ID: 952928050

View in Genome Browser
Species Human (GRCh38)
Location 3:38336298-38336320
Sequence GAAAAGTACCACCAACTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952928045_952928050 18 Left 952928045 3:38336257-38336279 CCTGAATTACGGAGTGTATTAAT No data
Right 952928050 3:38336298-38336320 GAAAAGTACCACCAACTAGGTGG No data
952928044_952928050 21 Left 952928044 3:38336254-38336276 CCTCCTGAATTACGGAGTGTATT No data
Right 952928050 3:38336298-38336320 GAAAAGTACCACCAACTAGGTGG No data
952928047_952928050 -7 Left 952928047 3:38336282-38336304 CCTAGGTCTTCCATTTGAAAAGT No data
Right 952928050 3:38336298-38336320 GAAAAGTACCACCAACTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952928050 Original CRISPR GAAAAGTACCACCAACTAGG TGG Intergenic
No off target data available for this crispr