ID: 952943450

View in Genome Browser
Species Human (GRCh38)
Location 3:38460117-38460139
Sequence CCCCAAAAACAGATGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952943450_952943454 -10 Left 952943450 3:38460117-38460139 CCTAGTTCCATCTGTTTTTGGGG 0: 1
1: 0
2: 0
3: 16
4: 187
Right 952943454 3:38460130-38460152 GTTTTTGGGGTCTTTACAAAGGG 0: 1
1: 0
2: 4
3: 16
4: 234
952943450_952943455 -9 Left 952943450 3:38460117-38460139 CCTAGTTCCATCTGTTTTTGGGG 0: 1
1: 0
2: 0
3: 16
4: 187
Right 952943455 3:38460131-38460153 TTTTTGGGGTCTTTACAAAGGGG 0: 1
1: 0
2: 0
3: 10
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952943450 Original CRISPR CCCCAAAAACAGATGGAACT AGG (reversed) Intronic
901191107 1:7410284-7410306 CCCCAAAAACTGGTGGACATGGG + Intronic
902669710 1:17964594-17964616 CCTTAAAGACAGATGGACCTAGG - Intergenic
903345555 1:22681953-22681975 CGACAAAAACAGATGGCACCTGG + Intergenic
906003819 1:42451305-42451327 CAGCAAAAACAGACAGAACTGGG - Intronic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909099345 1:71331813-71331835 CACCCAAAACAGTGGGAACTGGG - Intergenic
909120790 1:71600855-71600877 ACCCATAAACAGCTGGAATTAGG - Intronic
909804736 1:79859629-79859651 CCCCAAAAAACAATGGATCTAGG + Intergenic
910718885 1:90263179-90263201 CCCCACAAACATTTGAAACTTGG + Intergenic
913194946 1:116448524-116448546 CCCGAAAAGAAGATAGAACTAGG - Intergenic
913509748 1:119550963-119550985 CCCCAAAAGCAGGGGGCACTGGG + Intergenic
914850376 1:151309728-151309750 CTCCAAAAACAAATAGGACTTGG - Intronic
915450111 1:155998943-155998965 TACCAAAAACAGATGGAAGGGGG - Intronic
920728967 1:208464721-208464743 CCCCAAGAAGAGATGCAACAAGG - Intergenic
921777666 1:219121217-219121239 CCGCAATAACAGATAGCACTTGG - Intergenic
923018195 1:230143011-230143033 CCCTAAAAACAGTTTGAACCAGG - Intronic
923018532 1:230145462-230145484 CAACAAAAACAGAGGGAAATGGG - Intronic
924141250 1:241026202-241026224 CCTCACACACAGAGGGAACTCGG + Intronic
1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG + Exonic
1064782137 10:18853802-18853824 CCCTAAAATAACATGGAACTAGG - Intergenic
1067177588 10:43960888-43960910 CTCCAAACACAGATGGTCCTGGG + Intergenic
1067518879 10:46979634-46979656 CACAAAAAAGAGATGGAATTTGG + Intronic
1067643368 10:48072200-48072222 CACAAAAAAGAGATGGAATTTGG - Intergenic
1067729202 10:48797017-48797039 CCCCACAGCCAGATGGGACTGGG + Intronic
1070127491 10:73633960-73633982 CCCCAGCAAAAAATGGAACTTGG - Exonic
1070532391 10:77348476-77348498 TCCCAAAAAAAGATGGAACCAGG + Intronic
1070537973 10:77393562-77393584 CCCCTGAGACAGATGGAGCTGGG + Intronic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1074196682 10:111194384-111194406 CCGCAAAAACAGAAGCAAATGGG - Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075153052 10:119952537-119952559 CCCAAAAAAGAGATGTGACTGGG - Intergenic
1076203981 10:128580606-128580628 CCTCAAAAATAGAAGAAACTTGG + Intergenic
1079626669 11:22625137-22625159 CCCCAAGAAGAGTTGGAACCCGG - Exonic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1081645978 11:44791123-44791145 CCCCAAACTCAGAGGGAACGGGG - Intronic
1081880714 11:46448952-46448974 CTCCTAAAACAGAAAGAACTGGG + Intronic
1081981281 11:47268915-47268937 CCCCACAAACGGATGGGCCTGGG + Intronic
1084042964 11:66553256-66553278 CCCAAAAAATAGATGCAGCTGGG + Intronic
1084708458 11:70829526-70829548 CCCCCAAACCAGATGGGACATGG - Intronic
1087218617 11:95521595-95521617 CCCAACAAACACATGGATCTGGG - Intergenic
1088063692 11:105689190-105689212 CACCAAGAAGAGATGGAATTTGG + Intronic
1088191776 11:107235395-107235417 GGCCAAAGACAGATGGATCTTGG - Intergenic
1089719562 11:120402145-120402167 CCTCAGAAACAAATGTAACTGGG - Intronic
1090543072 11:127730201-127730223 CTCCAAAAACATATGTAATTAGG + Intergenic
1091038163 11:132252438-132252460 CCCCAAAAAAGGGTGGAAATGGG + Intronic
1092343398 12:7695418-7695440 CCAGAAAAACATCTGGAACTGGG - Intronic
1093093264 12:14944366-14944388 CCCCAGATACACATGGCACTGGG + Intronic
1094743543 12:33316527-33316549 CCCAAAACACTGATGGAAATTGG - Intergenic
1095650364 12:44600614-44600636 CCCCAAAAAGAGAAAGATCTTGG + Intronic
1096856082 12:54484222-54484244 CCACAAAAACACTTGCAACTGGG - Intergenic
1097150765 12:56978314-56978336 CCCCTAAAGCAGATACAACTTGG - Intergenic
1098998831 12:77152864-77152886 CCCCAACAACAGATACAGCTTGG - Intergenic
1099982718 12:89625286-89625308 CCCCAAAAATAGAGGCAGCTGGG + Intronic
1100694942 12:97082457-97082479 GCCCAACAACACATGCAACTGGG - Intergenic
1102205023 12:111084298-111084320 CCCTAGAAACAGATGGTACTTGG - Intronic
1103826348 12:123742201-123742223 CACAAAAAGCAGCTGGAACTGGG - Intronic
1104824031 12:131695652-131695674 CCCCCCACACAGATGTAACTTGG + Intergenic
1106050810 13:26187714-26187736 CCCCAAAATCAAATAGAGCTGGG - Intronic
1108247963 13:48536042-48536064 CCCCAAAAGCAGAAGTAATTAGG - Intergenic
1111299947 13:86335967-86335989 TCCCAAAGAAACATGGAACTGGG + Intergenic
1111690138 13:91553511-91553533 CCTCATATACAGATTGAACTGGG - Intronic
1112727062 13:102316997-102317019 GCCCAAAAAAAGATGGAAAATGG - Intronic
1116327742 14:43553434-43553456 TCCCAAAAAAAAATGTAACTAGG + Intergenic
1117036947 14:51739873-51739895 CCCCAAAAACAGGGGGAAGATGG + Intergenic
1117741285 14:58821732-58821754 CATCAGAACCAGATGGAACTGGG - Intergenic
1119607514 14:76033422-76033444 CCTCCAAAACAGACGGAGCTTGG + Intronic
1127892313 15:63264859-63264881 GAACCAAAACAGATGGAACTGGG - Exonic
1128654021 15:69445879-69445901 CCACAAAATCAGATGGTACTTGG - Intronic
1129279888 15:74476234-74476256 TCTCAAAAGAAGATGGAACTTGG + Intergenic
1133574968 16:7080185-7080207 TCCCAAAAACAAATGGGAATGGG - Intronic
1134072398 16:11268935-11268957 CCCCAAGAACAGAAAGAACTTGG - Exonic
1134626987 16:15729269-15729291 CCCCACAAGCAGATGGAACCAGG + Intronic
1135474496 16:22762372-22762394 CCCAGAAAACAGATGGAGTTTGG + Intergenic
1137009826 16:35311226-35311248 ACCCACAGACTGATGGAACTGGG - Intergenic
1138182553 16:54951794-54951816 CATCAAAAACATATGGACCTGGG - Intergenic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1141827104 16:86488267-86488289 CCCCAAAAACAGGTGGAAGAGGG - Intergenic
1144578179 17:16443064-16443086 CCCCTAGCATAGATGGAACTGGG + Intronic
1146392084 17:32431863-32431885 CCCCAAAAGCAGATGCCACATGG - Intergenic
1149546219 17:57505708-57505730 CCCCAAACCAAGATGGCACTCGG - Intronic
1153317243 18:3736373-3736395 CCCTAAAAACAGATTGTGCTTGG - Intronic
1157154152 18:45248563-45248585 CCCGACAAGCAGTTGGAACTTGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1160061785 18:75535419-75535441 TCCCAGAAACAAATGGCACTGGG + Intergenic
1162311782 19:9912491-9912513 CCCCCCAAACAGATGGAACAGGG + Intronic
1166313131 19:41974453-41974475 CCCCAAAAAAAGATGTCTCTTGG + Intronic
1166627576 19:44373208-44373230 CCCAAAAAACAGATTCAAATTGG - Intronic
927158849 2:20239801-20239823 TGCCAAAACCAGAAGGAACTGGG + Intergenic
928231890 2:29505497-29505519 CCCCAGAACCTGATGGAACCAGG - Intronic
935155646 2:100481478-100481500 CCCCAAAAACACATGGCAGGAGG + Intronic
936774206 2:115953377-115953399 TCCAGAAAGCAGATGGAACTTGG + Intergenic
937299566 2:120830759-120830781 CCCAGAAAACAGAGGGAACATGG - Intronic
939092644 2:137797363-137797385 CCCCAAAGAGAGAAGAAACTGGG - Intergenic
943702299 2:190999817-190999839 CCCCAAAAAGAGATCTGACTTGG + Intronic
944338466 2:198566020-198566042 CCCCAGAAACAGATGCTGCTAGG + Intronic
944992084 2:205249421-205249443 CCAGACCAACAGATGGAACTTGG - Intronic
945148273 2:206761724-206761746 CCACTACAACAGATGGAATTGGG + Intronic
946284734 2:218694403-218694425 CTCCAGAAACAGATGCAAATTGG - Intronic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1168851440 20:979750-979772 CCCCAAATGCAGAAGGAGCTGGG - Intronic
1168990568 20:2092248-2092270 CACTAAAAAGCGATGGAACTTGG - Intergenic
1173286555 20:41676576-41676598 CCCCCAAAACTGCTGGAAGTAGG + Intergenic
1173345806 20:42199016-42199038 TCCCCAAATCAGATGGAAATGGG - Intronic
1175749158 20:61483308-61483330 CCACAAACACAGATCAAACTGGG - Intronic
1177989222 21:28018394-28018416 CCCCACAAGCAGCTGGCACTGGG + Intergenic
1182058915 22:27382628-27382650 TCCCACACACAGATGGACCTTGG - Intergenic
1182239409 22:28903117-28903139 CCCAGGAAACAGAGGGAACTGGG - Intronic
1182489681 22:30663097-30663119 CCCCAAAAACAGATTGACCCAGG - Exonic
1183056265 22:35308052-35308074 CCCCAGAACAAGAGGGAACTTGG + Intronic
950225385 3:11229296-11229318 CCCCAAAAACTGAAAGAACCTGG + Intronic
951992649 3:28692823-28692845 CACCAAAAACAAATGGTCCTGGG - Intergenic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
956835461 3:73092777-73092799 CTCCAAAAGCAGATGGAAGTTGG - Intergenic
957194587 3:77051111-77051133 GCCCAAAACCAGATTTAACTGGG + Intronic
957617983 3:82556227-82556249 CCTCGAAAACAGAAGGGACTGGG + Intergenic
958692413 3:97484748-97484770 AGCCAAGAACAGAAGGAACTTGG - Intronic
959659559 3:108851164-108851186 CCACAAAAGCATAAGGAACTAGG + Intronic
961541241 3:127600848-127600870 CCACAAAAACAAATGTAATTGGG - Intronic
961776964 3:129294550-129294572 CCCAAAAGACAGGAGGAACTGGG - Intronic
962490344 3:135887522-135887544 ACTCACAAACAGATGGGACTAGG + Intergenic
963552954 3:146747728-146747750 CACCAAACACAGATGGAAACTGG - Intergenic
963843443 3:150131080-150131102 GCCCAAGAACTGGTGGAACTGGG + Intergenic
964786007 3:160397616-160397638 ACCTAAAAAATGATGGAACTTGG + Intronic
965756687 3:172034801-172034823 CCCCAGAAGCAGATGCCACTAGG - Intergenic
972327606 4:38032319-38032341 CCCCAAAAAAAGAAAGAAATGGG + Intronic
972589893 4:40475548-40475570 CCCCAAAAAAATTTGGAAGTTGG - Intronic
973084797 4:46044568-46044590 TACAAAAAACAGATGGAAATAGG + Intronic
974624226 4:64400809-64400831 CCCCAGAAGCAGATGCCACTAGG + Intronic
978759495 4:112341014-112341036 CCCAGCAAACACATGGAACTGGG + Intronic
979630559 4:122897832-122897854 CCCCAAAAAAAGAAGAAACGAGG - Exonic
980037236 4:127899433-127899455 CCACAAAAACACATGGACCTAGG - Intergenic
980822970 4:138040139-138040161 CTCCATCATCAGATGGAACTGGG - Intergenic
981694045 4:147541696-147541718 TCACACAAACAGATGAAACTCGG + Intronic
981800950 4:148654893-148654915 CCCCAGAAACATATGAAGCTAGG + Intergenic
982139418 4:152303896-152303918 CCATAAAAACCAATGGAACTTGG - Intergenic
982807729 4:159787524-159787546 CCCCAAAGACAGAAGAAATTAGG - Intergenic
983064424 4:163192609-163192631 CCCCAAAGACAGAGGTCACTGGG - Intergenic
984814810 4:183826212-183826234 GACCAAAACCAGATGGAACCTGG - Intergenic
985554234 5:548447-548469 CCCCAAAGAGAGAGGGCACTCGG + Intergenic
986054415 5:4121632-4121654 CAGCAATAACAGATGGAAGTTGG - Intergenic
988428890 5:31095772-31095794 CCACAAAACTAGTTGGAACTTGG + Intergenic
990086314 5:51982525-51982547 TCTCAAAAAGAGATGGAACAGGG + Intergenic
991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG + Intronic
996907425 5:128616919-128616941 ACCTGAAAAGAGATGGAACTGGG - Intronic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
1000410252 5:160929859-160929881 CACCAAAGACAGAGGCAACTTGG - Intergenic
1001302869 5:170549811-170549833 CCACAGAAATAGAAGGAACTTGG + Intronic
1001330201 5:170756607-170756629 CCCCAAAAACAAATTGAAAAGGG + Intergenic
1003733118 6:8848406-8848428 CTCCAAAAACAGGTGGATCTTGG - Intergenic
1006851767 6:37103495-37103517 CCCCACAAACAGGTGCAGCTGGG - Intergenic
1010425363 6:75723228-75723250 CCCCAAAAAAAGATTGATTTTGG + Intergenic
1011270674 6:85576709-85576731 CCCCAGAAACACATGGAAGCAGG - Intronic
1012616921 6:101288811-101288833 CCCCAAAATCAACTCGAACTAGG + Intergenic
1012820692 6:104082018-104082040 TGCAAAAAACAGATGGATCTTGG + Intergenic
1013784464 6:113764334-113764356 CAGCAACAACAGATGGAAATGGG + Intergenic
1013793131 6:113858155-113858177 CCCCAAACACAAATGAAACCTGG - Intronic
1014424277 6:121285433-121285455 CCCCAAAAACCTAAGGGACTGGG - Intronic
1014925848 6:127268451-127268473 CCCTAAAAACACATGAAAATAGG + Intronic
1015402985 6:132807618-132807640 GACCAAAAGCAGACGGAACTAGG - Intergenic
1017661808 6:156682229-156682251 CCACTAATACAGATGAAACTTGG + Intergenic
1019454743 7:1120991-1121013 CCCCAAAAACGAATGGACATGGG + Intronic
1019584010 7:1786686-1786708 CCCAAATAACAAATAGAACTTGG - Intergenic
1019791296 7:3015622-3015644 CCCCAGCAACATATGGATCTGGG + Intronic
1019840238 7:3434741-3434763 CCCCAAAAGCAGATAGGCCTGGG - Intronic
1022325785 7:29331045-29331067 GCCCAAAAGGAGAGGGAACTTGG - Intronic
1024916545 7:54506535-54506557 CCCCAAAAAAAGATGGAGTAAGG - Intergenic
1029942990 7:104499797-104499819 CCCCAAAACTATATAGAACTTGG + Intronic
1029961130 7:104690143-104690165 TGCCAAAGACAGATGGATCTTGG + Intronic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1035289427 7:157828105-157828127 CCCCACATGCAGATGGAGCTGGG + Intronic
1036112711 8:5921721-5921743 CCCCAAAAAAAGAGGGAAGGAGG + Intergenic
1037953469 8:23034850-23034872 TGCCAAAGACAGATGGATCTTGG + Intronic
1038251027 8:25904415-25904437 CCCCAAACACTGGTGGAACCTGG - Intronic
1038797288 8:30721225-30721247 CCCCAAAAAGAAAAGGACCTAGG + Intronic
1039665037 8:39517017-39517039 CTCCAAACACAGATGGGACTTGG - Intergenic
1041745191 8:61200927-61200949 CCCCAAAATCATATGGTACATGG - Intronic
1041964026 8:63653527-63653549 CCCCAATAACAGGAGGAAGTGGG - Intergenic
1042652041 8:71053613-71053635 CCACAAACTCAGATGGGACTAGG - Intergenic
1043755710 8:84000780-84000802 CCCCAATCACAGCTGGTACTTGG - Intergenic
1045148827 8:99379332-99379354 CGCCAAAAAAAAATGTAACTGGG - Intronic
1045363397 8:101453616-101453638 CACCAAAAAGAGATGCAACGTGG - Intergenic
1045779628 8:105848305-105848327 CCCCAAAGAGAGAAGGAACTCGG + Intergenic
1046152725 8:110249461-110249483 CCCCAATAACCTATGGAAATGGG + Intergenic
1047622591 8:126623054-126623076 CCCCAATAACACAGGGAAATGGG - Intergenic
1049159735 8:141089553-141089575 GCCCAGAGACAGACGGAACTGGG - Intergenic
1049377285 8:142295286-142295308 CTCCAGAGACAGATGGCACTTGG + Intronic
1052937938 9:34109153-34109175 ACCCAAAAACAGAAGGCTCTAGG + Intronic
1055410261 9:76021456-76021478 CCCCAAAAACTGAAGGCACGAGG + Intronic
1056255479 9:84795152-84795174 CTCCAAAGACAGAGGGAAGTGGG + Intronic
1057521262 9:95762402-95762424 GCCCTAAAGCAGTTGGAACTGGG + Intergenic
1058478874 9:105370531-105370553 CCCTAAAAGCAGATGGAATGGGG + Intronic
1058752816 9:108055478-108055500 CCCCAAACACAGCTCAAACTGGG - Intergenic
1059626303 9:116070502-116070524 CCCCAAAAACACATGTAATAAGG + Intergenic
1061225810 9:129280493-129280515 CCACAAACACAGATGGAAATCGG - Intergenic
1062450206 9:136612052-136612074 CCACAAAAACAGAAGAAATTCGG + Intergenic
1185782140 X:2857945-2857967 CCCTGAACACAGATGGAGCTAGG + Intronic
1185948129 X:4401099-4401121 CCCCAAAAAAAGAAGCAGCTGGG + Intergenic
1186692274 X:11990899-11990921 CCCAACAAACTGAAGGAACTTGG - Intergenic
1187267094 X:17744839-17744861 TCACAAAAACATATGGAATTGGG - Intronic
1187791080 X:22950962-22950984 ACCCAAAAATAGATGGGAGTTGG + Intergenic
1188754043 X:33938027-33938049 CCACAAAAACATAGGCAACTGGG - Intergenic
1190727952 X:53203721-53203743 CCCAAAAAACAGAAGCAACTTGG - Intronic
1196506433 X:116449768-116449790 ATTCAAAAACAAATGGAACTTGG + Intronic
1196821775 X:119707332-119707354 CCCAAAAAAAAGATGAAATTAGG - Intergenic