ID: 952929194

View in Genome Browser
Species Human (GRCh38)
Location 3:38346687-38346709
Sequence CCCGGCTCGCGTAGCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952929191_952929194 0 Left 952929191 3:38346664-38346686 CCGTCGATTGCACAGGACGCGGT 0: 1
1: 0
2: 0
3: 1
4: 10
Right 952929194 3:38346687-38346709 CCCGGCTCGCGTAGCCCCGCAGG 0: 1
1: 0
2: 1
3: 2
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952929194 Original CRISPR CCCGGCTCGCGTAGCCCCGC AGG Intergenic
900088021 1:907915-907937 CCCTGCTCGCCAAGCCCCCCGGG + Intergenic
900540579 1:3200704-3200726 CCCGGCACGCGTGGCCCTCCTGG + Intronic
901019671 1:6249432-6249454 CCCGCCGCGCGCAGCCCCCCGGG + Exonic
901279946 1:8026206-8026228 CCCGGCTGGCTCAGCGCCGCGGG + Exonic
901556126 1:10032815-10032837 CCCGTCCCGCGCAGCCGCGCCGG - Intronic
918064421 1:181089612-181089634 CCCCGCTCAAGAAGCCCCGCCGG + Exonic
921923229 1:220690758-220690780 CCCGGCTCCCGCTCCCCCGCGGG - Intronic
923479764 1:234373311-234373333 CTCGGCTCGCCTTGTCCCGCGGG + Intergenic
1063407934 10:5813891-5813913 CCCGGCAAGCCCAGCCCCGCGGG - Intronic
1067336754 10:45373354-45373376 CCCGCCTCTCCCAGCCCCGCCGG - Intergenic
1075683653 10:124349478-124349500 CCCGGCTCGCACAGCCAGGCTGG + Intergenic
1077419899 11:2445167-2445189 CCAGGCCCGCGCTGCCCCGCCGG - Exonic
1078570277 11:12452056-12452078 CCCTGCTGGAGTAGCCCTGCAGG - Intronic
1095981554 12:47977354-47977376 CCTGGCTCCCCTGGCCCCGCTGG - Exonic
1102506051 12:113385129-113385151 CCCTGCTCGGGGAGCCCCGATGG - Intronic
1102973503 12:117190037-117190059 TCCGCCTGGCGTGGCCCCGCAGG + Intronic
1119779865 14:77270598-77270620 CCCGGCCCGGTGAGCCCCGCTGG + Intronic
1122027775 14:98889970-98889992 CCTGGCCCGGGTAGCCCCGGAGG + Intergenic
1130656391 15:85794629-85794651 CCCGGGACACGTAGTCCCGCGGG + Intronic
1133006026 16:2882448-2882470 CGCGGCTCTCCCAGCCCCGCGGG - Intergenic
1138660878 16:58516153-58516175 CCCGGCCCGCGAGGCCGCGCCGG + Intronic
1144665096 17:17096986-17097008 CCCGGCTATCGTAGCCAGGCTGG + Intronic
1145765592 17:27456524-27456546 CCCGGCTCGGGCAGCGCCGAGGG + Intergenic
1145989433 17:29070046-29070068 CCCGGATCTCGAAGCCCCACTGG + Intergenic
1146057716 17:29589487-29589509 CCGGGCGCGCGGAGCCTCGCCGG - Exonic
1148048660 17:44758908-44758930 CCCGGCCCCCCCAGCCCCGCAGG - Intergenic
1151983818 17:77529270-77529292 CCTGGCTGGCGTGGCCCGGCAGG + Intergenic
1154125491 18:11689246-11689268 CCGGGCTCGCGGAGGCCCGTCGG + Exonic
1157386582 18:47263478-47263500 CCCGGCCCGCGCTGCCCTGCAGG - Intergenic
1158938362 18:62384966-62384988 TCCGGCTCCCGCAGCCCCTCGGG - Exonic
1160725556 19:616489-616511 CCCGGCCCGCCTGGGCCCGCGGG - Exonic
1160899174 19:1418552-1418574 CCCGGCCCGCCCCGCCCCGCCGG - Intronic
1162909823 19:13842775-13842797 CCCGGCTCCCCTCCCCCCGCGGG - Intergenic
1163204752 19:15794459-15794481 CCCGGCAGGTGCAGCCCCGCAGG - Exonic
1163206551 19:15807605-15807627 CCAGGCAGGCGCAGCCCCGCGGG + Exonic
1163549160 19:17955816-17955838 CCCGGCTCTCGTGGTCTCGCTGG + Intronic
1167366594 19:49057842-49057864 CCAGGCTCCCGGAGCTCCGCTGG + Exonic
931665879 2:64609345-64609367 ACCGGCTCGCGTGGCTCCGGGGG - Intergenic
938073922 2:128322218-128322240 TCCGGCTCGCGCGGACCCGCGGG + Intergenic
938271923 2:129979957-129979979 CCCGGCTGGAGGAGCCCGGCTGG - Exonic
947596041 2:231412372-231412394 CACGCCTCGCGCAGCTCCGCGGG - Intergenic
948140575 2:235669857-235669879 GCCGCCTCGCTTGGCCCCGCCGG + Intronic
948560671 2:238849150-238849172 CCCGGCTCGGGCAGCTTCGCGGG - Intronic
948665136 2:239529830-239529852 CCTGGCTCTCCTAGCCCCACCGG + Intergenic
1172644454 20:36461313-36461335 CCCGGCGCGCGCAGCCGGGCTGG - Intronic
1175971655 20:62689564-62689586 CCCGGCTCGCTGGGCCCTGCTGG - Intergenic
1178981466 21:37268096-37268118 CGCGGCCCGCGGAGCCCGGCTGG - Intergenic
1185255192 22:49827738-49827760 CCCGGCTCGGGGGGCCCGGCCGG + Intergenic
952929194 3:38346687-38346709 CCCGGCTCGCGTAGCCCCGCAGG + Intergenic
955768838 3:62370603-62370625 CCCGGCCCGCGGAGCGCGGCGGG - Intronic
956129227 3:66038691-66038713 CCCGGCTCGCCTCTCCTCGCTGG + Intronic
969439508 4:7208890-7208912 CCTGGCTCACCTAGCCCTGCTGG + Intronic
975118634 4:70705382-70705404 CCCGGCTCGGGTCACCCCGCGGG - Intronic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
983229099 4:165112360-165112382 CCCGGCTCCCGGAGACTCGCGGG + Intronic
985129726 4:186727004-186727026 CCCGGCTCGCGGAGCCCCTCCGG + Intergenic
985654385 5:1122258-1122280 CCCGCCTCGCACAGCCCTGCCGG - Intergenic
987099954 5:14582341-14582363 CCCGGGGCGCGTGGACCCGCGGG + Intronic
997361270 5:133296615-133296637 CCTGGCTCACATAGCCCCTCTGG + Intronic
999727132 5:154446353-154446375 CGCGGCTCGCAGGGCCCCGCCGG - Exonic
1005905570 6:30259752-30259774 CCCGGCCCGGGGAGCCGCGCCGG + Intergenic
1010244988 6:73654163-73654185 CCCGGCATGCGTAGACCGGCGGG - Intergenic
1015965573 6:138693027-138693049 CGCGGCCCGCGAAGCCCTGCGGG - Intergenic
1020418079 7:7969001-7969023 CCCGGATCACGCAGCCCCGAGGG - Exonic
1023015669 7:35967574-35967596 CCCGGCTAGGGTTGCCCCACAGG - Intergenic
1025819393 7:64947901-64947923 CTCGGCTCGGGGAGCCCGGCAGG - Intergenic
1029849313 7:103446010-103446032 CCCTGCTCGGGTGGGCCCGCGGG + Intronic
1035126005 7:156607963-156607985 CGGGGCTCGCGTGGCCTCGCAGG - Intergenic
1049710366 8:144060521-144060543 CCCGCCTCGGGTCGCCCCGTCGG - Intronic
1187173002 X:16870006-16870028 CCCGGCGCGCGCCGCCCCGCAGG + Intronic
1197198904 X:123732346-123732368 CCGGCCTCGCGTAGCGCCGTGGG - Intronic
1197980929 X:132217705-132217727 TCCTGCTCGCGCAGCCCAGCCGG + Exonic