ID: 952929786

View in Genome Browser
Species Human (GRCh38)
Location 3:38350150-38350172
Sequence AGGTGCACAAAGGGTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952929786_952929794 28 Left 952929786 3:38350150-38350172 CCCAGCTGACCCTTTGTGCACCT 0: 1
1: 0
2: 0
3: 17
4: 129
Right 952929794 3:38350201-38350223 CTCTTTGCCCCCAGCTAATGCGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952929786 Original CRISPR AGGTGCACAAAGGGTCAGCT GGG (reversed) Intronic
900373143 1:2341167-2341189 AGATCCACAAAGGGGAAGCTGGG - Intronic
901739526 1:11333211-11333233 AGGGGCAGAAAGGGTCAGTGTGG - Intergenic
902042596 1:13503634-13503656 AGATGCCCCCAGGGTCAGCTGGG - Intronic
904977847 1:34472291-34472313 ACAAGCACAAAGGCTCAGCTTGG + Intergenic
912679935 1:111722583-111722605 AGGTGGAGAAAGGCTGAGCTTGG - Exonic
920831106 1:209466588-209466610 ACGTGCACTGTGGGTCAGCTAGG + Intergenic
922354488 1:224763205-224763227 AGGTGCACAGTGGATCATCTGGG + Intergenic
1066669074 10:37817794-37817816 TGTAGCACAAAGGCTCAGCTGGG - Intronic
1068574247 10:58666207-58666229 AGGTGCAGAAAGAGTGAGATTGG + Intronic
1070495738 10:77020317-77020339 AGGTGAACAAAGGTTCACCTGGG - Intronic
1070723615 10:78773353-78773375 ACGTGCACAAAGGTTCTGCGGGG - Intergenic
1072208070 10:93221832-93221854 AAGTGCACAAAGGCTCTGCTTGG + Intergenic
1073221103 10:101874854-101874876 AGGCTTACAAAGGGTCAGGTGGG + Intronic
1073944110 10:108730424-108730446 AGGGACAGACAGGGTCAGCTAGG + Intergenic
1073960901 10:108926432-108926454 AGGTGAACTAAGAGTTAGCTGGG - Intergenic
1076520327 10:131077126-131077148 AGGTGCCCACAGGGTGAGCAAGG + Intergenic
1084776357 11:71379406-71379428 AGGTGGTAAAAGGGTCAGCTGGG - Intergenic
1087648029 11:100830793-100830815 AGGTGAACAATTTGTCAGCTCGG + Intronic
1088299045 11:108335733-108335755 AGGTGCACAGATGCTCAGATTGG + Intronic
1093215993 12:16361643-16361665 AGGTGCTCACAGGGAAAGCTGGG + Intronic
1094837476 12:34328915-34328937 AGCTCCACAAAGGGGCTGCTGGG + Intergenic
1096189819 12:49609178-49609200 AGATGCAACCAGGGTCAGCTTGG + Intronic
1099256135 12:80315110-80315132 AAGGGCACAAAGTTTCAGCTAGG + Intronic
1099343415 12:81467907-81467929 AGGAGCCCAAAGGGTGAGGTGGG - Intronic
1103037425 12:117667701-117667723 AGGTGCACAAAGTTACAGCAGGG + Intronic
1103217672 12:119214952-119214974 AGGTGCCCAAAGGGTCAAAATGG + Intronic
1103344040 12:120237653-120237675 AGGGTCACTGAGGGTCAGCTCGG - Intronic
1104252251 12:127106347-127106369 AGGTGCACAAGTGGTGAGCCTGG - Intergenic
1104606379 12:130192621-130192643 AGGTTCTCAAAGGGTGAGCTGGG - Intergenic
1106575772 13:30973392-30973414 AGGTGCATGAAGGGTCTTCTGGG + Intronic
1107438786 13:40405137-40405159 AAGTGCAGAAAGCCTCAGCTGGG - Intergenic
1110471175 13:75861831-75861853 AGGTGCAGAGCTGGTCAGCTGGG + Intergenic
1111893820 13:94116399-94116421 AGGTGCACAAAGGGTTGGAAGGG + Intronic
1113452988 13:110425366-110425388 AGCTGCACAAATGCTCAGCAGGG - Intronic
1119422112 14:74513468-74513490 ATGTCCATCAAGGGTCAGCTGGG - Intronic
1120093086 14:80356569-80356591 AGGTGCACAAAGGGACTTTTGGG - Intronic
1120759596 14:88273733-88273755 AGGTGCACACAGCCACAGCTGGG + Intronic
1122855439 14:104557765-104557787 AGGTGGACTCAGGCTCAGCTGGG + Intronic
1124372527 15:29111694-29111716 AGGTGCACAGAGGGCCAAATGGG - Intronic
1126273545 15:46849114-46849136 AGGTGCTCATGGGGTCTGCTGGG + Intergenic
1128676400 15:69612243-69612265 AGGTGCTCAAAGGGCCACCTGGG - Intergenic
1130856879 15:87847508-87847530 AAGTGCACCTAGGGTCAGGTGGG + Intergenic
1132539775 16:503312-503334 TTGTGCACGAAGGGCCAGCTGGG + Intronic
1134442337 16:14306682-14306704 AAGGGCAGAAGGGGTCAGCTGGG - Intergenic
1134490695 16:14693734-14693756 AGGGGCAGAAAGGGCCGGCTTGG - Intronic
1134496076 16:14732852-14732874 AGGGGCAGAAAGGGCCGGCTTGG - Intronic
1135952568 16:26928859-26928881 ATGTGCACAAAGGCTTGGCTTGG - Intergenic
1138515131 16:57531736-57531758 AGGAGCACAGAAGGTGAGCTGGG - Intronic
1146580822 17:34037147-34037169 TGTAGCACAAAGGCTCAGCTGGG - Intronic
1148185100 17:45637267-45637289 AGGTGCAAAGAGGCTCAGATTGG + Intergenic
1150035311 17:61790071-61790093 AGGGGCACAAAGGAACATCTGGG - Intronic
1150122160 17:62613025-62613047 TGTAGCACAAAGGCTCAGCTGGG + Exonic
1150474208 17:65462066-65462088 ATGGGCACAAAGGATCAGTTTGG - Intergenic
1152576609 17:81143943-81143965 AGGTGCACCCAGGGTGAGCACGG + Intronic
1152895099 17:82906324-82906346 AGGTGCACAAGGAGGCAGCAGGG - Intronic
1156081615 18:33342540-33342562 TGCTGCTCAAAGTGTCAGCTTGG - Intronic
1158676442 18:59523758-59523780 TGGTTCACAAAGGGTGAGCCAGG + Intronic
1160312915 18:77812686-77812708 AGGTCCACAAAGGCACAGCATGG - Intergenic
1160523691 18:79523127-79523149 AGGTGCACAAAGGGCCAGGCAGG + Intronic
1160712196 19:557321-557343 AGGTCCACAAAGGCTGAGGTCGG + Intergenic
1167731110 19:51256541-51256563 AGGGGCACAAAGTTTCAGCTAGG + Intronic
925309979 2:2875359-2875381 AGGAGCACGCAGGGTCACCTGGG + Intergenic
925874319 2:8298936-8298958 AGTTGCACAAATGGTTTGCTTGG - Intergenic
929071945 2:38039702-38039724 AGGTGCACATGGGGTCAGAAGGG + Intronic
929933707 2:46277829-46277851 AGGTACACAAAGAGTGTGCTGGG + Intergenic
934520578 2:95017888-95017910 GGCTGCACACAGGGTCAGCGCGG - Intergenic
935950160 2:108321697-108321719 AGGTGCACATGTTGTCAGCTGGG - Intergenic
936239162 2:110772350-110772372 AGATGCACAGTGGGTCACCTGGG - Intronic
938279160 2:130052274-130052296 AGGTGAAGAAAGGGTCAGAGTGG - Intergenic
938289211 2:130140564-130140586 AGGTGCCCTAAGGGTCAGATGGG + Intronic
938467315 2:131532374-131532396 AGGTGCCCTAAGGGTCAGATGGG - Intronic
940856058 2:158729578-158729600 AGGAGCAGAAAGGGCCAGCGTGG + Intergenic
941612123 2:167675062-167675084 AGGTGCACAGGGGCTCATCTGGG - Intergenic
941881868 2:170489070-170489092 AGGTGCACACAGGAAGAGCTAGG + Intronic
942642018 2:178070993-178071015 AGTTGCACAAGTGGTAAGCTAGG - Intronic
946070773 2:217032632-217032654 AGCTGGACACAGGCTCAGCTTGG - Intergenic
1172613972 20:36271545-36271567 AGGTGCATGGAGGGTCAGCCTGG + Intergenic
1174298076 20:49562793-49562815 TGGTTCACAAAGGGTCAAGTGGG - Intronic
1175156623 20:56975983-56976005 AGGAGCATAGAGGGTCAGATGGG + Intergenic
1176073569 20:63238632-63238654 AGGCGCACAAGGAGTCAGCAGGG - Intronic
1177024583 21:15906337-15906359 TTGCGAACAAAGGGTCAGCTGGG + Intergenic
1177702893 21:24661491-24661513 AGGTGCACAAAAGTTCTACTAGG - Intergenic
1178492437 21:33061326-33061348 AGGTGCACAACAGGACACCTGGG - Intergenic
1179379856 21:40888388-40888410 ACCTGCACACAGGGTCAGCCTGG - Intergenic
1182758130 22:32697657-32697679 ATGTTCACTGAGGGTCAGCTGGG + Intronic
950646776 3:14382062-14382084 AGGTGGAGAAAGTGTCAGGTGGG + Intergenic
950852548 3:16076586-16076608 AGTGGCAATAAGGGTCAGCTGGG + Intergenic
952257741 3:31710087-31710109 AGATGCACAAAAGGAAAGCTTGG + Intronic
952900500 3:38108956-38108978 AGAACCACAAAGGGACAGCTAGG - Intronic
952929786 3:38350150-38350172 AGGTGCACAAAGGGTCAGCTGGG - Intronic
953703554 3:45214594-45214616 AAGTGCACAGTGGGGCAGCTAGG - Intergenic
954154638 3:48678719-48678741 AGATGCGCACAGGGTCATCTAGG + Exonic
954901980 3:54027609-54027631 AGGAAAACAAAGGGTCAGCAAGG + Intergenic
957227617 3:77470023-77470045 AAGAGAACAAAGGGACAGCTAGG + Intronic
957972232 3:87397036-87397058 AGATGCTAAAAGGGTAAGCTAGG + Intergenic
963281214 3:143386243-143386265 AGGTGAGCAAAGGGTGAGCCAGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968947790 4:3674760-3674782 AGGTCCACAACGGCTCAGCAGGG - Intergenic
969855254 4:9993992-9994014 AGGTGCTCAAAGGTATAGCTGGG - Intronic
970163870 4:13215815-13215837 ATGTCCACCATGGGTCAGCTCGG + Intergenic
974321435 4:60354911-60354933 TGTAGCACAAAGGCTCAGCTGGG - Intergenic
982482131 4:155924914-155924936 AGGTGCACAAAGAAGCAGTTCGG + Exonic
990207936 5:53450422-53450444 AGATCCACAAAGGTTTAGCTAGG - Intergenic
997786759 5:136720637-136720659 AGTTACACAAAGTGTCAGTTGGG - Intergenic
999561978 5:152813512-152813534 AGGTTCAGAAAGGGACAGATGGG - Intergenic
1006359759 6:33580600-33580622 AGATGAACAGAGGCTCAGCTGGG + Intergenic
1011422511 6:87188278-87188300 AGGTGTACAAATGGTCAGCGTGG + Intronic
1012221221 6:96651790-96651812 AAATGCACAAAGGGTCAGGATGG - Intergenic
1015704705 6:136075508-136075530 AGGTAGACAATGGGACAGCTAGG - Intronic
1018176187 6:161181324-161181346 TAGTGCACAAAGGGACTGCTTGG - Intronic
1020046486 7:5044785-5044807 AGGTACACATTGGGTCAGCCTGG - Intronic
1022516486 7:30978027-30978049 AGGTGCACAAAGGTGGAACTTGG - Intronic
1022744675 7:33158966-33158988 AGGTACAGAAACGGTCAGGTTGG + Intronic
1023085733 7:36568476-36568498 AGGTGCCCAATGGGTCAGAAAGG - Intronic
1024006548 7:45228608-45228630 AGGTGCAAAGAGGGGCAGCCAGG - Intergenic
1024483475 7:49889629-49889651 AGGAGCAAAAAGGGTCTGCATGG - Intronic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1028889432 7:95970467-95970489 ATCTGCACAAAGGGTGTGCTGGG + Intronic
1032246962 7:130221513-130221535 AGGTGCACAACTGGTCAGGTGGG + Intergenic
1032284720 7:130531543-130531565 AGGGGCACAAAGGGTGGGGTGGG + Intronic
1033281170 7:140007421-140007443 AGGAGACCAAAGGGCCAGCTTGG - Intronic
1036720403 8:11169247-11169269 ATGGACACAAAGGGTGAGCTTGG - Intronic
1038235221 8:25746391-25746413 ATGGGAACAAAGGGTCAGCCAGG + Intergenic
1041460667 8:58108399-58108421 AGGAGCACAAAGAGTCAGCCTGG + Intronic
1042766893 8:72331798-72331820 AGATGCACAAGTGGTCAGCAGGG + Intergenic
1045332748 8:101169877-101169899 AAGTGGAAAGAGGGTCAGCTGGG + Intergenic
1048854445 8:138674333-138674355 AGGTGAAGAAGGGGTCAGCGTGG - Intronic
1053392295 9:37744650-37744672 GGGTGCACCAAGGGCCAGGTAGG - Exonic
1057950636 9:99366526-99366548 AGATGCAGGGAGGGTCAGCTGGG + Intergenic
1059648770 9:116294588-116294610 AGGTTTACAAAGGGGAAGCTTGG - Intronic
1060860874 9:126953974-126953996 AGGGGAACAAAGGGACAGGTGGG - Intronic
1061401021 9:130368429-130368451 AGGTGCACGGTGGGTGAGCTGGG + Intronic
1062314366 9:135959029-135959051 AGGAGCACGGAGGGTCAGTTAGG - Intronic
1062518848 9:136949438-136949460 AGGTGCTCAGAGGGACAGGTGGG + Intronic
1185560819 X:1059281-1059303 AAGTGCACACAGAGTCACCTTGG - Intergenic
1185648410 X:1631385-1631407 AGGTGCTTAAGGGGTGAGCTCGG - Intronic
1187626738 X:21122734-21122756 AGGTTCACAAGGGGCCAGGTTGG + Intergenic
1192264728 X:69530511-69530533 AGGTGCACACAGTTGCAGCTAGG + Exonic
1198177023 X:134166672-134166694 AGGTGAACAAAGGCGGAGCTGGG + Intergenic
1199920843 X:152401783-152401805 AATTTCACAAAGGGTCTGCTTGG + Intronic
1200038174 X:153346562-153346584 ACGTCCCCAAAGGCTCAGCTGGG - Intronic
1200827121 Y:7657433-7657455 AGGGGCACACGGGGTCAGCCAGG + Intergenic
1201073844 Y:10172083-10172105 GGGTGCTCAATGGGACAGCTTGG - Intergenic
1202195269 Y:22294504-22294526 AGGGGCACAAGGGGTCAGCCAGG + Intergenic
1202232755 Y:22672352-22672374 AGGGGCACACAGGGTCAGCCAGG - Intergenic
1202310401 Y:23523806-23523828 AGGGGCACACAGGGTCAGCCAGG + Intergenic
1202560401 Y:26146788-26146810 AGGGGCACACAGGGTCAGCCAGG - Intergenic