ID: 952928047

View in Genome Browser
Species Human (GRCh38)
Location 3:38336282-38336304
Sequence ACTTTTCAAATGGAAGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952928047_952928050 -7 Left 952928047 3:38336282-38336304 CCTAGGTCTTCCATTTGAAAAGT No data
Right 952928050 3:38336298-38336320 GAAAAGTACCACCAACTAGGTGG No data
952928047_952928049 -10 Left 952928047 3:38336282-38336304 CCTAGGTCTTCCATTTGAAAAGT No data
Right 952928049 3:38336295-38336317 TTTGAAAAGTACCACCAACTAGG No data
952928047_952928054 27 Left 952928047 3:38336282-38336304 CCTAGGTCTTCCATTTGAAAAGT No data
Right 952928054 3:38336332-38336354 AGTTGATTCTCTCATAGTTCTGG No data
952928047_952928055 30 Left 952928047 3:38336282-38336304 CCTAGGTCTTCCATTTGAAAAGT No data
Right 952928055 3:38336335-38336357 TGATTCTCTCATAGTTCTGGAGG No data
952928047_952928052 3 Left 952928047 3:38336282-38336304 CCTAGGTCTTCCATTTGAAAAGT No data
Right 952928052 3:38336308-38336330 ACCAACTAGGTGGTTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952928047 Original CRISPR ACTTTTCAAATGGAAGACCT AGG (reversed) Intergenic
No off target data available for this crispr