic
958016269 3:87942811-87942833 CTTAGAAACCCTGTTGAACTTGG - Intergenic
958629808 3:96670852-96670874 CTTAGAAACCCTATTGAATTTGG - Intergenic
959405519 3:105958154-105958176 TTTAAAAACCCCAAGGAACTTGG - Intergenic
962620862 3:137176945-137176967 CTTAAATACAATATTGAACTCGG - Intergenic
963185702 3:142414214-142414236 CTCAAAATCCATTTTGAACTAGG - Exonic
963187944 3:142439668-142439690 CTTAGAAACTCTACTGAACTTGG + Intronic
963915760 3:150857751-150857773 CTTAGAAACCCTACTGAACTTGG + Intergenic
964195261 3:154056961-154056983 TTTAAAAACCCTTTTGTAATGGG + Intergenic
965754836 3:172015170-172015192 CATAAAAACCCAAATGGACTGGG + Intergenic
965825146 3:172722612-172722634 CTTAGAAACCCTATTGAACTTGG + Intergenic
966353494 3:179056240-179056262 CTTAGAAACCCTATTTAACTTGG + Intronic
966502877 3:180665129-180665151 TTTTCAAACCCCATTGAACTGGG + Intronic
966590929 3:181682210-181682232 CTTAACAACCCTAATGATCAGGG - Intergenic
966902441 3:184496497-184496519 CTGAAAAACCCTAATACACTGGG + Intronic
967623557 3:191662004-191662026 CTTAGAAACCCTATTGAACTTGG + Intergenic
968391180 4:194123-194145 CTTAGAAACCCTATTGAACTTGG - Intergenic
969644917 4:8422453-8422475 CATAGAAACTCTAATGAACTTGG + Intronic
970588298 4:17535352-17535374 CTTAACAAACCTATGCAACTAGG + Intergenic
972181971 4:36478152-36478174 ATTAAAAACCTTATTCAAGTTGG - Intergenic
972781353 4:42289361-42289383 CTTAGAAACCCTATTGAACTTGG - Intergenic
972799156 4:42455048-42455070 CTTACAAACCCAAGTGAATTTGG + Intronic
974096482 4:57370091-57370113 CTTAAAATTCCAATTTAACTGGG - Intergenic
974520460 4:62975422-62975444 CTTAGAAACCCTACTGAACTTGG + Intergenic
974978852 4:68927131-68927153 CAAAAAAATCCTATTTAACTTGG - Intergenic
975003278 4:69253468-69253490 ACAAAAAACCCTATTTAACTTGG + Intergenic
975313821 4:72930118-72930140 CTTAGAAACCCTATTGAACTTGG - Intergenic
975854396 4:78607879-78607901 TTTTAAGACCCTATTGATCTGGG - Intronic
975909991 4:79256097-79256119 TTTAAAAACCCAACTGAAGTAGG - Intronic
976189837 4:82477431-82477453 CTTAGAAACCCTATTGAACTTGG + Intergenic
978377516 4:108090971-108090993 CTTAAAAACACTATAGTAATGGG + Intronic
978586809 4:110282779-110282801 CTTAGAAACCCTATTGAACTTGG - Intergenic
978909553 4:114048227-114048249 CTTAGAAACCCTATTGAACTTGG + Intergenic
980444205 4:132885548-132885570 CTTAAAAACCCTATTAAAATTGG + Intergenic
983667022 4:170193791-170193813 CTTAAAAACCCTATTGAACTTGG - Intergenic
984723744 4:183000806-183000828 CTTAGGAGCCCTATTGAACTTGG + Intergenic
988457099 5:31395982-31396004 CTTAGAAACCCTACTGAACTTGG - Intergenic
988682367 5:33496343-33496365 CATAAAAACCCAAGAGAACTGGG - Intergenic
988957182 5:36331441-36331463 CTTAGAAACCCTATTGAACTTGG - Intergenic
989488027 5:42014603-42014625 GTTAAAAAACCTAGTGAAGTAGG - Intergenic
989534682 5:42550186-42550208 CTGAAAAAGCCCATTGGACTGGG + Intronic
989811451 5:45681669-45681691 CTTTAAAACCTTATTGTACAGGG - Intronic
990390021 5:55309291-55309313 TTTTAAAACCCTGTTGAACAAGG + Intronic
990892289 5:60662432-60662454 CTTAGAAACCCCATTGAACTTGG + Intronic
992212335 5:74493122-74493144 CATAAAAACCCAAAAGAACTGGG - Intergenic
993057728 5:83001726-83001748 CTTAAAAATGCCTTTGAACTTGG + Intergenic
993354287 5:86886833-86886855 ATTTAAAACTATATTGAACTTGG - Intergenic
995465640 5:112447461-112447483 CTTAGAAACCCTACTGAACTTGG + Intergenic
995551544 5:113286633-113286655 ATAAAAAAGCCCATTGAACTGGG - Intronic
996987820 5:129588820-129588842 CTTTAAAAACCTCTTGAATTGGG - Intronic
998650939 5:144120703-144120725 GTTAAAAACCCTCAAGAACTAGG - Intergenic
1000581426 5:163039434-163039456 TGTAAATACCCTATTGACCTTGG + Intergenic
1003292631 6:4793180-4793202 GTGAGAAACCCTGTTGAACTGGG + Intronic
1004236813 6:13881783-13881805 CTTAGAAACCCTATTGAACTTGG + Intergenic
1005064701 6:21807102-21807124 TTTAAAAACCCTGAAGAACTAGG + Intergenic
1005991721 6:30907355-30907377 CTTAAAAACTGTATTTATCTGGG + Intergenic
1008496718 6:52141468-52141490 CTTAGAAAGCCTATTGGATTTGG - Intergenic
1008582373 6:52918555-52918577 TTTAGAAACACTATTGAACTTGG - Intergenic
1009426170 6:63515711-63515733 ATTAAAAACCCTTGTGAGCTAGG + Intergenic
1009501789 6:64422480-64422502 CTTTAAAACCTTATGGTACTTGG + Intronic
1009544777 6:65008382-65008404 CTTAGAAACCCTATTGAACGTGG + Intronic
1010893496 6:81340781-81340803 CTTAGAAACCCTATTGAACTTGG + Intergenic
1011076769 6:83446804-83446826 CTTAGAAACCCTACTGAACTTGG + Intergenic
1011189782 6:84716823-84716845 CTTAGAAACCCTATTGAACTTGG - Intronic
1011539865 6:88417742-88417764 CTTAGAAACCCTATTGAACTTGG - Intergenic
1013022235 6:106231758-106231780 CTTAGAAACCCTATTGAACTTGG + Intronic
1013165417 6:107586093-107586115 TTTAAAAGCCCTAGTGAAGTAGG - Intronic
1013543540 6:111134476-111134498 GTTAGAAACCCTACTGAACTTGG + Intronic
1013716770 6:112971271-112971293 TTTAAAAACCCTAATGAATCTGG + Intergenic
1015716623 6:136199364-136199386 CTTCAAAACCCTTATGAAATAGG - Intergenic
1015788040 6:136937981-136938003 CTTAAAAATCCTTCTGGACTGGG - Intergenic
1016343255 6:143084542-143084564 CTTAGAAATGCTACTGAACTTGG - Intronic
1016444721 6:144119905-144119927 CTTAGAAACCCTATTGAACTTGG - Intergenic
1018687515 6:166315567-166315589 TTAAGACACCCTATTGAACTTGG + Intergenic
1018761042 6:166894687-166894709 CTTAGAAACCCTATTGAACTTGG + Intronic
1019221247 6:170474645-170474667 CATAAAAACCCTAGAGGACTGGG + Intergenic
1019398017 7:833902-833924 TTTAAAAACTCTATTAAAATAGG - Intronic
1020730859 7:11878084-11878106 CTTAAAATCTTTGTTGAACTTGG + Intergenic
1023242204 7:38160567-38160589 CTTGAAAATCCCCTTGAACTTGG - Intergenic
1023439302 7:40169811-40169833 CTTAGAAACCCTATTGAACTTGG - Intronic
1025173837 7:56786140-56786162 CTTAAATTCCATATTAAACTAGG + Intergenic
1025698264 7:63792027-63792049 CTTAAATTCCATATTAAACTAGG - Intergenic
1025829995 7:65040277-65040299 CTTAAATTCCATATTAAACTAGG - Intergenic
1026003429 7:66581391-66581413 CATAAAAACCCAAGAGAACTGGG + Intergenic
1026027840 7:66761574-66761596 CATAAAAACCCAAGAGAACTGGG - Intronic
1028588590 7:92474215-92474237 CTTAGAAACCCTATTGAACTTGG - Intronic
1030337287 7:108340881-108340903 CTTAGAAACCCTATTGAACTTGG + Intronic
1030843495 7:114382665-114382687 CTTAGAAACCCTATTGAACTTGG - Intronic
1031264557 7:119567242-119567264 CTTAGAAACCCTATTGAACTTGG + Intergenic
1031471521 7:122174084-122174106 CTTAGAAACCCTACTGAATTTGG + Intergenic
1032426096 7:131823191-131823213 CTTAGAAACCCTATTGAACTTGG - Intergenic
1032725826 7:134589493-134589515 CTAAGAAACCCTATTGAACTTGG + Intergenic
1033073159 7:138223236-138223258 CTTAAATTCTCTTTTGAACTGGG - Intergenic
1033948176 7:146748444-146748466 CTTAAAAACCATATAGATTTGGG - Intronic
1034249183 7:149674837-149674859 CTTAGAAACCCTATTGAACTTGG + Intergenic
1037377663 8:18249520-18249542 CTTAAAAAGACTATTGCAATAGG - Intergenic
1037570992 8:20157730-20157752 CTTAGAAACCCTACTGAACTTGG + Intronic
1038238319 8:25783975-25783997 CTTAAGAATCCTATAGAAGTCGG + Intergenic
1039099595 8:33927135-33927157 CTTCAAAAGCTTATTGAAGTTGG + Intergenic
1039623022 8:39017886-39017908 AATAAAAACTCTATTGCACTGGG - Intronic
1040447726 8:47512398-47512420 CTTCAAAACACTTTTGGACTTGG - Intronic
1041663873 8:60423862-60423884 CTTAGAAACCCTAATGAACTTGG - Intergenic
1042056109 8:64766434-64766456 CTTAGAAACCCTAATGAACTTGG + Intronic
1042739108 8:72023407-72023429 GTTCAAACCCCTATTCAACTAGG - Intronic
1043097082 8:75988871-75988893 CTTTTAAGCCATATTGAACTAGG + Intergenic
1044552623 8:93529077-93529099 ATTAAAAAACCTATGGAAATGGG - Intergenic
1045517436 8:102872437-102872459 CATAAAAACCCAAGGGAACTGGG - Intronic
1047443883 8:124902515-124902537 CTTAGAAACCCTATTGAACTTGG - Intergenic
1047808082 8:128379739-128379761 CTTGGAAACTCTATTGAATTTGG - Intergenic
1047968552 8:130065380-130065402 ATTAAAAACCCTAGAGGACTGGG - Intronic
1051099248 9:13502358-13502380 CTATAAAACCCTATTTGACTTGG - Intergenic
1051583322 9:18700943-18700965 TTTAAAAACCCTATTTATTTAGG + Intronic
1052528995 9:29657181-29657203 CTTAGAAACCCTATTGAACTTGG - Intergenic
1052529612 9:29664758-29664780 GTTAAAAACCTCAATGAACTAGG + Intergenic
1052538517 9:29777601-29777623 CTTAGAAACCCTATTGAACTTGG - Intergenic
1053239436 9:36484776-36484798 CTCAAAAACCATATGGAACAGGG - Intronic
1053652425 9:40182543-40182565 CTTGAAAACCCTAATGAATGGGG - Intergenic
1053902825 9:42811851-42811873 CTTGAAAACCCTAATGAATGGGG - Intergenic
1054532156 9:66193678-66193700 CTTGAAAACCCTAATGAATGGGG + Intergenic
1055356259 9:75440244-75440266 AGTATAAACCCTATTTAACTGGG + Intergenic
1056704700 9:88941915-88941937 GTTAGAAACCCTATTGAACTTGG - Intergenic
1060674103 9:125496816-125496838 CTTAAAAGCCATCTTGTACTTGG + Intronic
1186254252 X:7701951-7701973 CTTAGAAACCCTATTGAACTTGG - Intergenic
1189561523 X:42195876-42195898 CTTAAAAAACCTTGTGAAGTAGG - Intergenic
1189916802 X:45863567-45863589 CTGAAAACCCCAAGTGAACTTGG + Intergenic
1192939976 X:75901851-75901873 CTTAGAAACCCTATTGAACTTGG - Intergenic
1193160341 X:78221474-78221496 GTTAAAAACTCAATTAAACTAGG - Intergenic
1194576892 X:95624267-95624289 CTTAAAAATGGTATTGATCTGGG + Intergenic
1194896331 X:99445696-99445718 CTTAAAAAGCATATAGAAATGGG + Intergenic
1195281626 X:103340074-103340096 GTTAAAAAGCCCAGTGAACTAGG + Intergenic
1195688099 X:107603352-107603374 CTTAAAAACCCTTATTAAGTAGG + Exonic
1196511121 X:116513791-116513813 CCTAAAAAACCTATTGAAATAGG - Intergenic
1197879012 X:131144957-131144979 TTTAAAATCAGTATTGAACTTGG + Intergenic
1200851593 Y:7889037-7889059 CTCAGAAACACTATTGAACTTGG - Intergenic
1201471865 Y:14343138-14343160 TTTAGAAACTCTATTGAATTTGG - Intergenic
1201992122 Y:20038750-20038772 GTTAAAAACTCTAATAAACTAGG + Intergenic