ID: 952934591

View in Genome Browser
Species Human (GRCh38)
Location 3:38386290-38386312
Sequence GGCAAACAGAAGTGGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952934591_952934598 23 Left 952934591 3:38386290-38386312 CCCTTGAGCCACTTCTGTTTGCC 0: 1
1: 0
2: 2
3: 14
4: 207
Right 952934598 3:38386336-38386358 GAAGAAGAAAAAAGAAAGGTAGG 0: 1
1: 4
2: 68
3: 601
4: 5688
952934591_952934596 1 Left 952934591 3:38386290-38386312 CCCTTGAGCCACTTCTGTTTGCC 0: 1
1: 0
2: 2
3: 14
4: 207
Right 952934596 3:38386314-38386336 ATTTAATGGCTTTTTAGAGAAGG 0: 1
1: 0
2: 3
3: 72
4: 905
952934591_952934599 27 Left 952934591 3:38386290-38386312 CCCTTGAGCCACTTCTGTTTGCC 0: 1
1: 0
2: 2
3: 14
4: 207
Right 952934599 3:38386340-38386362 AAGAAAAAAGAAAGGTAGGAAGG 0: 2
1: 46
2: 506
3: 4143
4: 19792
952934591_952934597 19 Left 952934591 3:38386290-38386312 CCCTTGAGCCACTTCTGTTTGCC 0: 1
1: 0
2: 2
3: 14
4: 207
Right 952934597 3:38386332-38386354 GAAGGAAGAAGAAAAAAGAAAGG 0: 2
1: 17
2: 142
3: 1194
4: 7080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952934591 Original CRISPR GGCAAACAGAAGTGGCTCAA GGG (reversed) Intronic
900191074 1:1352501-1352523 GCCACACAGAACTAGCTCAAAGG + Intergenic
900616676 1:3568621-3568643 GGGCAACAGAGGTGGCTCGAAGG - Intronic
902704177 1:18193070-18193092 GGGAAAGAGAAGTGGCCCACAGG + Intronic
903014423 1:20352709-20352731 GGGAAACAGAGGATGCTCAAAGG + Intronic
903161073 1:21489532-21489554 GGCACACAGTAGGCGCTCAATGG + Intergenic
903315018 1:22496544-22496566 TGCACACAGAAGGCGCTCAAAGG - Intronic
905254442 1:36671126-36671148 GGCAAACAGACTTGACGCAAGGG - Intergenic
906979013 1:50608236-50608258 GGTAAACAGACATGGCACAATGG + Intronic
907713944 1:56910527-56910549 GTCAAAGAGAAATTGCTCAATGG + Intronic
908149122 1:61281553-61281575 GGAAAACAGACGTGGCACCATGG - Intronic
910884483 1:91950617-91950639 GGTAAAGAGAAGTTTCTCAAAGG + Intronic
911039022 1:93577911-93577933 GGCAAGCAGGCGTGGCTCCAGGG - Intronic
916397974 1:164412730-164412752 GGCAAAGAGAACTGCCTCAGTGG + Intergenic
918100569 1:181369677-181369699 GGCATACAGAAGGGACTCATTGG - Intergenic
918343324 1:183585104-183585126 GGCAACCACAAGATGCTCAAAGG - Intronic
920703689 1:208236399-208236421 GGCAGACAGAAGTGGCAAGAGGG - Intronic
922224252 1:223631566-223631588 GACACACAGAAGCAGCTCAACGG + Intronic
922238644 1:223740227-223740249 TTCAAACAGAGGTGACTCAATGG - Intronic
923215365 1:231843798-231843820 TGCAAACTCAACTGGCTCAAAGG - Intronic
924069527 1:240262019-240262041 GACAAACAGCACTGGCTGAAGGG - Intronic
1065001884 10:21344850-21344872 GGCAAACAGAATAAGCTTAATGG + Intergenic
1066209637 10:33224233-33224255 GGCACACAGAAGGGCTTCAAGGG - Intronic
1066492136 10:35903994-35904016 AGCAAACAGAACTGACTAAAAGG - Intergenic
1067138637 10:43634895-43634917 GGCAAACAGATGGGGCACAGTGG - Intergenic
1069889349 10:71643588-71643610 GGGACCCAGAAGAGGCTCAACGG - Intronic
1073658485 10:105445401-105445423 GGTAAACAGAAGTGACTATAGGG + Intergenic
1075313948 10:121437413-121437435 GGCAAACAGACGAGGCTCTTTGG - Intergenic
1075617211 10:123899320-123899342 GGAATACAGAAATGGTTCAATGG + Intronic
1075716883 10:124560975-124560997 AACAAACAGAAGAGGCTGAAAGG + Intronic
1075953666 10:126504357-126504379 GGCAATTTGAGGTGGCTCAATGG + Exonic
1076521446 10:131083927-131083949 GGGGAAGAGAACTGGCTCAACGG + Intergenic
1079570061 11:21931976-21931998 CGCAAACAGAAGTGAGTTAAGGG - Intergenic
1079575924 11:22002971-22002993 GGCACATAGTAGTTGCTCAAAGG - Intergenic
1080961654 11:37167994-37168016 GGCCAATGGAAGTGGCTCTATGG - Intergenic
1081669740 11:44936402-44936424 TTCAAACAGAAGTGGCTCTGGGG + Intronic
1081742230 11:45448734-45448756 GGCAAACAGAGGGGCCTTAAAGG - Intergenic
1083330449 11:61895865-61895887 GGCACACAGAAGTGCCACAGAGG - Intergenic
1086281774 11:85198106-85198128 GAAAAAAAAAAGTGGCTCAAAGG + Intronic
1089097952 11:115935392-115935414 TGCAGACAGAGGTGGATCAAAGG - Intergenic
1089227981 11:116942861-116942883 AGCCAACAGAAGTAGCTCAGTGG + Intronic
1091340943 11:134813059-134813081 GGCATAAAGAAGAGGCTAAAGGG - Intergenic
1091535463 12:1404363-1404385 TGCAAACAGTAGTTGTTCAAAGG - Intronic
1093857625 12:24125524-24125546 GGAAAACAGAAGGGGCAAAATGG - Intergenic
1095968086 12:47882892-47882914 TGCAAACAGAAGTGGCTTGTTGG + Intronic
1096510746 12:52126649-52126671 GGCAAACAAAAGTGGGTGGAGGG + Intergenic
1098013140 12:66075814-66075836 GGAAAACAGAAGTCACTCTATGG + Intergenic
1099322717 12:81170920-81170942 AGTAAATAAAAGTGGCTCAATGG - Intronic
1101428744 12:104608931-104608953 TCAAGACAGAAGTGGCTCAAGGG - Intronic
1102660535 12:114523651-114523673 GGGAAACAGAAGTGGTTCTGGGG + Intergenic
1103965089 12:124633545-124633567 GGCAACCACAAGAGGCTCTAGGG - Intergenic
1104825129 12:131702409-131702431 GGGAAACAGCAGTGGCTGAGCGG + Intergenic
1105844576 13:24283006-24283028 GGCACACAGAAGGGTCTCACAGG - Intronic
1107993884 13:45842037-45842059 GTCTAACAAATGTGGCTCAAGGG - Intronic
1111285846 13:86090878-86090900 GGAAAAAAGAAGTGGCCCACAGG - Intergenic
1114775667 14:25478076-25478098 GGCAAACACAACTTACTCAAAGG - Intergenic
1115529123 14:34310593-34310615 GCTTATCAGAAGTGGCTCAAAGG + Intronic
1116584805 14:46689316-46689338 GGCAAAAAGAAATGTCTCTAGGG + Intergenic
1116677203 14:47920810-47920832 GGGAAACAGAAGTGAAGCAAAGG + Intergenic
1117719570 14:58616184-58616206 GGCAAACAATAGTGCCTCATTGG - Intergenic
1118777669 14:68983492-68983514 GGGAAAAAGAAGTAGCTAAAGGG + Intergenic
1119062583 14:71491338-71491360 GACACATAGAAGGGGCTCAAGGG - Intronic
1120053427 14:79895181-79895203 TGCAAACAGAAGTTACTCAGGGG - Intergenic
1121732766 14:96197908-96197930 GGCCACCAGAGGTGGCACAAGGG - Intergenic
1124153099 15:27199911-27199933 GGGAAAGAGAAATGGCTGAAGGG - Intronic
1125429971 15:39583811-39583833 GGCATACAGAAGTGACTCCAAGG + Intronic
1126521197 15:49596090-49596112 TGCAAACAGAGGAAGCTCAATGG + Intronic
1130456785 15:84118678-84118700 GGCACACAGTAGTTGTTCAATGG + Intergenic
1131059228 15:89394335-89394357 AGCAAACAGAAGTAGAACAAAGG - Intergenic
1132326088 15:100971747-100971769 GACGAACAGAAGTGGGTTAAAGG - Intronic
1134536040 16:15027772-15027794 GGCAGACAGAAGTGGCTGGATGG - Intronic
1135254424 16:20929559-20929581 GGCAAATGGAAGATGCTCAAAGG - Intergenic
1135658278 16:24270873-24270895 GGCAAAGCCAAGTGGCTCACTGG + Intronic
1135935060 16:26772690-26772712 TGCAAACATAAGTGACTCATCGG + Intergenic
1136499247 16:30661586-30661608 GAGAACCAGAAGTAGCTCAAGGG - Intronic
1138241125 16:55427945-55427967 CCTAAACAGAAGTGGGTCAAAGG + Intronic
1139860019 16:70013015-70013037 GGCAGACAGAAGTGGCTGGATGG + Intergenic
1140233315 16:73136162-73136184 GGCAAACTCAAGTGGCTCCATGG - Intronic
1141530137 16:84640651-84640673 GGCAAACAGTCCTGGCTGAAAGG - Intergenic
1142130090 16:88428363-88428385 GGCAAACACCAGTGGCCCATTGG - Exonic
1142148313 16:88501842-88501864 GGCAAACAGCAGTGGCAGGAGGG - Intronic
1144703470 17:17352965-17352987 GGCATATAGATGCGGCTCAATGG + Intergenic
1146375837 17:32293805-32293827 AGCAAACAGAAGTGGGTGAGGGG + Intronic
1147636909 17:41969525-41969547 GGCAACCAGAAATGGCCTAAAGG - Intronic
1148783688 17:50135118-50135140 GGCAGACAGAGGTGGCTAGAAGG - Exonic
1149278768 17:55077500-55077522 GGAAAACAGAAGAAACTCAATGG - Intronic
1149497065 17:57125713-57125735 GGCATACAGCAGGTGCTCAATGG - Intergenic
1150270648 17:63862321-63862343 GGCAAACAGACCTGGCTGGAAGG + Intergenic
1152430325 17:80245265-80245287 GGCAAACAGAAGAGGCGGACAGG - Intronic
1152908132 17:82981298-82981320 GAGAAACAAAAGTGGCTCAGAGG + Intronic
1153017387 18:596463-596485 GGAAAAAAGTAGTGGGTCAAAGG - Intergenic
1153070868 18:1102975-1102997 GGAATAAAGAAGTAGCTCAAAGG + Intergenic
1153522704 18:5967449-5967471 GGGAAACAGAGGTGGCTGCATGG - Intronic
1153619485 18:6963510-6963532 GGCAAAGAGAAGGGGCACAGTGG + Intronic
1156278563 18:35609476-35609498 CACACACAGAAGAGGCTCAAGGG - Intronic
1157195988 18:45620464-45620486 TGCATACAGAAGGGACTCAAAGG + Intronic
1158091297 18:53716906-53716928 GACAAACAGAAGTGGGGCGAAGG - Intergenic
1158281803 18:55836374-55836396 GGGTACCAGATGTGGCTCAAAGG - Intergenic
1160179432 18:76620943-76620965 GGCAAACAGCATTTGCACAAAGG - Intergenic
1163991212 19:21000791-21000813 GGTAGACTGAAGTGGCTCTAGGG - Intergenic
1164855850 19:31520099-31520121 GGCAAACTGACATGGCACAATGG + Intergenic
925430936 2:3792354-3792376 GGCCAACAGAAGTAGGACAAGGG - Intronic
926705768 2:15836360-15836382 AGGAAACAGAAGTGGGTCAGGGG + Intergenic
927277312 2:21272930-21272952 GAAAAACAGAAGAGGTTCAAAGG + Intergenic
927853388 2:26513585-26513607 GGCAAGCAGCAGTGTCTCACCGG - Intronic
930156123 2:48109336-48109358 GACAAAAAGATGAGGCTCAAGGG + Intergenic
930541937 2:52717314-52717336 GGCAAGCAGAAGTTACTCGAAGG - Intergenic
931662245 2:64576556-64576578 GGAAATCAGTAGTGGCACAATGG - Intronic
931730791 2:65151743-65151765 GACAAACAGAAGTGGGAGAAAGG - Intergenic
932225408 2:70035731-70035753 GGAAAACTGAAGTGACTTAAGGG + Intergenic
932618213 2:73249598-73249620 GGCAAACAGAAGAAGTTAAAAGG - Intronic
932792454 2:74667405-74667427 GGCTACCAGCAGTGGCTAAAGGG + Intronic
933480594 2:82852181-82852203 TGCAAACAGATGTGGATTAAGGG + Intergenic
935611216 2:105027590-105027612 GCCACACAGAAGTGGGTCAGTGG - Intergenic
936013604 2:108941755-108941777 CGCACACAGAATTGGCTCAGAGG + Intronic
938256287 2:129862138-129862160 GAAACACAGAAGTGGCTCAGAGG + Intergenic
940184284 2:150965761-150965783 GGCAAAGAGAAGTTGATAAATGG - Intergenic
942898240 2:181084116-181084138 AGCAAACAGAATTTGCTGAAGGG + Intergenic
943710339 2:191086958-191086980 GGCAATCTGAAGTGCCTCAGAGG + Intronic
945063802 2:205931409-205931431 GGCAGAAGCAAGTGGCTCAAGGG + Intergenic
945470847 2:210226036-210226058 GGGAAACATAAATGGCTCAAAGG + Intergenic
946098410 2:217296318-217296340 GGCAAACAGAAGAAAATCAAAGG + Intronic
946759881 2:222982956-222982978 GCCACACAGAAATGGCTCCAAGG - Intergenic
947302924 2:228708394-228708416 CTCAAACAAAAATGGCTCAAGGG - Intergenic
947952621 2:234161202-234161224 TACAAACAGAAGTGGCAAAATGG + Intergenic
948406450 2:237723836-237723858 GGCAAACAGCTGGTGCTCAAAGG - Intronic
1168832923 20:856841-856863 GGCACACAGTAGGTGCTCAATGG - Intronic
1172404885 20:34680613-34680635 GGCACACAGCAGGGGCTCAAAGG - Intergenic
1172588699 20:36102737-36102759 GTCAGACAGAAGGGACTCAAGGG - Intronic
1172936863 20:38626716-38626738 GGAAAACAGAGGTGGGTGAAGGG - Intronic
1174953570 20:55069896-55069918 GGTTAACTGAAATGGCTCAATGG - Intergenic
1175093244 20:56521915-56521937 GGCAAACAGACGTGGTTTACAGG - Intronic
1177056518 21:16310837-16310859 TGCAAACAAAAATTGCTCAAAGG - Intergenic
1177549785 21:22605565-22605587 GACAAAGAGAAGTGGCTTAAAGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179413192 21:41177923-41177945 GGCAAACAGACCTGGCTCCATGG + Intronic
1179464225 21:41561101-41561123 GGCAGTCAGCAGTGGCTCAGGGG + Intergenic
1180229677 21:46419580-46419602 GAAAAACAAAAGTGGCTCGAGGG - Intronic
1180589797 22:16927774-16927796 GGCAAACAGTAGGTGCTCAGTGG - Intergenic
1181776531 22:25164025-25164047 GGCAAAGACAAGTGCCTCAGTGG - Intronic
1182017122 22:27050181-27050203 GGCAAACAGAAAGAGCTTAAAGG - Intergenic
1183121881 22:35736414-35736436 TGCAGACAGAAGTGCCTCAGGGG + Intergenic
1183677235 22:39306433-39306455 GGCACAGAGAAGTGGGTGAAAGG - Intergenic
1185392246 22:50568832-50568854 GACAAACAGAAATGGCCCCAGGG + Intergenic
949474548 3:4431151-4431173 GGCAAATAGAGATGGGTCAATGG + Intronic
950072249 3:10162064-10162086 GGAAAACAGAACTGGCTCAAAGG + Intergenic
951961771 3:28333367-28333389 GGGAAACAGAACTGGCCCACAGG + Intronic
952880552 3:37983473-37983495 GGCACAGAGAAGTGGCTAACAGG - Exonic
952934591 3:38386290-38386312 GGCAAACAGAAGTGGCTCAAGGG - Intronic
953743499 3:45556150-45556172 GGCACTGAGCAGTGGCTCAAGGG + Intronic
954134458 3:48575604-48575626 GGTGAGCAGAAGTGGCTCAGTGG - Exonic
958449817 3:94259454-94259476 GGCAAACAGGAGTGGGTCCCTGG + Intergenic
961061463 3:123832299-123832321 GGAAAACAAAAGTGTCTGAAGGG - Intronic
961244566 3:125440371-125440393 GGCAAACAGAAGTGAGTTTAGGG + Intergenic
962670575 3:137702637-137702659 GATAAAGAGAAGTGGCTTAAAGG + Intergenic
962888074 3:139646506-139646528 GGCAAATGGGAGTGGCTCAGGGG - Intronic
963299922 3:143586258-143586280 TGAAAACAGAAGTTGCTAAATGG - Intronic
964224047 3:154376850-154376872 GGCACAGAGAAGTTGCTCAAGGG - Intronic
964404082 3:156330357-156330379 GGTAAAGAGAAGTGCCTAAAGGG - Intronic
964738067 3:159936480-159936502 GGCAGAAAGGAATGGCTCAATGG + Intergenic
965712054 3:171565189-171565211 GGCAAACAGAAGTCCCGCAGTGG - Intergenic
967671994 3:192247424-192247446 TGCAATCAGATATGGCTCAATGG + Intronic
968644543 4:1733246-1733268 TAAAAACATAAGTGGCTCAATGG - Intronic
969353614 4:6612589-6612611 GGGAACCAGAGGTGGCTCAATGG - Intronic
971233498 4:24819793-24819815 GCCACAGAGGAGTGGCTCAATGG - Intronic
971359354 4:25922582-25922604 GGCTAACAGGAGTGGCTGAAAGG - Intronic
974284191 4:59842471-59842493 GGGAAACAGAGGTGCCTTAATGG + Intergenic
975871809 4:78787460-78787482 GTCTAACGGTAGTGGCTCAAGGG - Intronic
976153602 4:82118469-82118491 GGCAAACAGAAGTAACTCAAAGG + Intergenic
981667712 4:147248336-147248358 AGCAAACAGAAGTGGATGGAGGG - Intergenic
982296171 4:153831861-153831883 GGCAAACAAAAGTGTCTCACTGG + Intergenic
983774169 4:171584979-171585001 GGCAGACAGAAGTGGGTCCCTGG - Intergenic
985804597 5:2033068-2033090 GGAAAACATAAGTAGCTCACTGG - Intergenic
989431163 5:41356864-41356886 GGCAAACAGGAAGGGCTCCATGG + Intronic
991907585 5:71527309-71527331 GGCATAGAGATGGGGCTCAAGGG - Intronic
992480952 5:77152117-77152139 GGCATACAGTAGGGACTCAATGG + Intergenic
993229159 5:85209885-85209907 TACAAACAGCAGTGGATCAAGGG + Intergenic
994905512 5:105837632-105837654 GGTAAACTGAAGTGGCACACTGG - Intergenic
995447457 5:112261568-112261590 GCCTAAGAGAAGTAGCTCAAAGG + Intronic
995851157 5:116547059-116547081 AGCAAACAGAAATGACTTAATGG - Intronic
998509569 5:142700280-142700302 GGCACACAGTAGGTGCTCAATGG - Intergenic
998816356 5:146017894-146017916 GGGGAAGAGAAGTGGCTGAAAGG - Intronic
999222078 5:149988656-149988678 GGAAAAAAAATGTGGCTCAAAGG - Intronic
1003047858 6:2751266-2751288 GGCAAACAGAGGTGGCTGTGGGG - Intergenic
1004910458 6:20277937-20277959 AGAACACAGAGGTGGCTCAAAGG - Intergenic
1007280189 6:40706491-40706513 GGCAAAGAGAAGTAATTCAAAGG + Intergenic
1007708540 6:43806432-43806454 GGCTGACAGAAGTGGCTCTCTGG + Intergenic
1007721786 6:43889479-43889501 GGCCAGCAGAAGTGGCTGACAGG + Intergenic
1007941439 6:45785230-45785252 AGCAAACAGTAGGGGCTTAAGGG + Intergenic
1008464153 6:51811848-51811870 GGCAAAAAGAAAGGGCTAAATGG + Intronic
1011275081 6:85622731-85622753 AGCAAATACAAGTGGATCAAAGG + Intronic
1012133198 6:95520999-95521021 GGCAAACAGGAGGGGATCAAGGG - Intergenic
1018784150 6:167094817-167094839 GGGAAACAGAAGTGCTTCAGTGG + Intergenic
1020075875 7:5258538-5258560 AGCAAACAGAGATGGATCAATGG + Intergenic
1022555974 7:31296685-31296707 AGAAAACTGAAGTGGCTCATCGG + Intergenic
1024628872 7:51231326-51231348 AGCAAAAAGAAGTGTCTCCATGG + Intronic
1025203209 7:56975024-56975046 AGCAAACAGAGATGGATCAATGG - Intergenic
1025668735 7:63601903-63601925 AGCAAACAGAGATGGATCAATGG + Intergenic
1027678026 7:81183055-81183077 GGCAAATAAAGGTAGCTCAACGG + Intronic
1030636431 7:111954439-111954461 GGTAAACAGAAGAGACCCAAGGG + Intronic
1030656434 7:112173499-112173521 GCCAAACAGAAGTGGCTTTGAGG + Intronic
1031648635 7:124258527-124258549 GAGAAACAGAAGTGGCTTTAGGG + Intergenic
1036704865 8:11039475-11039497 GGCACACAGAAGTTACTCATGGG - Intronic
1041095107 8:54342216-54342238 GGCACACATAGCTGGCTCAAAGG + Intergenic
1041379050 8:57233353-57233375 AGCAAAAAGAATTGGCTTAAAGG + Intergenic
1042057723 8:64784135-64784157 GGCAAAGAGTAGTGCCTCAAAGG + Intronic
1044212134 8:89562306-89562328 GTCTAACAGAAATGCCTCAAGGG - Intergenic
1050339183 9:4619061-4619083 GGAGAATTGAAGTGGCTCAAGGG - Intronic
1050697667 9:8297345-8297367 GCCAAACCTAAGAGGCTCAATGG + Intergenic
1053827696 9:42042788-42042810 GGTAAAAAGAAGTTACTCAATGG - Intronic
1054602864 9:67144654-67144676 GGTAAAAAGAAGTTACTCAATGG + Intergenic
1056977046 9:91267534-91267556 GGCAAGCAGATGCGGCCCAAAGG - Intronic
1058426684 9:104881561-104881583 GGTAAGAAGAAGTGGCTGAAAGG + Intronic
1058662382 9:107278423-107278445 GTCAAACTGAAGGGCCTCAAGGG - Intergenic
1059896314 9:118869892-118869914 GGCAAAGATTAGTGGCTTAAAGG + Intergenic
1060268060 9:122123613-122123635 GGCAAAAACAAGAGGCTCAGGGG - Intergenic
1189267547 X:39728510-39728532 GGAAGGCGGAAGTGGCTCAATGG + Intergenic
1191164972 X:57379653-57379675 GGCATAGAGTAGTGGCTTAAGGG - Intronic
1194195381 X:90884823-90884845 GGCATACAGCAAAGGCTCAAAGG + Intergenic
1196264085 X:113620991-113621013 GGGAAACAGATGTGGGGCAATGG + Intergenic
1197137996 X:123085130-123085152 GGCAAAGAGAAGTGACACAGAGG + Intergenic
1198760851 X:140031098-140031120 GGTAAAGAGAAGTGGGTTAAAGG - Intergenic
1201447689 Y:14076347-14076369 GGAAAACAGAGGTGGCTTAGAGG - Intergenic
1201737385 Y:17283175-17283197 GGAAAACAGAAGTCTATCAATGG - Intergenic
1202056456 Y:20837544-20837566 GGTAAACAGAGGTGGGTTAATGG - Intergenic