ID: 952943182

View in Genome Browser
Species Human (GRCh38)
Location 3:38458630-38458652
Sequence TACCCTGAGCTCCCAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952943182_952943183 -4 Left 952943182 3:38458630-38458652 CCTCTGCTTGGGAGCTCAGGGTA 0: 1
1: 0
2: 1
3: 17
4: 144
Right 952943183 3:38458649-38458671 GGTAGTGCAAATGAGAACCAAGG 0: 1
1: 0
2: 2
3: 10
4: 187
952943182_952943187 29 Left 952943182 3:38458630-38458652 CCTCTGCTTGGGAGCTCAGGGTA 0: 1
1: 0
2: 1
3: 17
4: 144
Right 952943187 3:38458682-38458704 CAGGAGTTTAGATCCACTCACGG 0: 1
1: 0
2: 0
3: 15
4: 178
952943182_952943184 4 Left 952943182 3:38458630-38458652 CCTCTGCTTGGGAGCTCAGGGTA 0: 1
1: 0
2: 1
3: 17
4: 144
Right 952943184 3:38458657-38458679 AAATGAGAACCAAGGAGTATCGG 0: 1
1: 0
2: 1
3: 26
4: 297
952943182_952943185 10 Left 952943182 3:38458630-38458652 CCTCTGCTTGGGAGCTCAGGGTA 0: 1
1: 0
2: 1
3: 17
4: 144
Right 952943185 3:38458663-38458685 GAACCAAGGAGTATCGGTTCAGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952943182 Original CRISPR TACCCTGAGCTCCCAAGCAG AGG (reversed) Intronic
900670449 1:3850573-3850595 TGCCCTGAGCTCCGACGTAGAGG + Intronic
904264383 1:29310038-29310060 TCCCCAGAGCCCCCAAGCTGAGG - Intronic
906680509 1:47722927-47722949 TAAACGGAGGTCCCAAGCAGGGG + Intergenic
907789029 1:57643269-57643291 GCCCCTGACCTCTCAAGCAGAGG - Intronic
908249155 1:62251573-62251595 CACCCTGTGTTCTCAAGCAGAGG + Intronic
908414391 1:63898793-63898815 TTCCCTGACCTCCTAGGCAGGGG - Intronic
908732389 1:67239375-67239397 TACCTTGGCCTCCCAAGTAGCGG + Intronic
915026668 1:152837241-152837263 TGCCCTCAGCTCAAAAGCAGTGG - Intergenic
915288303 1:154866872-154866894 TTCCCTGAGCTCCCCCTCAGGGG + Intronic
916428241 1:164702313-164702335 TACCCTGAGCTCACATTCATGGG + Intronic
916586725 1:166155879-166155901 CAGCCTGAGCCCCCATGCAGAGG + Intronic
917079039 1:171237587-171237609 CACACTGAGCTCCCTGGCAGAGG + Intergenic
917697682 1:177543577-177543599 TCCCCTCAACTCCCTAGCAGAGG - Intergenic
918943147 1:191027109-191027131 CACACTAAGCTCCCAGGCAGGGG + Intergenic
920705532 1:208248010-208248032 CACCCTTGGCTCCCAAGCACAGG - Intergenic
923035518 1:230282472-230282494 GACCCTGTGCTCCAAACCAGGGG + Intergenic
923087393 1:230711965-230711987 TACCCTGAGACCCCCAGAAGAGG + Intronic
1062925992 10:1315632-1315654 TACCCTGGCCTCCCAGGGAGGGG + Intronic
1065989167 10:30991204-30991226 TCCCCTCAGCTCCCAAGCTGGGG + Intronic
1069981933 10:72258796-72258818 TACCCTGAATTCTCCAGCAGGGG + Intergenic
1070581056 10:77719831-77719853 TACAATGGGGTCCCAAGCAGAGG + Intergenic
1072627669 10:97123902-97123924 AAGCCTCAGCTCTCAAGCAGAGG + Intronic
1074192541 10:111150333-111150355 TACCATGAGATAACAAGCAGGGG - Intergenic
1075420099 10:122294321-122294343 TCAGCTGAGCTCCCAGGCAGTGG + Intronic
1075781167 10:125018125-125018147 TACCCTGAGTCCCACAGCAGGGG - Intronic
1075908532 10:126103972-126103994 TACAGTGAACTGCCAAGCAGTGG + Intronic
1077554108 11:3217805-3217827 TACCCTGAGCACCCAAGGGCTGG - Intergenic
1077633641 11:3827347-3827369 TACCCAGTGTTCCCAAGCAGAGG + Exonic
1085510962 11:77088008-77088030 CACCCTGAGCTCCCAGGCCTGGG - Intronic
1086131134 11:83403760-83403782 TACCCTTACCTTCCTAGCAGTGG + Intergenic
1087430603 11:98048285-98048307 TAACCTCAGCTCACAACCAGAGG + Intergenic
1088903468 11:114136285-114136307 CACCCTCAGCCCCCAAACAGTGG - Intronic
1096543289 12:52320657-52320679 TGCCCTGAGCGCCCACACAGTGG + Intronic
1096628184 12:52907809-52907831 AACCCTGAAGTCCCAGGCAGGGG - Intronic
1096692899 12:53332087-53332109 ACCCCTGATCTTCCAAGCAGCGG + Intronic
1101235006 12:102779720-102779742 TACCTTTAGGTCCCAAGAAGAGG - Intergenic
1104637363 12:130446727-130446749 TAACCTGATCTCACAAGCTGTGG + Intronic
1106112467 13:26789126-26789148 TACCCTGAGACCGAAAGCAGGGG + Intergenic
1106135051 13:26967629-26967651 GACCCTGAGCTCCGCAGCTGGGG + Intergenic
1108698763 13:52925996-52926018 GACCCTGAGCCGCCAAGCCGAGG - Intergenic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1113704018 13:112413919-112413941 TTCCCTGAGGCCCCAACCAGAGG - Intronic
1113905014 13:113815159-113815181 TCACAAGAGCTCCCAAGCAGAGG + Exonic
1114684552 14:24516086-24516108 TACCAGGAACTCCAAAGCAGAGG - Intergenic
1119740739 14:77012312-77012334 TTCCCTGGGCACCCAAGCTGAGG + Intergenic
1121158509 14:91711032-91711054 TACGCTGAGCCCCTAATCAGTGG - Intronic
1123574956 15:21656820-21656842 TTCCCTGCTCCCCCAAGCAGGGG + Intergenic
1123611571 15:22099309-22099331 TTCCCTGCTCCCCCAAGCAGGGG + Intergenic
1125364689 15:38901464-38901486 ATGCCTAAGCTCCCAAGCAGTGG + Intergenic
1128217739 15:65945851-65945873 TACCCGCAGCTCACAGGCAGGGG + Intronic
1129658201 15:77538654-77538676 TTCCCTGACCTCCCAAGCCTGGG - Intergenic
1132002488 15:98194053-98194075 TTCCCTGACCTCCCCAGGAGAGG + Intergenic
1202983824 15_KI270727v1_random:391064-391086 TTCCCTGCTCCCCCAAGCAGGGG + Intergenic
1132603738 16:785077-785099 GACCCACAGCTCCCAAGCTGGGG + Exonic
1132849394 16:2017960-2017982 TACCCTGTTCCCCCAAGCTGAGG + Intronic
1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG + Intronic
1134317003 16:13127811-13127833 GAGCCAGAGCTCCCAAGCACAGG + Intronic
1135136815 16:19891064-19891086 GACCATGAGGTCCCAAGCAGAGG - Intergenic
1135771456 16:25221274-25221296 TTCCCTGAGATGCCAGGCAGAGG - Intronic
1137744044 16:50807834-50807856 TTCCCCCACCTCCCAAGCAGAGG - Intergenic
1141663111 16:85452383-85452405 TGCCCTGAGCTGCCAGACAGAGG - Intergenic
1141875400 16:86820653-86820675 CACCCTGTGCTTCCAACCAGGGG - Intergenic
1144762155 17:17713256-17713278 TGCCTTGGCCTCCCAAGCAGTGG - Intronic
1145711767 17:26984632-26984654 TACCCTGAGTTACATAGCAGGGG + Intergenic
1148581855 17:48749823-48749845 TACCCCTTCCTCCCAAGCAGAGG + Intergenic
1150543060 17:66123345-66123367 TCCCCTGAGCTCCCAATCAAGGG - Intronic
1156348596 18:36283196-36283218 GACCCTGAGCTCGTAAGTAGTGG + Intergenic
1157402305 18:47398744-47398766 GACCATGAGCTCCCAGGCATTGG + Intergenic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1161058039 19:2200409-2200431 TGCCCTGAGCTCCCAGGCCTGGG - Intronic
1161981906 19:7634250-7634272 TTCCCTCAGTGCCCAAGCAGGGG + Intronic
1163699238 19:18778892-18778914 GACCCTGAGCTGCCAAGAAGGGG - Exonic
1164452447 19:28378466-28378488 GACCCTGAGCTCCCAGGCCAGGG + Intergenic
1164634745 19:29784305-29784327 TAGGCAGAGCTCCCAAGAAGAGG - Intergenic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1167341450 19:48918864-48918886 TTCACTGAGCTCCCATCCAGGGG - Intronic
1167469123 19:49665671-49665693 TACCCGGAGCTCCAAGACAGGGG - Exonic
925029982 2:642989-643011 GACCCTGAGCCCCCAAGCTCTGG + Intergenic
925913156 2:8586542-8586564 CCCCAGGAGCTCCCAAGCAGGGG + Intergenic
928359816 2:30654149-30654171 CTCACTGAGCTCCCAACCAGTGG - Intergenic
932907336 2:75768091-75768113 TTCCCTGAGCTCCCTGTCAGAGG + Intergenic
935061113 2:99608615-99608637 GACCCTCAGCTCCCCAGCCGAGG + Intronic
935831242 2:107002812-107002834 TAACCTGAGCTCTCAAGAAGAGG - Intergenic
939515606 2:143163995-143164017 TGCCTTGACCTCCGAAGCAGAGG - Intronic
940851425 2:158691044-158691066 TTCCCTGTGCTCCCCAGCAGAGG - Intergenic
948519144 2:238524546-238524568 TCCCCTGAGATCCCAAGCAAAGG + Intergenic
948542376 2:238699730-238699752 TGCCCTGAGGTCCCCAGCAGAGG - Intergenic
948660955 2:239506135-239506157 TTCCCTGAGCCACCAAGCAGAGG + Intergenic
1169003681 20:2189133-2189155 TACCCCTAGCTCTGAAGCAGTGG - Intergenic
1170679626 20:18514456-18514478 TACCCTTCTCTCCCAACCAGAGG + Intronic
1172518578 20:35552997-35553019 TGCCCTGAGCTTCAAAGCTGGGG + Intronic
1173609471 20:44356006-44356028 TTCCCTAAGCTCTCAAGCCGGGG + Intronic
1180840697 22:18957617-18957639 TTCCCTGAGCCCCCAAACATGGG - Intergenic
1181060790 22:20281157-20281179 TTCCCTGAGCCCCCAAACATGGG + Intronic
1184716090 22:46282565-46282587 TGCACTTGGCTCCCAAGCAGGGG + Intronic
1184986430 22:48139304-48139326 TCCCCTGAGACCCCAGGCAGAGG - Intergenic
950006039 3:9691577-9691599 TGCAGTGAGCTCCCAAGCTGAGG + Intronic
950801344 3:15554165-15554187 TACTCAGAGTTCCCAAGAAGAGG - Intergenic
952070436 3:29627946-29627968 CACCATGTACTCCCAAGCAGAGG + Intronic
952943182 3:38458630-38458652 TACCCTGAGCTCCCAAGCAGAGG - Intronic
953674751 3:44992189-44992211 TGCCTTGAGCTCTCCAGCAGAGG - Intronic
953770957 3:45778260-45778282 CACACTGAGCACCCGAGCAGAGG - Intronic
955370267 3:58345157-58345179 TGCCCTGCTCTCCCAGGCAGAGG - Intronic
963812575 3:149793315-149793337 TTCCCTGGGCTGCAAAGCAGTGG - Intronic
966428252 3:179804212-179804234 GACTCTGAGTTCACAAGCAGGGG - Intronic
967413721 3:189194594-189194616 TACTCTGAGCTCCCACCCATGGG - Intronic
968938528 4:3626000-3626022 CACCCTCAGCAACCAAGCAGGGG - Intergenic
969560346 4:7942671-7942693 TAGCGTGAGACCCCAAGCAGAGG + Intergenic
974063358 4:57055063-57055085 GACCAGGAGCTACCAAGCAGAGG + Intronic
985399703 4:189582400-189582422 TCGCTTGAACTCCCAAGCAGAGG - Intergenic
986076848 5:4346798-4346820 TAAGCAGAGCTCCCAAGGAGGGG + Intergenic
986760568 5:10876297-10876319 ATCCCTTAGGTCCCAAGCAGAGG + Intergenic
987181026 5:15368551-15368573 TGCCCTGAGTTCCACAGCAGGGG + Intergenic
988536594 5:32074203-32074225 TCCACTGAGCTACCAAGAAGAGG - Exonic
990466414 5:56075834-56075856 GACCCTGGGGCCCCAAGCAGGGG + Intergenic
991440985 5:66649081-66649103 TACTCTGAACTCCCAACCAAGGG - Intronic
992906740 5:81354549-81354571 TACCCTGAGCTCCCTTGCGAGGG - Intronic
998729960 5:145063548-145063570 TACCTGGAGCTCCCAAACAAAGG - Intergenic
999153850 5:149444024-149444046 TGCCCTAACCCCCCAAGCAGTGG - Intergenic
999467950 5:151824667-151824689 TTCTCTGAGCTCCCAAGTATAGG + Intronic
1001869597 5:175139547-175139569 TGCCCTGGGCTCCAAAGCTGAGG + Intergenic
1005366748 6:25086126-25086148 TACTCTGAGCTTGCAAGCAGAGG - Intergenic
1007664416 6:43505906-43505928 GACCCTGAGCTGCCAAGGTGTGG - Exonic
1012989539 6:105911230-105911252 GACCCTGAGCTCCTGAGCAGAGG + Intergenic
1014798379 6:125749886-125749908 TACCCCAAGCTCCCGAGCTGCGG - Intronic
1015166821 6:130207987-130208009 TCCCCTGAGCTCTCACGCTGAGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1017949568 6:159125176-159125198 TGCCCTGTGCTCGCCAGCAGAGG + Intergenic
1018632764 6:165834965-165834987 GCCCCTGAGCTCCCAAGCCCTGG - Intronic
1018741771 6:166734489-166734511 TACTCTGTGCTCACAAGCAGCGG + Intronic
1023503102 7:40871794-40871816 TATCCTGAGCTCCCCCGAAGAGG - Intergenic
1024208597 7:47184796-47184818 TAACATGAAATCCCAAGCAGGGG + Intergenic
1025104152 7:56157138-56157160 GACACTTACCTCCCAAGCAGAGG + Intergenic
1025254593 7:57375012-57375034 TTCCCTGAGCTCCTGAGTAGAGG - Intergenic
1026860710 7:73786171-73786193 TAACCTGAGCTCCGGAGTAGAGG + Intergenic
1027857021 7:83524856-83524878 TCCACTGTGCTGCCAAGCAGAGG - Intronic
1029610265 7:101622874-101622896 TACCCTGTGCTCCCCAGCACAGG + Intronic
1032949914 7:136895883-136895905 TATCCCAAGCTCCCAGGCAGAGG - Intronic
1035389957 7:158497235-158497257 TTCCCTGGGCTGCCAAGCAAGGG + Intronic
1036746649 8:11414636-11414658 TAGCCTGGGCCCCCAAGTAGAGG - Intronic
1038397619 8:27258686-27258708 TACCCCCAGCTCGCAAGCTGTGG - Intergenic
1039987950 8:42463792-42463814 ATCCCTGAGCTGCCAGGCAGGGG - Intronic
1041175675 8:55193811-55193833 TACCCAGAGCTCCCAAACACTGG - Intronic
1042695173 8:71547676-71547698 GACCCTGAGTTCCCAGGCGGCGG - Intronic
1043482593 8:80668386-80668408 TCCCCTGAGCTCCCAGGCTGAGG + Intronic
1044297218 8:90543220-90543242 CACGCTGAGTTCCCCAGCAGTGG - Intergenic
1048355823 8:133653457-133653479 TCCTCTTAGCTCCCAAGCATCGG - Intergenic
1048882821 8:138884228-138884250 AACCCTGAGCTCCTCAGCAGGGG + Intronic
1048883988 8:138893894-138893916 TTCCCTGACCTCCCAAGCCCAGG - Intronic
1051055155 9:12976904-12976926 TCCCCTGAGCTCTAAGGCAGTGG + Intergenic
1051250218 9:15151652-15151674 CAACCTGAGGTCCCCAGCAGAGG + Intergenic
1054452213 9:65409336-65409358 CACCCTCAGCAACCAAGCAGGGG + Intergenic
1054895132 9:70302010-70302032 TTCCCTGAACTCACAAACAGAGG + Intronic
1056008785 9:82303135-82303157 TTCCCTGTGCGGCCAAGCAGTGG - Intergenic
1059165605 9:112073777-112073799 TGCCCCGACCTCCCAAGTAGCGG - Intronic
1060058657 9:120439112-120439134 TACCCTGAGCCCCCAACTTGAGG + Intronic
1062395766 9:136351978-136352000 TTCCCTGAGGACCCCAGCAGAGG - Intronic
1187578787 X:20586473-20586495 CTCCCTGAGCTCTCAAGGAGGGG - Intergenic
1190304729 X:49075531-49075553 TACCCTGTGCTCACCAGTAGAGG + Exonic
1192310917 X:70013369-70013391 TACTCTGAGATCCCAAGTTGGGG - Intronic
1193943541 X:87705754-87705776 GTCCTTGAGCTCCCAGGCAGAGG + Intergenic
1197648467 X:129041463-129041485 GACCCTGAGCTGCCAAGGTGTGG + Intergenic
1200042464 X:153379959-153379981 TGCCCTGAGCTCCTAACCCGGGG + Intergenic