ID: 952942269

View in Genome Browser
Species Human (GRCh38)
Location 3:38454014-38454036
Sequence GACTCAGGCATAGCGCGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952942269_952942282 15 Left 952942269 3:38454014-38454036 CCCCGCCGCGCTATGCCTGAGTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 952942282 3:38454052-38454074 CGTGCCCCGCCGCCGCCCCCCGG 0: 1
1: 1
2: 7
3: 62
4: 479
952942269_952942275 -10 Left 952942269 3:38454014-38454036 CCCCGCCGCGCTATGCCTGAGTC 0: 1
1: 0
2: 0
3: 4
4: 44
Right 952942275 3:38454027-38454049 TGCCTGAGTCGGGCGCGCCCCGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952942269 Original CRISPR GACTCAGGCATAGCGCGGCG GGG (reversed) Exonic
903065306 1:20696345-20696367 GACGCAGGGATAGCGGGGTGGGG + Intronic
904768991 1:32870686-32870708 GCCACAGGCGGAGCGCGGCGCGG + Exonic
915298208 1:154936693-154936715 GCTTCAGGCATCGCGAGGCGTGG - Exonic
923648941 1:235853766-235853788 AACTCAGGCATAGGGCAGCCAGG + Intronic
923755410 1:236786652-236786674 GAGTCAGGCATAGAACGGCGAGG - Intergenic
1063218118 10:3942385-3942407 GCCTCAGGCAAAGCGTGGAGAGG - Intergenic
1068279771 10:54854025-54854047 GAGTCAGGCATAGAATGGCGAGG + Intronic
1077229844 11:1453850-1453872 GACTCAGGCAGAGCGCGCCTGGG - Intronic
1097805181 12:63957486-63957508 GAGTCAGGCATAGCGCAGCCTGG + Intronic
1116448395 14:45038396-45038418 GAGCCAGGCACAGAGCGGCGAGG + Intronic
1118404874 14:65412999-65413021 GACTGAGGCAGAGCGCGAGGCGG - Intronic
1134833569 16:17343367-17343389 GACTCAGGCATAGGTGGGCTTGG + Intronic
1141486562 16:84344150-84344172 GACTGAGGCATTCAGCGGCGTGG + Intergenic
1144778943 17:17798378-17798400 GGCTCCGGCAGAGCCCGGCGGGG + Exonic
1149329987 17:55570606-55570628 GAGTCAGGCATGGAGCAGCGAGG - Intergenic
1154241519 18:12657803-12657825 GACTGAGGCAGTGGGCGGCGAGG - Exonic
1160765755 19:806888-806910 CACACAGGGTTAGCGCGGCGGGG + Intronic
1160951936 19:1671994-1672016 AACCGAGGCATAGAGCGGCGAGG + Intergenic
1164222067 19:23203889-23203911 GACTCCGGCCTAGCGCAGGGCGG - Intergenic
1167506860 19:49875570-49875592 GCCCCAGGCCTAGCACGGCGAGG - Intronic
1167609789 19:50501595-50501617 GACTCAGGCACAGGGAGGCAAGG - Intergenic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
945394880 2:209305901-209305923 GAGTCAGGCATAGAGCAGTGAGG + Intergenic
946403855 2:219482783-219482805 GACTCAGGCAAAGGGCGCAGAGG + Exonic
1179597505 21:42452598-42452620 CACTCAGGCATAGCGCGAATGGG + Intergenic
1182772094 22:32803198-32803220 GACACAGGCAGAGGGCGGCAAGG - Intronic
951803527 3:26622998-26623020 GACGCAGGCAGTGCGTGGCGCGG - Exonic
952942269 3:38454014-38454036 GACTCAGGCATAGCGCGGCGGGG - Exonic
954737199 3:52716141-52716163 GAGTCAGGCATGGAGCGGCGAGG - Intronic
963234977 3:142947472-142947494 GTCTCAGGGAGAGCGCGGGGAGG - Intergenic
965272835 3:166639606-166639628 GAGTCAGGCATGGAGCGGTGAGG - Intergenic
976226326 4:82798057-82798079 TCCTCAGGCAGACCGCGGCGGGG + Intronic
984623112 4:181975687-181975709 GACTCAGGCACAGTGCGCAGTGG + Intergenic
984926011 4:184807599-184807621 GAGACAGGCATAGCGAGGCAGGG + Intronic
988225348 5:28405127-28405149 GAGCCAGGCATAGAGCGGCAAGG - Intergenic
1002638973 5:180621644-180621666 TACTCAGGCTGAGCGTGGCGTGG + Exonic
1004497751 6:16180829-16180851 GACGCAGGCATGGCGGGGTGCGG + Intergenic
1012231047 6:96761912-96761934 GAGTCAGGCATGGAGCGGCAAGG + Intergenic
1017054630 6:150425792-150425814 GAGTCAGGCATGGAGCAGCGAGG - Intergenic
1017719784 6:157236310-157236332 CACCCAGGCGGAGCGCGGCGGGG + Intergenic
1035252261 7:157605151-157605173 GAGTCAGGCATGGAGTGGCGAGG + Intronic
1049563471 8:143325123-143325145 GTCTCAGCCATAGCAAGGCGAGG + Intronic
1049724934 8:144141439-144141461 GACTGAGGCATAGAGGGGCAAGG + Intergenic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1052576603 9:30299521-30299543 GGCTCAGGCATAGCGGGCTGTGG - Intergenic
1061242656 9:129383460-129383482 GACCCCGGCAAAGCGCGGCTGGG - Intergenic
1062468965 9:136693943-136693965 GACTCAGGCAGGGTGCGGCAGGG - Intergenic
1062646331 9:137550501-137550523 GAGCCAGGCCCAGCGCGGCGGGG + Exonic
1188811399 X:34657272-34657294 GGCGCTGGCAGAGCGCGGCGCGG - Exonic