ID: 952928044 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:38336254-38336276 |
| Sequence | AATACACTCCGTAATTCAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 952928044_952928049 | 18 | Left | 952928044 | 3:38336254-38336276 | CCTCCTGAATTACGGAGTGTATT | No data | ||
| Right | 952928049 | 3:38336295-38336317 | TTTGAAAAGTACCACCAACTAGG | No data | ||||
| 952928044_952928050 | 21 | Left | 952928044 | 3:38336254-38336276 | CCTCCTGAATTACGGAGTGTATT | No data | ||
| Right | 952928050 | 3:38336298-38336320 | GAAAAGTACCACCAACTAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 952928044 | Original CRISPR | AATACACTCCGTAATTCAGG AGG (reversed) | Intergenic | ||