ID: 952932423

View in Genome Browser
Species Human (GRCh38)
Location 3:38370640-38370662
Sequence CGGTTTCCTCATCTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9932
Summary {0: 1, 1: 11, 2: 216, 3: 2081, 4: 7623}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952932423 Original CRISPR CGGTTTCCTCATCTGGAACA AGG Intronic
Too many off-targets to display for this crispr