ID: 952928052

View in Genome Browser
Species Human (GRCh38)
Location 3:38336308-38336330
Sequence ACCAACTAGGTGGTTTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952928048_952928052 -7 Left 952928048 3:38336292-38336314 CCATTTGAAAAGTACCACCAACT No data
Right 952928052 3:38336308-38336330 ACCAACTAGGTGGTTTAAAAAGG No data
952928045_952928052 28 Left 952928045 3:38336257-38336279 CCTGAATTACGGAGTGTATTAAT No data
Right 952928052 3:38336308-38336330 ACCAACTAGGTGGTTTAAAAAGG No data
952928047_952928052 3 Left 952928047 3:38336282-38336304 CCTAGGTCTTCCATTTGAAAAGT No data
Right 952928052 3:38336308-38336330 ACCAACTAGGTGGTTTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952928052 Original CRISPR ACCAACTAGGTGGTTTAAAA AGG Intergenic
No off target data available for this crispr