ID: 952944524

View in Genome Browser
Species Human (GRCh38)
Location 3:38468916-38468938
Sequence CATTCCTGGAAAACACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952944524_952944535 19 Left 952944524 3:38468916-38468938 CCTTCCAGTGTTTTCCAGGAATG 0: 1
1: 0
2: 3
3: 20
4: 224
Right 952944535 3:38468958-38468980 ATGTATTTCAGAGCTGTGGGAGG 0: 1
1: 0
2: 3
3: 19
4: 227
952944524_952944533 15 Left 952944524 3:38468916-38468938 CCTTCCAGTGTTTTCCAGGAATG 0: 1
1: 0
2: 3
3: 20
4: 224
Right 952944533 3:38468954-38468976 AGGCATGTATTTCAGAGCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 247
952944524_952944536 23 Left 952944524 3:38468916-38468938 CCTTCCAGTGTTTTCCAGGAATG 0: 1
1: 0
2: 3
3: 20
4: 224
Right 952944536 3:38468962-38468984 ATTTCAGAGCTGTGGGAGGATGG 0: 1
1: 0
2: 4
3: 40
4: 467
952944524_952944531 -5 Left 952944524 3:38468916-38468938 CCTTCCAGTGTTTTCCAGGAATG 0: 1
1: 0
2: 3
3: 20
4: 224
Right 952944531 3:38468934-38468956 GAATGATGGGGCCTGGAAAAAGG 0: 1
1: 0
2: 1
3: 27
4: 285
952944524_952944534 16 Left 952944524 3:38468916-38468938 CCTTCCAGTGTTTTCCAGGAATG 0: 1
1: 0
2: 3
3: 20
4: 224
Right 952944534 3:38468955-38468977 GGCATGTATTTCAGAGCTGTGGG 0: 1
1: 0
2: 0
3: 26
4: 208
952944524_952944537 30 Left 952944524 3:38468916-38468938 CCTTCCAGTGTTTTCCAGGAATG 0: 1
1: 0
2: 3
3: 20
4: 224
Right 952944537 3:38468969-38468991 AGCTGTGGGAGGATGGTGCCAGG 0: 1
1: 0
2: 2
3: 35
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952944524 Original CRISPR CATTCCTGGAAAACACTGGA AGG (reversed) Intronic
900634708 1:3657291-3657313 CATGCCTGGGAACCACAGGATGG - Intronic
901445925 1:9308127-9308149 ATGTCTTGGAAAACACTGGAAGG - Intronic
902074205 1:13769815-13769837 CATTTCTGGATCACACTCGACGG - Intronic
904027230 1:27512151-27512173 CATTGCTGGAAGAAACAGGAGGG - Intergenic
909957821 1:81801233-81801255 CCTTGCTGGAAAACTCAGGAGGG + Intronic
911103095 1:94109302-94109324 CATTGGTGGATATCACTGGAGGG + Intronic
914867254 1:151441857-151441879 AATTCATCGAAAACATTGGAAGG - Intronic
915521130 1:156444747-156444769 AATTCCTAGAAACAACTGGAGGG - Intergenic
916870778 1:168912489-168912511 AATTCCTTGAAAACAGTGCAAGG - Intergenic
918806924 1:189060016-189060038 CATTCCTTGAACATGCTGGAGGG + Intergenic
921160699 1:212470328-212470350 GATTGCTGGAAAACCCTCGAGGG + Intergenic
922391286 1:225146101-225146123 CCTTCCTGGAAACCACTAGTGGG + Intronic
923493146 1:234501990-234502012 AATTCCTGTAAAATACTGAAGGG + Intergenic
923573519 1:235137800-235137822 CCTTCCAGGAAAAGCCTGGAAGG + Intronic
1063054901 10:2494601-2494623 CCTTCCTGGAGGGCACTGGATGG - Intergenic
1063096746 10:2915439-2915461 CCTCTCGGGAAAACACTGGAAGG + Intergenic
1064701037 10:18022235-18022257 CATTCCTGGAAGACACGGAGAGG - Intronic
1068703649 10:60048325-60048347 CATTCCTGGGAACCATTTGATGG - Intronic
1068841891 10:61624724-61624746 AATTCCTGTAAAGCACTGGCAGG + Intergenic
1069254337 10:66313145-66313167 CATTCCCGTAAAACTCTGCATGG + Intronic
1069298584 10:66878135-66878157 CATTCATGGAAAAAAATGAAGGG - Intronic
1069462297 10:68607072-68607094 CATTCCTAGAAATCACAGAATGG - Intronic
1069821613 10:71231986-71232008 CATTCTTGGAAAGCCCTGCAAGG + Intronic
1071365476 10:84895658-84895680 CATTCTTAGAAATCACTGGTGGG - Intergenic
1071369346 10:84935354-84935376 CATTCCTGGAAAACAATGAGAGG + Intergenic
1072944611 10:99798565-99798587 CATTGCTGGGGAACACTAGAAGG - Intronic
1074032405 10:109701879-109701901 CATTCCTTGAAAATGATGGAGGG + Intergenic
1076174158 10:128353892-128353914 AATTTCTGAGAAACACTGGAAGG + Intergenic
1077067441 11:648643-648665 CATTCCTGGCAAACACTATTTGG - Intronic
1079292691 11:19202345-19202367 CCTTCCTGGAAATCATTGCAGGG + Intronic
1079851594 11:25542586-25542608 CATTTGTGAAAAACACTGGCAGG - Intergenic
1080987799 11:37491815-37491837 TCTGCCTGGAACACACTGGATGG + Intergenic
1082582640 11:54892066-54892088 TATCCCAGGAAAAAACTGGAAGG + Intergenic
1084225716 11:67713676-67713698 CATTCCTGGAGCCCACTGGGTGG - Intergenic
1084646094 11:70459420-70459442 CAGCCCTGGAAAACATTGCAAGG + Intergenic
1084903226 11:72325824-72325846 CATTTTTGGAAAACTCTGGGTGG + Intronic
1086131469 11:83406546-83406568 CAGTCCTGGAAAAGAGTGGTGGG - Intergenic
1087061209 11:93979611-93979633 CATTCCTTGAAAAAGGTGGAAGG + Intergenic
1087730936 11:101778058-101778080 CATTCCTTGAAAACATTGTAAGG - Intronic
1088394013 11:109347565-109347587 CTTTCCTGAAAAACACTGTGAGG - Intergenic
1089611106 11:119669721-119669743 CACTCCTGGCACACACTGCACGG + Intronic
1089795320 11:120975689-120975711 CATTCCTGGGAACCTCTAGAGGG - Intronic
1090164279 11:124531169-124531191 GAATCCTGGAAAACATTAGAAGG + Intergenic
1090482894 11:127083656-127083678 CATTCCCAGGAAAGACTGGATGG + Intergenic
1090771017 11:129919934-129919956 CATTTCTGGAAAGCCCAGGAGGG + Intronic
1092097779 12:5858094-5858116 CAGTGCTGCAGAACACTGGAAGG - Intronic
1093045558 12:14440052-14440074 AATTCTTGGAAAACTCTTGAAGG + Intronic
1093876860 12:24358630-24358652 CATTCTTGGAAGACAGTGAAAGG - Intergenic
1094662636 12:32485291-32485313 CATTCCTGGAAAAAAATGGAAGG + Intronic
1095485094 12:42676535-42676557 CACTCCTGGAAAACTCTTGGTGG - Intergenic
1096298278 12:50402438-50402460 CATTCCTTAAAAAAACTGGCTGG - Intronic
1102144889 12:110647697-110647719 CATTCTGGGAGCACACTGGAGGG + Intronic
1104087967 12:125493320-125493342 GATTCCTGGGAAATTCTGGAGGG - Intronic
1107589126 13:41883231-41883253 CATGCCTGGTAAAGAATGGAGGG + Intronic
1107844120 13:44493434-44493456 CATTCTTTGAAAACATTGAAAGG + Intronic
1108930893 13:55816797-55816819 CATACCTGTAAAACACATGAAGG - Intergenic
1109587145 13:64421107-64421129 TATTACTTGAAAAAACTGGATGG + Intergenic
1110726776 13:78834685-78834707 CATTGCTGGAACAGACTGGAAGG - Intergenic
1110863886 13:80373559-80373581 CATTCCTGAAAAATAATGAATGG - Intergenic
1112504291 13:99966339-99966361 AAATCCTGGAGAACACTGAAAGG - Intronic
1113818718 13:113195070-113195092 CATTATTGGCAAACACTCGAAGG + Exonic
1114043247 14:18699527-18699549 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114047538 14:18889973-18889995 CCATCCAGGAAAACACTGGCTGG + Intergenic
1114114985 14:19511672-19511694 CCATCCAGGAAAACACTGGCTGG - Intergenic
1114116676 14:19629435-19629457 CCATCCAGGAAAACACTGGCTGG - Intergenic
1114254595 14:20990581-20990603 AATTCCTGGAAAACCCAGGTAGG + Exonic
1115857510 14:37646850-37646872 CATTTCTGGAAAATACAGAATGG + Intronic
1116174622 14:41451555-41451577 CATTCAAAGAAAAAACTGGATGG + Intergenic
1118079922 14:62347019-62347041 CTTTCCTGGGCCACACTGGAAGG + Intergenic
1119834034 14:77731287-77731309 CCTGCCTGGAAGACACTGCAAGG + Intronic
1120161626 14:81151779-81151801 CATTTCTGGAATATATTGGAAGG + Intergenic
1121607865 14:95254403-95254425 CATTCCTGAGAAACACTAGATGG + Intronic
1122654515 14:103248807-103248829 CAATTCTGGAAAACACTGCAAGG - Intergenic
1124417523 15:29485498-29485520 CACTCCTGGAAAACACTAGAAGG + Intronic
1125156434 15:36592003-36592025 CATTCCTGCATGGCACTGGATGG - Intronic
1125422008 15:39513298-39513320 CATGCCTTGAAAACAATAGAAGG + Intergenic
1125925094 15:43556591-43556613 CATTCCTTAAAAACATTGTAAGG - Intronic
1128148813 15:65348461-65348483 TATTTCTGGCAAACAATGGAAGG + Intronic
1128300128 15:66561438-66561460 CATGCCTAGAAAGAACTGGATGG + Intronic
1128540466 15:68525345-68525367 CATTGCTGGAAAAGTCAGGAAGG + Intergenic
1129904741 15:79178535-79178557 ATTTCCTGGTAACCACTGGAGGG - Intergenic
1129951970 15:79599890-79599912 AATTCCTGCAAAACATTGTAGGG + Intergenic
1130740712 15:86596560-86596582 AATTCCTGGAAAACACCTGGTGG + Intronic
1131498242 15:92933937-92933959 CATACCTGTAACACAGTGGAAGG + Intronic
1131915163 15:97257263-97257285 CATTCCTAGAGAGCACTTGAGGG + Intergenic
1136587429 16:31196345-31196367 CTTACCTGGAAAACAATTGAGGG + Intergenic
1137321198 16:47384526-47384548 TATTTCTGGAACATACTGGAAGG + Intronic
1138209973 16:55155336-55155358 GAGTCCTGGAAAACATTGCATGG - Intergenic
1138558221 16:57785322-57785344 GTTTCCTGGAATACGCTGGAGGG - Intronic
1138823413 16:60288633-60288655 CATACCTCAAAAACACTAGAGGG + Intergenic
1138915588 16:61460090-61460112 AATTACTGGAACACACTGGTGGG + Intergenic
1140167241 16:72565157-72565179 CATAAAGGGAAAACACTGGAGGG + Intergenic
1140847296 16:78902748-78902770 CATTCTTAGAAGACAGTGGATGG - Intronic
1141091292 16:81132044-81132066 TAGTCCTGGAAAGCACTGGTTGG - Intergenic
1141322046 16:83020356-83020378 CATTCCTGGGAAACTCTTGGAGG + Intronic
1141674515 16:85510580-85510602 CTCTGCTGGAAAACACTGGAAGG + Intergenic
1143706197 17:8699126-8699148 CCCTCCTGGACCACACTGGAGGG - Intergenic
1144919277 17:18749992-18750014 CATTCCTGGAAAAAAAAAGATGG - Exonic
1146003621 17:29147150-29147172 CCTGCCTGGAAAACAATGGGAGG + Intronic
1147627000 17:41906789-41906811 CATGCCTTGAAGACACTTGATGG + Intronic
1148522603 17:48294880-48294902 CATTCCTGGAAAGAACTTTAAGG - Intronic
1148676498 17:49448650-49448672 CATTCCTGGTAACCCCAGGAGGG + Intronic
1149253441 17:54796621-54796643 CATTCCTGTATGAAACTGGAGGG - Intergenic
1149540884 17:57467305-57467327 CATTCTTGAAAAGCATTGGATGG + Intronic
1150587645 17:66532988-66533010 CACGGCTGGAAAATACTGGAAGG + Intronic
1150588032 17:66535925-66535947 CATGCCTGGAACATACTGAATGG + Intronic
1151757020 17:76080838-76080860 CACTCCTGGAAACCACCTGAAGG + Intronic
1151813841 17:76461260-76461282 CACTCCTGGAAAACAGAGGCTGG - Intronic
1153549655 18:6248300-6248322 CATTCTTGGATGACACAGGAGGG - Intronic
1153758019 18:8302806-8302828 CCATCCTGGATAATACTGGAAGG - Intronic
1154422714 18:14249032-14249054 CACTGCTGGAAAACACAGAAGGG - Intergenic
1157755571 18:50214280-50214302 GATTTGTGGAAAACCCTGGAGGG - Intergenic
1158376623 18:56877437-56877459 CATTCCTTGAAAACAGTTGAAGG - Intronic
1159838002 18:73363876-73363898 CATTCCTTGAAAACACTGTAAGG - Intergenic
1162688175 19:12405498-12405520 CATTCCTTGAAAACACAGTCAGG - Intronic
1162728320 19:12702818-12702840 CACTGCTGGAAAACACAGGTGGG - Exonic
1164151168 19:22552779-22552801 CTTACCTGGAAATCACTGAAAGG + Intergenic
1164507496 19:28871598-28871620 CATTCCTGGAGAATAAGGGAAGG - Intergenic
925321338 2:2971777-2971799 CATTCCAGGAAGAAATTGGAGGG - Intergenic
929168547 2:38907694-38907716 CTCTCCTGGGAAACGCTGGAGGG - Intronic
933717422 2:85371525-85371547 CCTTCATGGAAACCACTGGGAGG + Exonic
933863838 2:86498220-86498242 CATTGCTTGAAAACACTGTAAGG - Intergenic
936227932 2:110674798-110674820 CATGCCTGGATCCCACTGGAAGG - Intronic
936227949 2:110674884-110674906 CATGCCTGGATCCCACTGGAAGG - Intronic
938117780 2:128613521-128613543 CAGCCCTGGAAAGCCCTGGAAGG - Intergenic
938424914 2:131178495-131178517 CCATCCAGGAAAACACTGGCTGG + Intronic
939561774 2:143740881-143740903 TATTTCTGGAAAAAAATGGATGG - Intronic
940019540 2:149142352-149142374 CATTCCTGGAAAAAGCAAGATGG - Intronic
940321586 2:152383184-152383206 CCTCCCTTGGAAACACTGGAAGG + Intronic
944111760 2:196139795-196139817 TATTCCTGAAAAACAAGGGAGGG + Exonic
944611813 2:201417407-201417429 CATTCCTGGAAAAAACTACTTGG - Intronic
946083016 2:217142302-217142324 CACAGCTGGAAAACACTGAAAGG - Intergenic
946671883 2:222113867-222113889 CATTCTTGGCAAGCACTGAACGG + Intergenic
946950199 2:224865992-224866014 CATTTCGGGAAAACACTCGCTGG - Intronic
947080629 2:226391985-226392007 CATTCCGTGAAAACCCTGGAAGG + Intergenic
947138982 2:227003558-227003580 ATTTCCTGGAACACACTGAATGG + Exonic
947339513 2:229122633-229122655 CATTTGTGGAACACACTGAAGGG + Intronic
948718258 2:239880284-239880306 CACTCCTGGAAATCAGTGCATGG - Intergenic
948783716 2:240340257-240340279 CATCCCGGGCAGACACTGGAAGG - Intergenic
948862287 2:240758426-240758448 CAGTCCTCGATGACACTGGAGGG + Exonic
1170258089 20:14369168-14369190 GATTCCTTGAAAATACTGTAAGG - Intronic
1170317365 20:15057258-15057280 CAGTCCTGGAATAAAATGGAGGG - Intronic
1171152019 20:22835640-22835662 CATCCTTGAGAAACACTGGAGGG + Intergenic
1172357912 20:34292493-34292515 CCTTCCAGGCATACACTGGAGGG + Exonic
1173103088 20:40105753-40105775 TATTCCTAAAAAACACTGAAGGG - Intergenic
1173674764 20:44824115-44824137 CAGTCCTGGAAAAACCAGGATGG + Intergenic
1175416742 20:58806157-58806179 CATTGCAGAAAAACACAGGAGGG - Intergenic
1175707103 20:61187878-61187900 CATCCCTGGAATACATTGAAGGG + Intergenic
1178202801 21:30426910-30426932 AATTCCTGGAAGACAATTGACGG + Intergenic
1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG + Intergenic
1183235583 22:36614464-36614486 CATTCCTGGACTACATTGAAAGG + Intronic
1184750401 22:46482812-46482834 CATCCCTGGAGAACAGGGGAGGG + Intronic
949747839 3:7315468-7315490 CATTGCTAGAAAACACTGTGAGG - Intronic
950006692 3:9696050-9696072 CATTCCTGCTAAACTCTAGAAGG - Intronic
951054959 3:18136845-18136867 AATTACTTGAAAACACTGAATGG - Intronic
951200339 3:19869434-19869456 CATTAGAGGAAAACACTGTAGGG + Intergenic
951900441 3:27653001-27653023 GATTCTTGGAAAAGACTGGCTGG - Intergenic
952069050 3:29610716-29610738 AATTCCTAGAAAACACTCGCTGG + Intronic
952090799 3:29883148-29883170 CAGTCCTGGTAAACAAAGGATGG + Intronic
952311994 3:32198825-32198847 CATCCCTTGAAAACACTGGGTGG + Intergenic
952944524 3:38468916-38468938 CATTCCTGGAAAACACTGGAAGG - Intronic
953317712 3:41944066-41944088 GTTTCCTGGAAAACACTTAATGG + Intronic
953318252 3:41948597-41948619 TATTCCTGGAAAACAAAAGATGG + Intronic
956199983 3:66695857-66695879 CCATCCTGGAAAGCACTTGAGGG - Intergenic
956377605 3:68632301-68632323 CATTCATGGGAAACAGGGGAAGG + Intergenic
956871466 3:73422163-73422185 CATTCCTCCAGAACACTAGAGGG + Intronic
957832164 3:85535792-85535814 TATTCCTGGAAGCCACTGAAGGG + Intronic
958972652 3:100629623-100629645 CATTCCTGCAGAACTCTGTAGGG - Exonic
960010772 3:112832602-112832624 GATCCCTGCAAAACACTGGATGG + Intronic
960566784 3:119141849-119141871 CATTCCTCAAAAACATTGAAAGG + Intronic
961011922 3:123442200-123442222 CACTCCTGGGAAACACATGACGG + Intronic
961814934 3:129544541-129544563 CATTCCTGGAAGAGAGAGGAGGG + Intronic
962732112 3:138293039-138293061 CATCCCTGGCAAAGCCTGGAGGG - Intronic
963273466 3:143307945-143307967 CAATCCTGGAAAAACCTGGATGG + Intronic
966592586 3:181698613-181698635 CAATCCTGGAAAACCTAGGATGG - Intergenic
970916985 4:21347443-21347465 AACTCATGGAATACACTGGAGGG - Intronic
971069025 4:23069527-23069549 CCTGCCTGGAAAACAATGCAAGG - Intergenic
975197517 4:71542801-71542823 CATTCCAGTAAACCACTGGAGGG + Intronic
975546362 4:75564258-75564280 CCTTCGTGGAAAAAAATGGAAGG - Exonic
976315739 4:83657065-83657087 CGTGCCTGGAAAATATTGGAAGG - Intergenic
977068712 4:92353976-92353998 CATTTCTTGAAAACATTGCAAGG - Intronic
977465172 4:97374798-97374820 CATTCCAGGCAAACAATGCAAGG + Intronic
977971334 4:103217659-103217681 GTCTCCTGGAAAACACTGGTGGG - Intergenic
982456858 4:155620248-155620270 CATTACTGGAAGATACTGAAAGG + Intergenic
984575576 4:181444202-181444224 CCTTCCAGGAACACACTGGTTGG + Intergenic
985971686 5:3383249-3383271 CATTCCTTGAAAATTCTGCATGG - Intergenic
985989128 5:3540534-3540556 CATTCCTGGAAAGTCCTGTATGG + Intergenic
986351821 5:6887259-6887281 TATCACTGGAAAACACTGGAGGG + Intergenic
988641660 5:33047342-33047364 CTCTCCTGGAAGACACAGGAAGG + Intergenic
989483382 5:41959482-41959504 CACTACTGGAAAAAAATGGAGGG - Intergenic
990211832 5:53488720-53488742 CATTCCTCTTAAACACTGGACGG + Intergenic
990484822 5:56247835-56247857 CCTTCCTGGCAGACTCTGGAGGG + Intergenic
991302457 5:65142520-65142542 ACTTCCTTGAAAACTCTGGAAGG + Intergenic
995061057 5:107812385-107812407 CTTTCCTGGTTAACACTGCAGGG + Intergenic
997890467 5:137671981-137672003 CATACCTGGAGAACACTGGTTGG + Intronic
998034753 5:138905318-138905340 CATTGCTGGAAAATACAGGGTGG + Intronic
1000501947 5:162063208-162063230 CATTCCTTCAAAACCCTAGAAGG - Intergenic
1001281861 5:170391809-170391831 CATTCCTCAAAAACACTGAGGGG - Intronic
1001396679 5:171423029-171423051 CAGTCCTGGAAAACACTGCGAGG - Intronic
1001720107 5:173849996-173850018 TAGTCTTGGAAAACACTAGAAGG + Intergenic
1001774515 5:174318846-174318868 CATTTTAGGAAAACATTGGATGG - Intergenic
1002489938 5:179568450-179568472 CATGACTTGAAAACACTGAAAGG - Intronic
1002664445 5:180811895-180811917 CAGTCCTGGAAATGCCTGGAAGG - Intronic
1002950312 6:1803267-1803289 CATTCTTGCAAAACCCTGGCTGG + Intronic
1003602844 6:7533750-7533772 CATTAGGGGAAAAAACTGGAAGG + Intergenic
1011335780 6:86258172-86258194 CTTCCCTGGACCACACTGGAAGG + Intergenic
1017019294 6:150127522-150127544 GGTTCCTGGGAAACACTGGGAGG + Intergenic
1018619393 6:165715455-165715477 CATTCCTGGAACCTGCTGGATGG - Intronic
1020728616 7:11849747-11849769 CATTACTGGAAAACAGATGATGG + Intergenic
1021946329 7:25731413-25731435 CCTTCCTGGAAACCACAGCAAGG + Intergenic
1024064743 7:45722916-45722938 CAATCTTGAAAAAGACTGGAAGG - Exonic
1025168926 7:56738403-56738425 CATTCCTAGAAATCACAGAATGG + Intergenic
1025583046 7:62743879-62743901 TATCCCAGGAAAACACTAGAAGG + Intergenic
1025703463 7:63841491-63841513 CATTCCTAGAAATCACAGAATGG - Intergenic
1026653104 7:72232843-72232865 AATTCCTTTAAAAGACTGGAAGG + Intronic
1030296528 7:107934441-107934463 CCTTCCTTGAAAACACAGGAAGG + Intronic
1032565822 7:132941752-132941774 CATTTCTGAAAAGCACAGGACGG + Intronic
1033383252 7:140845148-140845170 CATTTGTGGAAAAGACTGAATGG - Intronic
1033733080 7:144196908-144196930 CATTCTTTGAAGTCACTGGAGGG - Intergenic
1033743932 7:144295474-144295496 CATTCTTTGAAGTCACTGGAGGG - Intergenic
1033749969 7:144354080-144354102 CATTCTTTGAAGTCACTGGAGGG + Intergenic
1033925836 7:146459236-146459258 CCTTCTTGGAAAACCATGGAAGG - Intronic
1037979858 8:23245157-23245179 CATTCCTAGTCAACACTGTACGG - Intronic
1038276406 8:26125069-26125091 TTTTCCTGGAAAGAACTGGATGG - Intergenic
1039795848 8:40914375-40914397 CATGCCTGGAATACCTTGGAAGG + Intergenic
1041197306 8:55412836-55412858 CATTCCTGATGAACAATGGAGGG + Intronic
1042926525 8:73973047-73973069 CACTCCTGGAAAACAGTAGAAGG - Intronic
1043852454 8:85230089-85230111 AATTCCTGGAAATATCTGGAGGG + Intronic
1044055223 8:87561353-87561375 CATACCTAGAAAAAAATGGACGG + Intronic
1047957072 8:129984310-129984332 CCTGCCTGGGAGACACTGGATGG - Intronic
1048605991 8:135969549-135969571 ACTTTCTGGAAAAGACTGGAAGG + Intergenic
1052343385 9:27384691-27384713 CATGCCAGGGAAATACTGGAGGG - Intronic
1052994011 9:34540167-34540189 CACTCCTTTGAAACACTGGAAGG - Intergenic
1055128660 9:72749773-72749795 TATTCCTGTAAAACAGTGGCAGG - Intronic
1056587020 9:87934431-87934453 CACTACTGGAAAACACAGAAGGG + Intergenic
1056609854 9:88118505-88118527 CACTACTGGAAAACACAGAAGGG - Intergenic
1060378314 9:123139356-123139378 GATTCATGAAAAAAACTGGATGG + Intronic
1187529157 X:20080884-20080906 CATTACAGGAAAATACTGGCTGG - Intronic
1188250152 X:27883248-27883270 CATTCTTGGAAAACCCAGCAAGG - Intergenic
1188765933 X:34090577-34090599 CATTCCTCAAAAACATTGTAAGG + Intergenic
1191264082 X:58364947-58364969 TATACCTGGAAAAAACTAGATGG + Intergenic
1193120213 X:77815369-77815391 TATTCCTTGAAAACATTGAAAGG - Intergenic
1194551250 X:95302334-95302356 CATTCTTCTAAAACACTGAATGG + Intergenic
1198576977 X:138021180-138021202 CATTGCTGGAAAACATTGTAAGG - Intergenic
1200383633 X:155866076-155866098 CAGACCAGGAAACCACTGGAAGG + Intergenic
1200633115 Y:5613724-5613746 CATTCCTGAAACAAAGTGGAAGG - Intronic
1200936703 Y:8744669-8744691 CATTCCTGGAAGAGACTGTGTGG + Intergenic
1201634687 Y:16109505-16109527 CATTTCTGAATATCACTGGATGG - Intergenic