ID: 952925261

View in Genome Browser
Species Human (GRCh38)
Location 3:38315452-38315474
Sequence CCCAGCTGGCCAGCAGGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8621
Summary {0: 1, 1: 0, 2: 5, 3: 248, 4: 8367}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952925261_952925271 12 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925271 3:38315487-38315509 AAGGCTGTTCAGATGCCTTCTGG 0: 1
1: 0
2: 1
3: 8
4: 149
952925261_952925280 29 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925280 3:38315504-38315526 TTCTGGGAGGGGTCAAGGGAGGG 0: 1
1: 1
2: 2
3: 47
4: 417
952925261_952925273 16 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925273 3:38315491-38315513 CTGTTCAGATGCCTTCTGGGAGG 0: 1
1: 0
2: 0
3: 19
4: 186
952925261_952925279 28 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925279 3:38315503-38315525 CTTCTGGGAGGGGTCAAGGGAGG 0: 1
1: 0
2: 3
3: 34
4: 370
952925261_952925270 -7 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925270 3:38315468-38315490 AGCTGGGCAGGTGGTGGGGAAGG 0: 1
1: 1
2: 17
3: 167
4: 1369
952925261_952925277 25 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925277 3:38315500-38315522 TGCCTTCTGGGAGGGGTCAAGGG 0: 1
1: 0
2: 0
3: 21
4: 284
952925261_952925274 17 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925274 3:38315492-38315514 TGTTCAGATGCCTTCTGGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 205
952925261_952925272 13 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925272 3:38315488-38315510 AGGCTGTTCAGATGCCTTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 194
952925261_952925275 18 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925275 3:38315493-38315515 GTTCAGATGCCTTCTGGGAGGGG 0: 1
1: 0
2: 2
3: 13
4: 178
952925261_952925276 24 Left 952925261 3:38315452-38315474 CCTGAGCCTGCTGGCCAGCTGGG 0: 1
1: 0
2: 5
3: 248
4: 8367
Right 952925276 3:38315499-38315521 ATGCCTTCTGGGAGGGGTCAAGG 0: 1
1: 0
2: 1
3: 27
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952925261 Original CRISPR CCCAGCTGGCCAGCAGGCTC AGG (reversed) Intronic
Too many off-targets to display for this crispr