ID: 952929181

View in Genome Browser
Species Human (GRCh38)
Location 3:38346620-38346642
Sequence CCTTCGAAGCGCACCCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952929181_952929185 -7 Left 952929181 3:38346620-38346642 CCAGAGGGGGTGCGCTTCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 952929185 3:38346636-38346658 TCGAAGGAAAGCGGGCTGCGTGG 0: 1
1: 0
2: 0
3: 3
4: 60
952929181_952929192 26 Left 952929181 3:38346620-38346642 CCAGAGGGGGTGCGCTTCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 952929192 3:38346669-38346691 GATTGCACAGGACGCGGTCCCGG 0: 1
1: 0
2: 0
3: 3
4: 38
952929181_952929189 14 Left 952929181 3:38346620-38346642 CCAGAGGGGGTGCGCTTCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 952929189 3:38346657-38346679 GGGGGCACCGTCGATTGCACAGG 0: 1
1: 0
2: 0
3: 1
4: 36
952929181_952929188 -4 Left 952929181 3:38346620-38346642 CCAGAGGGGGTGCGCTTCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 952929188 3:38346639-38346661 AAGGAAAGCGGGCTGCGTGGGGG 0: 1
1: 0
2: 1
3: 16
4: 177
952929181_952929187 -5 Left 952929181 3:38346620-38346642 CCAGAGGGGGTGCGCTTCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 952929187 3:38346638-38346660 GAAGGAAAGCGGGCTGCGTGGGG 0: 1
1: 0
2: 1
3: 23
4: 301
952929181_952929190 20 Left 952929181 3:38346620-38346642 CCAGAGGGGGTGCGCTTCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 952929190 3:38346663-38346685 ACCGTCGATTGCACAGGACGCGG 0: 1
1: 0
2: 0
3: 0
4: 9
952929181_952929186 -6 Left 952929181 3:38346620-38346642 CCAGAGGGGGTGCGCTTCGAAGG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 952929186 3:38346637-38346659 CGAAGGAAAGCGGGCTGCGTGGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952929181 Original CRISPR CCTTCGAAGCGCACCCCCTC TGG (reversed) Intergenic
900405928 1:2492992-2493014 CCTTCCCTGAGCACCCCCTCGGG + Intronic
905393661 1:37653537-37653559 CCTTTGAAGCACAGCCCCTCGGG - Intergenic
920670433 1:208000062-208000084 CCTTCTTAGCCCACCCTCTCTGG + Intergenic
920991645 1:210945542-210945564 CCTTCCAAGGGCTTCCCCTCAGG + Intronic
1072465294 10:95656956-95656978 CCTTCGAAACGCCGCCCCACTGG + Intergenic
1078635569 11:13046613-13046635 CCTTCTAAGCAGACCCCCACTGG + Intergenic
1078679712 11:13463862-13463884 CCTTCGAAGCTTACACCCCCGGG + Intergenic
1088540035 11:110903934-110903956 CCTTAGAAGGGGACCCCCTCTGG - Intergenic
1107038714 13:35926882-35926904 CCTTGGAAGAGCACCAGCTCTGG - Intronic
1108602980 13:52011182-52011204 CCTTCCCTGCGCACCCCCTGGGG + Intronic
1115021698 14:28688673-28688695 CCTACAAAGCGAACCCCATCCGG - Intergenic
1115503789 14:34074484-34074506 CCTTCCCAGCGCATCCCATCAGG - Intronic
1118304932 14:64647928-64647950 CCTTCCAAAGGCACCCACTCTGG - Intergenic
1121224191 14:92309367-92309389 CCCTGGAAGCCCGCCCCCTCGGG + Intergenic
1128162647 15:65434424-65434446 CTTTGGAAGCTCACCACCTCGGG + Intergenic
1132244994 15:100287649-100287671 CCTACGAAGGGAACCCCATCAGG + Intronic
1151607389 17:75147154-75147176 ACTTCGCAGCACACCCCCTGGGG + Intronic
1152028447 17:77826771-77826793 CATTAGAAGGGCACTCCCTCAGG + Intergenic
1152901236 17:82942239-82942261 CCTCGGAAGGGCACCCCATCTGG - Intronic
1153666503 18:7371449-7371471 CCTCCTAAGTGCACCCCATCTGG - Intergenic
1159587046 18:70290879-70290901 CCACCCAAGCGCACACCCTCGGG + Intronic
927848345 2:26483613-26483635 CGTTCGGGGGGCACCCCCTCGGG + Exonic
932448469 2:71794870-71794892 CCTTCAGAGGGGACCCCCTCCGG + Intergenic
935873785 2:107484143-107484165 CCTTCAAAGCACACCACCTGGGG - Intergenic
948995046 2:241573783-241573805 CCTGGGAAGCCCAGCCCCTCAGG + Exonic
1179899101 21:44379696-44379718 CCTTCACAACGGACCCCCTCTGG - Intronic
1181648717 22:24247391-24247413 CCTTCCAAACCCACTCCCTCTGG + Intergenic
952929181 3:38346620-38346642 CCTTCGAAGCGCACCCCCTCTGG - Intergenic
962001541 3:131303727-131303749 CCTACGAAGGGAACCCCATCAGG - Intronic
972142928 4:35983673-35983695 CCTTCCAAGAGAACCCCATCAGG + Intronic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
991244178 5:64491263-64491285 CCTACAAAGGGCACCCCATCAGG + Intergenic
998428024 5:142046441-142046463 CATTCCAAGGGCAACCCCTCAGG - Intergenic
1002123363 5:177022829-177022851 CGGTCAAAGCGCACCCCGTCCGG - Exonic
1002422378 5:179155366-179155388 CCCTCCAAGCCCACCTCCTCTGG + Intronic
1023652788 7:42388963-42388985 TCTTCGAATCCCATCCCCTCAGG - Intergenic
1049373469 8:142278480-142278502 CCTTCGAAGCAGAGCCCCGCTGG - Intronic
1049693240 8:143971882-143971904 CCTCCCAAGCGCAGCTCCTCTGG - Intronic
1052551220 9:29951561-29951583 CCTACGAAGGGAACCCCATCAGG - Intergenic