ID: 952928044

View in Genome Browser
Species Human (GRCh38)
Location 3:38336254-38336276
Sequence AATACACTCCGTAATTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952928044_952928049 18 Left 952928044 3:38336254-38336276 CCTCCTGAATTACGGAGTGTATT No data
Right 952928049 3:38336295-38336317 TTTGAAAAGTACCACCAACTAGG No data
952928044_952928050 21 Left 952928044 3:38336254-38336276 CCTCCTGAATTACGGAGTGTATT No data
Right 952928050 3:38336298-38336320 GAAAAGTACCACCAACTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952928044 Original CRISPR AATACACTCCGTAATTCAGG AGG (reversed) Intergenic