ID: 952928055

View in Genome Browser
Species Human (GRCh38)
Location 3:38336335-38336357
Sequence TGATTCTCTCATAGTTCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952928053_952928055 3 Left 952928053 3:38336309-38336331 CCAACTAGGTGGTTTAAAAAGGA No data
Right 952928055 3:38336335-38336357 TGATTCTCTCATAGTTCTGGAGG No data
952928048_952928055 20 Left 952928048 3:38336292-38336314 CCATTTGAAAAGTACCACCAACT No data
Right 952928055 3:38336335-38336357 TGATTCTCTCATAGTTCTGGAGG No data
952928051_952928055 6 Left 952928051 3:38336306-38336328 CCACCAACTAGGTGGTTTAAAAA No data
Right 952928055 3:38336335-38336357 TGATTCTCTCATAGTTCTGGAGG No data
952928047_952928055 30 Left 952928047 3:38336282-38336304 CCTAGGTCTTCCATTTGAAAAGT No data
Right 952928055 3:38336335-38336357 TGATTCTCTCATAGTTCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952928055 Original CRISPR TGATTCTCTCATAGTTCTGG AGG Intergenic
No off target data available for this crispr