ID: 952928045

View in Genome Browser
Species Human (GRCh38)
Location 3:38336257-38336279
Sequence ATTAATACACTCCGTAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952928045_952928049 15 Left 952928045 3:38336257-38336279 CCTGAATTACGGAGTGTATTAAT No data
Right 952928049 3:38336295-38336317 TTTGAAAAGTACCACCAACTAGG No data
952928045_952928050 18 Left 952928045 3:38336257-38336279 CCTGAATTACGGAGTGTATTAAT No data
Right 952928050 3:38336298-38336320 GAAAAGTACCACCAACTAGGTGG No data
952928045_952928052 28 Left 952928045 3:38336257-38336279 CCTGAATTACGGAGTGTATTAAT No data
Right 952928052 3:38336308-38336330 ACCAACTAGGTGGTTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952928045 Original CRISPR ATTAATACACTCCGTAATTC AGG (reversed) Intergenic
No off target data available for this crispr