ID: 952937768

View in Genome Browser
Species Human (GRCh38)
Location 3:38413543-38413565
Sequence CACCTCAGACAGCTGAAACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952937768 Original CRISPR CACCTCAGACAGCTGAAACA AGG (reversed) Exonic
900589065 1:3451591-3451613 CACCACAAACAACTCAAACATGG - Intergenic
900599706 1:3497771-3497793 CCCCTCAGACAGCAGACCCAAGG + Intronic
904959439 1:34320306-34320328 CCCATCAGACAGCAGACACATGG - Intergenic
906800590 1:48733725-48733747 CAGCTAAGAAATCTGAAACATGG + Intronic
907309342 1:53530306-53530328 CAGCACAGAGAGCTGAAATAGGG + Intronic
910844776 1:91594486-91594508 CACCTCAGGAGGCTGAAGCATGG - Intergenic
913549437 1:119903114-119903136 CACCACAGACAGCTGCCACTAGG + Intergenic
919418684 1:197343793-197343815 CACATGAGGAAGCTGAAACATGG + Intronic
920905453 1:210160849-210160871 CACATCAGAAAGCTGAAATAGGG - Exonic
923907499 1:238401769-238401791 CACCTCACACAGCCGGAGCAGGG + Intergenic
1064581930 10:16802757-16802779 CACTTCAAACAGGTGAAAGAAGG + Intronic
1067268079 10:44764769-44764791 CAGCTCAGCCAGCTGCAACCAGG - Intergenic
1069768094 10:70878760-70878782 TACCTCTGAAAGCTGAATCAAGG - Exonic
1070303244 10:75220833-75220855 AACCAAAGACAGCTGAACCATGG - Exonic
1070493702 10:77001357-77001379 TACCACAGACAGCACAAACATGG + Intronic
1071427324 10:85571952-85571974 AAGCTCAGACAGCTTAAACTGGG + Intergenic
1075486547 10:122827064-122827086 CAGCTCAGACAGCAGATACATGG - Intergenic
1077408612 11:2393411-2393433 CACCTGGGACAGCTGGACCAGGG - Intronic
1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG + Intronic
1078073722 11:8137900-8137922 CACTTCTGACTGTTGAAACATGG - Intronic
1078089363 11:8254769-8254791 CACGTCTGACAGCTGGAAAAGGG + Intronic
1078505917 11:11945263-11945285 CTCCTCAGTCATCTGAAAGAAGG + Intronic
1086096270 11:83052994-83053016 CACCTCAGAGAGAAGACACAGGG + Intronic
1087153722 11:94881341-94881363 CCCCTCAGAGAGCTGAAAGAGGG - Intergenic
1088074358 11:105828483-105828505 TACCTGAGACAGCTAATACAGGG + Intronic
1089859021 11:121572434-121572456 GACCTGAGCCAGGTGAAACAGGG - Intronic
1090218253 11:124990785-124990807 CTGCTTAGACAGCTGAAAGATGG + Intronic
1091252869 11:134158358-134158380 CATCTCCTACACCTGAAACAGGG - Exonic
1091314009 11:134597970-134597992 CTCCTCAAAAAGCCGAAACATGG + Intergenic
1092696763 12:11180098-11180120 CATCTCAGCCAGATGAAGCATGG + Intergenic
1093029554 12:14275599-14275621 CATCTCAGAGAGCAGAACCAAGG - Intergenic
1095582440 12:43815435-43815457 TTCCTCAGACAGCTGATACTGGG - Intergenic
1101340461 12:103838311-103838333 CGCATGAGACAGCTGAAGCATGG - Intronic
1101347745 12:103901998-103902020 CACCTCACCCAGGTGAAACCAGG + Intergenic
1102119422 12:110429167-110429189 CACCTCAGGCGGCGGACACAGGG + Intergenic
1102481878 12:113229464-113229486 CTCCTCAGACAGCAGGGACAGGG - Intronic
1102629424 12:114264822-114264844 CACCCCAGACAAATGAAAAATGG + Intergenic
1104093856 12:125538283-125538305 CACCACAGAAAGCTGAGACTTGG - Intronic
1104418919 12:128619224-128619246 AACTTCAGAAAGGTGAAACAGGG + Intronic
1106586575 13:31062148-31062170 ATCCTCTGAAAGCTGAAACAAGG + Intergenic
1106701704 13:32235685-32235707 CACCTCTGATGGCTGAAAGAAGG - Intronic
1106899613 13:34341266-34341288 CACCTCAGGCAGAGGAAACAGGG - Intergenic
1110358098 13:74591764-74591786 GACCACAGACACCTAAAACATGG - Intergenic
1112568504 13:100571669-100571691 AAGGTCACACAGCTGAAACACGG - Intronic
1113520302 13:110935960-110935982 CACCGCACCCAGCTGAAACCAGG + Intergenic
1114296378 14:21333164-21333186 CCACTCAGACATCTGAAACCAGG - Intronic
1115358361 14:32473836-32473858 CACCTCATACAGCTGGGTCATGG + Intronic
1116944477 14:50823293-50823315 GACCTCAGCCATCTGCAACAAGG + Intronic
1118057861 14:62100514-62100536 GACATCAGACAGCTGAAAGAGGG - Exonic
1118637604 14:67762267-67762289 GACCTCAATCAGCTGAATCATGG - Exonic
1121002410 14:90461431-90461453 CACCGCACCCAGCTGAGACACGG + Intergenic
1121109796 14:91304292-91304314 CACCACAGTCAGCTGAAAAGAGG - Intronic
1121709129 14:96024234-96024256 CTCCCCAGAGAGCAGAAACAGGG - Intergenic
1122499472 14:102187112-102187134 CATCTCAGACAACCAAAACAGGG - Intronic
1123007471 14:105330742-105330764 CTCGTCAGGAAGCTGAAACAAGG - Intronic
1124434842 15:29638461-29638483 CATCTCAGAGTGCTGAATCAAGG + Intergenic
1125821545 15:42636292-42636314 CACCCCACCCAGCTGAGACAGGG - Intronic
1126859673 15:52871568-52871590 CACCTCAGGGAGCTGACAGATGG + Intergenic
1127268249 15:57378089-57378111 CACCTGAGACACCTGTCACATGG + Intronic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1131414059 15:92236739-92236761 CAGCTCAGACAGCTGCAAAATGG + Intergenic
1133650804 16:7812712-7812734 CACCACAAACAACAGAAACAAGG - Intergenic
1134031643 16:10996716-10996738 CACCCCAGACAGGTGAATCCTGG - Intronic
1134099331 16:11440635-11440657 CTCCTCAGACATCTCATACAGGG + Intronic
1139347514 16:66313614-66313636 CACCCCAGACAGCTCTAACTGGG + Intergenic
1140175865 16:72659047-72659069 CAGATTACACAGCTGAAACAAGG - Intergenic
1140289290 16:73636000-73636022 GACCTCAGACTATTGAAACAGGG + Intergenic
1141736104 16:85854635-85854657 CACCTCAAAGAGCTGTTACAAGG - Intergenic
1141769327 16:86079696-86079718 CCCCACAAACAGCTGAGACAAGG + Intergenic
1145824702 17:27868099-27868121 CTCTTCAGACAGCACAAACATGG - Intronic
1146085289 17:29822648-29822670 CACCTCATCCAGCTGAGCCAGGG + Intronic
1148745496 17:49915872-49915894 CACTTTACACAGCTGAAAAAGGG - Intergenic
1152343505 17:79738018-79738040 GACCTCAGACAGAAGAATCACGG - Exonic
1155421558 18:25662111-25662133 CACCTGAGCCAGCTGTGACATGG - Intergenic
1156023895 18:32630130-32630152 CAGCTCAAGCAGCTGAGACAGGG + Intergenic
1159192746 18:65069286-65069308 CACCTCAGAGAGGTAGAACACGG - Intergenic
1160898564 19:1415105-1415127 CAGCTGAGAAACCTGAAACAGGG - Intronic
1163696603 19:18767442-18767464 CACTTCGGAAAGCTGAGACAGGG - Intronic
1164603029 19:29576425-29576447 CACCCGAGACAACAGAAACAGGG + Intergenic
925636371 2:5945244-5945266 CAGGTCAGTCAGCTGACACAAGG + Intergenic
925747267 2:7054144-7054166 CAGCTCAAGCAGCTGAGACAAGG + Intronic
926982369 2:18585262-18585284 CCCCTTAGGCAGCTGACACATGG + Intronic
927740699 2:25566961-25566983 GAGGTCAGACAGCTTAAACAAGG + Intronic
928139110 2:28712541-28712563 TACCTCACACAGCTAATACACGG + Intergenic
928188036 2:29132725-29132747 CACATCAGACTATTGAAACAAGG - Intronic
930482861 2:51971403-51971425 CACCCCAGACATCTTAAGCAAGG - Intergenic
931276284 2:60746458-60746480 CAACTCAAGCAGCTGAGACAGGG - Intergenic
931737072 2:65205552-65205574 AACCAAAGACAGCTGAACCATGG - Intergenic
932757244 2:74417345-74417367 CACCTCAGGTAGCTGCCACAGGG + Intronic
933076011 2:77927453-77927475 CACCTCAGGAAGCTTAATCATGG - Intergenic
934299446 2:91768523-91768545 CAGCTCAGACCCCTGAAACTGGG + Intergenic
938295756 2:130178386-130178408 CACCTCACAAAACTGAGACAGGG + Intronic
938388187 2:130882646-130882668 AACCTCAGTGAGCAGAAACAGGG - Intronic
938643766 2:133310367-133310389 CTCCTCAAACAGCTGCAACCTGG + Intronic
938906927 2:135846236-135846258 CACCTCAGAAAGGTGGAAGAAGG - Exonic
939289523 2:140176034-140176056 CTCCCCAGACAGCAGACACAAGG + Intergenic
942113661 2:172706925-172706947 CACCTCACCCAGCAGGAACAAGG - Intergenic
948443236 2:238011319-238011341 CACTCCAGGCAGATGAAACAGGG - Intronic
948556868 2:238818044-238818066 CACCCCAGAAAGATGCAACAGGG - Intergenic
1171953060 20:31438683-31438705 CACCTCAGACATCAGACACCAGG - Intergenic
1172798630 20:37560777-37560799 CACCTCTGACAGCTGGGGCAGGG - Intergenic
1176310359 21:5145927-5145949 CAGCTCAGACAGCCGAGGCAGGG + Intronic
1179846696 21:44116108-44116130 CAGCTCAGACAGCCGAGGCAGGG - Intronic
1182008091 22:26978207-26978229 GGCCTCAAACAGCTGAAACTGGG - Intergenic
1182442600 22:30372968-30372990 CACAGCAGACACCTGATACATGG - Intronic
1184890108 22:47374203-47374225 CACCTCAGAGAGCAGACACCAGG - Intergenic
1185361121 22:50407626-50407648 CATCTCAGCCAGCTGTAACGGGG + Intronic
951771177 3:26259268-26259290 TGCCATAGACAGCTGAAACATGG - Intergenic
952365768 3:32673659-32673681 CACCTTTGAGAGCTGTAACAGGG - Intergenic
952937768 3:38413543-38413565 CACCTCAGACAGCTGAAACAAGG - Exonic
953272631 3:41460258-41460280 CACCTCAGAAAGGATAAACAAGG + Intronic
953828279 3:46273009-46273031 GATCTCAGAGAGCTGAAACTTGG - Intergenic
954085957 3:48244110-48244132 AACCTCACACAGCTGAACTAAGG - Intronic
957920798 3:86745955-86745977 CACCTCAGAGAGTTAAAAAATGG + Intergenic
961091188 3:124114087-124114109 CACCTCAGGCAGCTGGATGAGGG + Intronic
961798292 3:129425437-129425459 CACCTCAGACAACAGAAAGGAGG - Intronic
962394884 3:135006914-135006936 CCACCCCGACAGCTGAAACATGG + Intronic
962969587 3:140386521-140386543 CAGCTCAAGCAGCTGAGACAGGG - Intronic
966159331 3:176951359-176951381 CAGCTGAGACTGCTGATACAGGG - Intergenic
968269881 3:197395267-197395289 CACGGCTGCCAGCTGAAACAAGG + Intergenic
969702621 4:8776074-8776096 AACCTCAGAGAACTGAGACACGG - Intergenic
971697611 4:29926725-29926747 CATCTTACACAACTGAAACAAGG - Intergenic
972269150 4:37492915-37492937 GACCTGAGAAAGCTGAACCAGGG - Intronic
973793057 4:54395626-54395648 GGCCTGAGACAGCTGAGACAAGG - Intergenic
974298344 4:60033913-60033935 CACCTCATACAGCTGACATCAGG - Intergenic
974906307 4:68062710-68062732 CACATGAGAAAGCTGAAATAGGG + Intronic
977212404 4:94234442-94234464 CACCTCACACAACTGTGACAAGG + Intronic
982059501 4:151590430-151590452 CACCTCAGAGAGCTGTTACGAGG + Intronic
982955340 4:161758238-161758260 AACATCAGACAGCTGATAAATGG + Intronic
984528800 4:180890134-180890156 CATCTCAGGCTGCTGTAACAAGG + Intergenic
985421076 4:189785730-189785752 CACCTCTGTCAGCTGAGACATGG + Intergenic
987860198 5:23476320-23476342 CAACTCTGACAGATGTAACAGGG + Intergenic
987892619 5:23900297-23900319 CACCTCAGAAAGCTCAAACTAGG + Intergenic
989840876 5:46067102-46067124 CACCTCACAGAGTTAAAACACGG + Intergenic
989987276 5:50715638-50715660 CACCACAGACAGTAGTAACAAGG + Intronic
990073481 5:51814470-51814492 TACCTCACACAGCTAATACATGG - Intergenic
991276456 5:64853202-64853224 GATATCAGAAAGCTGAAACATGG + Intronic
993979725 5:94530767-94530789 CAGCTCTGAAAGCAGAAACAGGG - Intronic
994741458 5:103624786-103624808 CACTTCAGACATTTGAAAGATGG - Intergenic
995114138 5:108459873-108459895 CTCCTCAGAGAGCTGTCACATGG - Intergenic
998529120 5:142868828-142868850 CATGACAGACAGCTGAGACATGG - Intronic
998770518 5:145539081-145539103 AACCTAAGACAGCCGAAACAAGG + Intronic
1001321283 5:170684137-170684159 CACCTCACACAACTGATAAATGG - Intronic
1002425216 5:179170906-179170928 CACCTCAGAGACCTGAAAACAGG + Intronic
1004272125 6:14204890-14204912 CACCTCAGGCAGCTGACAAAGGG + Intergenic
1005392040 6:25343811-25343833 CACTTGAGACAGCTGAAGGAGGG - Intronic
1007301850 6:40873660-40873682 CAACTCAGAAAGCAGAACCAGGG - Intergenic
1012688862 6:102288743-102288765 AACCTCAGACAGCAAAACCAGGG + Intergenic
1012964453 6:105658070-105658092 AACCTGAGAGAGCTGACACATGG + Intergenic
1013195380 6:107840447-107840469 AACCTATGATAGCTGAAACAGGG + Intergenic
1018238351 6:161748532-161748554 CGCCTCCGACAGCAGAATCAGGG + Intronic
1018838357 6:167501679-167501701 CACCGCAGACATCTGACCCATGG + Intergenic
1019459494 7:1149417-1149439 CACCTCAGACCACAGAACCAGGG + Intergenic
1024685535 7:51740907-51740929 AAGCTCAGGCAGCTGAAACATGG + Intergenic
1025990151 7:66491517-66491539 CTACTCAGGAAGCTGAAACATGG + Intergenic
1026813285 7:73487676-73487698 GACCACAGAAAGCTGAATCATGG + Intronic
1029175691 7:98662805-98662827 CAGGAAAGACAGCTGAAACAAGG + Intergenic
1029601685 7:101567447-101567469 CACCTCAGTAAGCTGAGACATGG - Intergenic
1030082697 7:105791200-105791222 CACCTCGGGCACCTGAAACCTGG - Intronic
1031405326 7:121378471-121378493 CACCACAGCCAGCTGCAAGACGG + Intronic
1031820153 7:126490601-126490623 CTCCTAAGACCTCTGAAACATGG - Intronic
1031969397 7:128053378-128053400 CATCTCACAGAGCTGGAACAGGG - Intronic
1032409228 7:131682130-131682152 CACTTTAGCAAGCTGAAACATGG - Intergenic
1033985551 7:147221487-147221509 CACCTGAGACAGCAGAAGCATGG - Intronic
1035393310 7:158519775-158519797 CACCTCAGAAAGAAGAAAAAGGG + Intronic
1035762873 8:2082238-2082260 CACCTCAGCCATTTTAAACAAGG + Intronic
1036082399 8:5571824-5571846 AACCACAGAAAGCTAAAACACGG + Intergenic
1037931978 8:22886707-22886729 CTCCTCACACAGCAGCAACAGGG + Intronic
1037982140 8:23261808-23261830 CACCTCAGGCAGCAGGGACAGGG - Exonic
1041589054 8:59555526-59555548 CACCTCAGACCACTGAAGCCTGG - Intergenic
1043491144 8:80750161-80750183 CCCCCCAGGCAGCTGCAACATGG + Intronic
1044268803 8:90215524-90215546 CACCTCAGACAGGAGAAGAAGGG - Intergenic
1045138575 8:99252132-99252154 CACCTAAAACACCAGAAACATGG - Intronic
1045631400 8:104128058-104128080 CAACTGAAACAGGTGAAACAGGG + Intronic
1046024872 8:108710641-108710663 CAGCTCAAGCAGCTGAGACAAGG - Intronic
1046164662 8:110416195-110416217 CCCTTCAGACAGCAGTAACAGGG - Intergenic
1047451254 8:124966926-124966948 CACCTCACCCAGCTTCAACATGG + Intergenic
1048787681 8:138067933-138067955 CACCGCAGACTTCAGAAACATGG + Intergenic
1049716000 8:144092470-144092492 CACCTCAGGCAGCTGGCACTGGG + Intergenic
1049905499 9:213269-213291 TACCTGACACAGCTGAAACCAGG + Exonic
1050092402 9:2028177-2028199 CCCCTCAGACAGTTAAAACCAGG - Intronic
1051270284 9:15348757-15348779 CAAATCAGACAGCTAATACATGG + Intergenic
1055427006 9:76206621-76206643 CACCTCACAGAGCGCAAACAAGG + Intronic
1057904714 9:98974787-98974809 CACTTCAGTCAGCTTAAACGGGG - Intronic
1058937665 9:109783788-109783810 AGCCTCAGGCAGCTGAAACCTGG - Intronic
1059014683 9:110503181-110503203 CATCTCCGCCAGCCGAAACATGG - Exonic
1059700504 9:116771319-116771341 CTCCACTGACAGCTGAAAAATGG - Intronic
1061455476 9:130694243-130694265 CCCCTCAGAGAGCTGAAAACTGG - Intronic
1062336882 9:136075201-136075223 GGCCTCAGACAGCTGTCACATGG + Intronic
1186314412 X:8353192-8353214 AACTTCAGACAGCTGCAAAAAGG - Intergenic
1186647640 X:11524337-11524359 CATTTCAGCCAGCTGAAATAGGG - Intronic
1193327635 X:80199526-80199548 CAAATCATACATCTGAAACAAGG - Intergenic
1193473768 X:81939262-81939284 CACCTTAGGCTGCTGTAACAAGG - Intergenic
1195023802 X:100855529-100855551 CAGCTATGACAGCTGTAACAAGG - Intronic
1195177754 X:102327111-102327133 CTCCTCAGAGAGCTGACACCGGG + Intergenic
1195181110 X:102359982-102360004 CTCCTCAGAGAGCTGACACCGGG - Intergenic
1196609437 X:117695025-117695047 CACCCCAGGCAGCGGAAGCATGG + Intergenic
1199740971 X:150735990-150736012 AACCTCACATAGCTGAGACATGG - Intronic