ID: 952942270

View in Genome Browser
Species Human (GRCh38)
Location 3:38454015-38454037
Sequence CGACTCAGGCATAGCGCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 25}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952942270_952942282 14 Left 952942270 3:38454015-38454037 CCCGCCGCGCTATGCCTGAGTCG 0: 1
1: 0
2: 0
3: 4
4: 25
Right 952942282 3:38454052-38454074 CGTGCCCCGCCGCCGCCCCCCGG 0: 1
1: 1
2: 7
3: 62
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952942270 Original CRISPR CGACTCAGGCATAGCGCGGC GGG (reversed) Exonic
900366745 1:2314737-2314759 CGAGTCAGGCGGAGCGCGCCGGG + Intergenic
907069169 1:51518890-51518912 CGGCACCGGCAGAGCGCGGCCGG + Intronic
1077229845 11:1453851-1453873 AGACTCAGGCAGAGCGCGCCTGG - Intronic
1090352010 11:126113831-126113853 TGACTCAGGCAGAGAGCAGCAGG + Intergenic
1092182996 12:6458800-6458822 AGCCTCAGGCAAAGCGTGGCAGG + Exonic
1092237154 12:6817408-6817430 CAACTCAGGCATTGGGAGGCCGG - Intronic
1123427525 15:20184270-20184292 GGACGCAGGGAGAGCGCGGCTGG + Intergenic
1123536761 15:21190820-21190842 GGACGCAGGGAGAGCGCGGCTGG + Intergenic
1129295320 15:74596943-74596965 CGACTCAGGGATCGCGGGGGCGG + Exonic
1136856769 16:33665539-33665561 GGACGCAGGGAGAGCGCGGCTGG - Intergenic
1141563938 16:84888619-84888641 TGAGTCAGGCAGAGCGTGGCAGG - Intronic
1153024046 18:657732-657754 GGCCACAGGCATGGCGCGGCGGG - Exonic
1157275929 18:46311194-46311216 GGACTCAGGCCTAGGGCGGGCGG - Intergenic
926101436 2:10120730-10120752 TGACTCAGGTTTAGCGCGGGAGG + Intergenic
1179597504 21:42452597-42452619 GCACTCAGGCATAGCGCGAATGG + Intergenic
951837170 3:26996253-26996275 CGAAGCAGGCATAGAGCAGCAGG - Intergenic
952942270 3:38454015-38454037 CGACTCAGGCATAGCGCGGCGGG - Exonic
966866551 3:184261567-184261589 CGACTGCGGCAGAGCACGGCGGG + Intronic
981033990 4:140152132-140152154 CGACTCGGGGCTAGCCCGGCAGG - Intronic
984926010 4:184807598-184807620 AGAGACAGGCATAGCGAGGCAGG + Intronic
986152513 5:5140371-5140393 CGACCCAGGCAGAGCGCGGGAGG - Exonic
1009752151 6:67887714-67887736 GGACCCAGGCATAGCCAGGCGGG - Intergenic
1010794823 6:80106724-80106746 CTACTCAGGCTCAGGGCGGCAGG + Exonic
1010806481 6:80243026-80243048 CGACTCAGGCATAGAGCATCAGG + Intronic
1017719783 6:157236309-157236331 CCACCCAGGCGGAGCGCGGCGGG + Intergenic
1030278371 7:107743973-107743995 GGACTCAGGCATAGTTCGGGCGG - Exonic
1049844176 8:144792148-144792170 CGACTCACGATTAGCGCGGCCGG + Intronic
1061242657 9:129383461-129383483 GGACCCCGGCAAAGCGCGGCTGG - Intergenic
1062468966 9:136693944-136693966 TGACTCAGGCAGGGTGCGGCAGG - Intergenic
1193339973 X:80335768-80335790 GGTCTAAGGGATAGCGCGGCTGG + Intronic