ID: 952944785

View in Genome Browser
Species Human (GRCh38)
Location 3:38472132-38472154
Sequence CTGAAGAGACAGATGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 0, 2: 2, 3: 51, 4: 543}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952944785_952944802 30 Left 952944785 3:38472132-38472154 CCTGGCCCCATCTGTCTCTTCAG 0: 1
1: 0
2: 2
3: 51
4: 543
Right 952944802 3:38472185-38472207 TTACTCTGCTGCTGGGGAGGTGG 0: 1
1: 0
2: 1
3: 32
4: 286
952944785_952944797 23 Left 952944785 3:38472132-38472154 CCTGGCCCCATCTGTCTCTTCAG 0: 1
1: 0
2: 2
3: 51
4: 543
Right 952944797 3:38472178-38472200 GCTGCCCTTACTCTGCTGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 221
952944785_952944800 27 Left 952944785 3:38472132-38472154 CCTGGCCCCATCTGTCTCTTCAG 0: 1
1: 0
2: 2
3: 51
4: 543
Right 952944800 3:38472182-38472204 CCCTTACTCTGCTGCTGGGGAGG 0: 1
1: 0
2: 1
3: 28
4: 242
952944785_952944798 24 Left 952944785 3:38472132-38472154 CCTGGCCCCATCTGTCTCTTCAG 0: 1
1: 0
2: 2
3: 51
4: 543
Right 952944798 3:38472179-38472201 CTGCCCTTACTCTGCTGCTGGGG 0: 1
1: 0
2: 3
3: 26
4: 306
952944785_952944796 22 Left 952944785 3:38472132-38472154 CCTGGCCCCATCTGTCTCTTCAG 0: 1
1: 0
2: 2
3: 51
4: 543
Right 952944796 3:38472177-38472199 AGCTGCCCTTACTCTGCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952944785 Original CRISPR CTGAAGAGACAGATGGGGCC AGG (reversed) Intronic
900129195 1:1080449-1080471 CAGAATTGAGAGATGGGGCCTGG + Intergenic
900176651 1:1294127-1294149 CCAAAGAGACAGCCGGGGCCGGG - Exonic
900184437 1:1326314-1326336 AAGCAGAGACAGGTGGGGCCGGG - Intronic
901019116 1:6247009-6247031 CTGAAGAGACAGAACAGGGCAGG - Intergenic
901488112 1:9579510-9579532 AAGAAGAGACAGGTAGGGCCAGG + Intronic
902728024 1:18350227-18350249 CTCAAGAGCCAGATGGGCCAGGG + Intronic
903321760 1:22547580-22547602 GGGAAGAGACAGATGGAGGCAGG - Intergenic
903654686 1:24942105-24942127 CTGAGGACACGGATGGGGGCAGG - Intronic
903909712 1:26714163-26714185 CTGAAAAGACAGCTGGTGACTGG + Intronic
904421822 1:30399006-30399028 CTGCAGAGAGAGATGGGGGTGGG + Intergenic
905412081 1:37777671-37777693 ATGAAGAGACACATAGGGCAAGG + Intergenic
905631696 1:39522380-39522402 CTGCAGGGACAGAAGGGGCAAGG - Intronic
905666057 1:39763792-39763814 CTGCAGGGACAGAAGGGGCAAGG + Exonic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
906210760 1:44011163-44011185 CTGAAGAGGGAGCTAGGGCCAGG + Intronic
907227014 1:52957222-52957244 TTAAATAGACAGAAGGGGCCAGG - Intronic
908655712 1:66385936-66385958 ATGAAGAGATACATAGGGCCAGG - Intergenic
911413450 1:97540457-97540479 ATGAAGAGACACATAGGGCAAGG + Intronic
912499169 1:110110582-110110604 GTGAAGATACCCATGGGGCCGGG - Intergenic
912547145 1:110458936-110458958 TTTAAGAGAGAGAGGGGGCCGGG + Intergenic
912949318 1:114109935-114109957 CTAAAGACACAGAAGGGGCAGGG + Intronic
913053781 1:115139220-115139242 GTGAAGAGAATGATGGCGCCTGG - Intergenic
913230511 1:116737045-116737067 CTGCAGATACAGATGGGGTCTGG + Intergenic
914509830 1:148321674-148321696 CTGAAAAGACACATGTGGCAGGG + Intergenic
914785141 1:150822595-150822617 ATGAAGAGATAGATAGGGCAAGG - Intronic
914856146 1:151352206-151352228 CTGAAGTGAAAGCTTGGGCCAGG + Intergenic
914986076 1:152458199-152458221 CTGATGATACATATGGGGACAGG - Intergenic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915300252 1:154947605-154947627 CTCCAGAGGCAGGTGGGGCCTGG - Intronic
915345297 1:155194008-155194030 CTTAAGAGGCAGATCGGGCGTGG + Intergenic
915562983 1:156698372-156698394 CAAAAGAAACAGATGAGGCCGGG + Intergenic
915929998 1:160054378-160054400 GTGAGGACCCAGATGGGGCCAGG - Intronic
916239061 1:162621304-162621326 CTGGAGAGACTGATGGGTTCTGG + Intergenic
916688702 1:167170987-167171009 ATGAAGAGACACATGGGGTGAGG - Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
917283121 1:173397895-173397917 GTGAAAAGACAGATGGGTCTTGG + Intergenic
917358860 1:174155089-174155111 CTCAAGAGACATTTAGGGCCAGG + Intergenic
918006344 1:180545125-180545147 ATGAAGAGACACATAGGGCAAGG - Intergenic
918660941 1:187088073-187088095 TTTAAGAGACATATGGGGACAGG - Intergenic
919839716 1:201600001-201600023 CCGAGGAGACAGCTTGGGCCCGG + Intergenic
919954804 1:202403145-202403167 CAGTAGAGAGAGATGGGGCCTGG + Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920690040 1:208139288-208139310 TTGAAGTCAGAGATGGGGCCAGG + Intronic
921122079 1:212145967-212145989 TTTAAAAAACAGATGGGGCCTGG - Intergenic
922331670 1:224582334-224582356 GTGCAGAGACAGATGTGGCTGGG + Intronic
922752763 1:228078425-228078447 CTGGAGTGACAGAGGCGGCCTGG - Intergenic
923017638 1:230139324-230139346 CAGAAGGGACACATGTGGCCAGG - Intronic
923568065 1:235091504-235091526 CTCTAGAGAGAGATGTGGCCAGG + Intergenic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
924486564 1:244489517-244489539 CTGAAGAGACAGCTGGAGTCAGG + Intronic
924509213 1:244714837-244714859 CTTGAAAGACAGATGAGGCCAGG + Intergenic
924908397 1:248481845-248481867 CTGATGAGACATATGGTGTCTGG - Intergenic
924915713 1:248566240-248566262 CTGATGAGACATATGGTGTCTGG + Intergenic
1062995620 10:1863583-1863605 CTGAAGAGACAGAGGAAGACGGG - Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063535853 10:6882681-6882703 TAGAAGAGACAGTTGGGTCCTGG + Intergenic
1064575987 10:16747007-16747029 CTTATGAGACAGATGGGGGTTGG - Intronic
1066004569 10:31134383-31134405 CTGAAGAGGCAGCTGGAGCGCGG - Intergenic
1067077505 10:43196598-43196620 CTGAAGGGACAGCTGGGTTCAGG - Intronic
1067532099 10:47081406-47081428 CAGAAGAGAAAGAAGGGGCGGGG - Intergenic
1067719840 10:48719988-48720010 CTGAAGCAACAGATGGGACTTGG - Intronic
1068326230 10:55491422-55491444 CTGAAGAGCAAGGTGGGGCAGGG - Intronic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1069862552 10:71480688-71480710 GTGAGGAAACAGATGGGGTCAGG + Intronic
1070511357 10:77164007-77164029 CTGATGAGAAAACTGGGGCCTGG - Intronic
1071590069 10:86864470-86864492 CTGAAGAGTCAACTAGGGCCTGG - Intronic
1072136115 10:92548062-92548084 ATCAAGAGTCAGATGAGGCCAGG + Intronic
1072408034 10:95173039-95173061 GAGCACAGACAGATGGGGCCTGG - Intergenic
1072839074 10:98750458-98750480 CTGAAGAGACTGAAGGGGATGGG + Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1075302616 10:121338837-121338859 CTGCTAAGCCAGATGGGGCCTGG + Intergenic
1075335574 10:121606803-121606825 CTCAACAGTCACATGGGGCCAGG + Intergenic
1075342310 10:121657005-121657027 ATGAAGACACAGAGAGGGCCGGG - Intergenic
1075539135 10:123297612-123297634 TTCAAGAGACAGCAGGGGCCCGG - Intergenic
1076678035 10:132158104-132158126 CTGAGTAGACAGATGCTGCCGGG - Intronic
1077159839 11:1107706-1107728 GTGAAGAGCAAGATGGTGCCTGG + Intergenic
1077236732 11:1485520-1485542 ATGAAGAGAAAGATGGAGCCGGG + Intronic
1077541325 11:3147848-3147870 CAGACGAGACAGAAGGGCCCGGG - Intronic
1078162069 11:8849526-8849548 CTGAAGAGACTGATAAGGCCAGG + Intronic
1078180495 11:9006168-9006190 GTGATGGGACAGAAGGGGCCAGG - Intergenic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1079080005 11:17407453-17407475 CCTAAAAGACAGATGTGGCCTGG + Exonic
1079106738 11:17576845-17576867 CTGCAGAGAGAGACGGGCCCTGG - Intronic
1079119515 11:17671995-17672017 CTGCAGAGACACATGGGGATGGG + Intergenic
1079356879 11:19737149-19737171 CTGAAGGGACAGCTGAGGACAGG + Intronic
1080118575 11:28648120-28648142 TTGAAGAGCCAGATGGGGCAAGG + Intergenic
1080394869 11:31880896-31880918 CTGAAGAGACATCTTGGGCAAGG + Intronic
1080767748 11:35312292-35312314 CTCAAGAAGCAGCTGGGGCCTGG - Exonic
1081499540 11:43652684-43652706 ATGAAGAGATACATGGGGCGAGG + Intronic
1081579060 11:44339531-44339553 CTGGAGAGACAGATCTGGCCTGG + Intergenic
1081702378 11:45159894-45159916 CTGCAGAAACAGAATGGGCCAGG + Intronic
1081822001 11:46007608-46007630 CATAAAAGATAGATGGGGCCGGG - Intronic
1081980069 11:47260707-47260729 CTGAGGGGAAAGAGGGGGCCAGG + Intronic
1082861193 11:57858220-57858242 CTGAGGAGAAAGATGGAGCCTGG + Intergenic
1082877849 11:58006229-58006251 TTTAAGAGACAAATGAGGCCAGG - Intergenic
1083398122 11:62405233-62405255 CTGGAGAGACAGGTGGGAACAGG + Intronic
1083403338 11:62439961-62439983 CTTAAAAGACAAATGCGGCCGGG - Intronic
1083821167 11:65172223-65172245 CTGCAGAGACAGATCGGGGTGGG - Intronic
1084219883 11:67671333-67671355 ATGAGGAAACAGATGGGGGCTGG + Intronic
1084952098 11:72672100-72672122 TGGAAGAGAGAGGTGGGGCCAGG - Intronic
1085331135 11:75652368-75652390 CAGAAGGGACAGCTGGGGCATGG - Intronic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1085460013 11:76687920-76687942 CTGAAGGGACAGACTGGGGCAGG + Intergenic
1085736207 11:79041357-79041379 TTCAAGAGACAAATGAGGCCGGG - Intronic
1088167407 11:106955265-106955287 CTTAAAAGACAGACTGGGCCGGG - Intronic
1089400822 11:118163642-118163664 AGGAAGAGACAGATGGGGGGTGG + Exonic
1089671883 11:120062426-120062448 CTGCAGTGACAGAGGAGGCCCGG + Intergenic
1090033952 11:123231903-123231925 CTGAAGTGACTGATGGAGGCAGG - Intergenic
1090543849 11:127739730-127739752 CAGCAGAAAAAGATGGGGCCAGG + Intergenic
1090658627 11:128864778-128864800 CTGCAGAGAGTGATGGGGACAGG - Intronic
1090713391 11:129408495-129408517 GTGAAGAGACAGGCAGGGCCAGG - Intronic
1090972875 11:131657974-131657996 CTGAAGAGACCTGAGGGGCCAGG + Intronic
1091413771 12:262251-262273 CTGTAGAGTCAGATGAGGCCAGG + Intronic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1092709663 12:11322437-11322459 GTGTGGAGACAGATGGGCCCAGG - Intergenic
1092936303 12:13367254-13367276 CTGTAGGGCCAGGTGGGGCCTGG - Intergenic
1092997107 12:13960771-13960793 ATGAAGAGACGGATTGGGTCAGG + Intronic
1094045086 12:26158619-26158641 CAGAAGAGGCAGATGAGTCCTGG + Intronic
1094320706 12:29179729-29179751 TAGAGGAGACAGATGGGGCCAGG - Intronic
1095257104 12:40051585-40051607 CTGAAGAGTCAGAGGGGCCTTGG + Intronic
1096277771 12:50225195-50225217 TTAAAGAGACAGTTGGGGCCAGG - Intronic
1096704636 12:53411400-53411422 CTGATGATACAGATGGGTGCCGG - Exonic
1096741764 12:53698653-53698675 CAGAAGACAGAGATGAGGCCAGG - Intergenic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097223622 12:57464221-57464243 AAGAAGTCACAGATGGGGCCGGG + Intronic
1097835166 12:64265565-64265587 AGGAAGAAACAGATGTGGCCTGG + Intronic
1098902939 12:76131785-76131807 TAGAAGAGACACATAGGGCCAGG + Intergenic
1099239109 12:80117121-80117143 CTCAAGAGACAAATGGGGCCTGG + Intergenic
1099278085 12:80603813-80603835 GTGATGATACAGATGGGGCAGGG - Intronic
1099919026 12:88934109-88934131 CTCAAAAGACAGAACGGGCCTGG + Intergenic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1101440738 12:104702707-104702729 TTGAAGAGACTGCTGGGGGCAGG - Intronic
1102650662 12:114439993-114440015 GAGAAGAGCCAGGTGGGGCCTGG - Intergenic
1102899143 12:116622763-116622785 ATGAAGAGACACATAGGGCAAGG + Intergenic
1102928731 12:116846448-116846470 TTGTAGAGACATATGGGGCATGG + Intronic
1103040501 12:117691331-117691353 CTGCAAAGAAAGATGGTGCCAGG + Intronic
1103338521 12:120208530-120208552 CCAAAGAGAATGATGGGGCCAGG - Intergenic
1103379043 12:120479631-120479653 CTGAAGAACCAGATGGTGCTAGG + Intronic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1104274078 12:127308906-127308928 CGGAAGGGACTGATGGAGCCTGG - Intergenic
1104554015 12:129783580-129783602 CTGAAGAGACAAATGCCGCTGGG + Intronic
1104787181 12:131457236-131457258 CTGAGAAGTCAGATGGGGGCTGG - Intergenic
1104838514 12:131808438-131808460 CTAAAGAGACATTTGTGGCCGGG + Intergenic
1104891172 12:132140867-132140889 TGGAAGATACAGATGGGGACGGG - Exonic
1104972513 12:132538370-132538392 GTGAAGAGACAGCTGGGGATGGG - Intronic
1105278243 13:18948504-18948526 ATGCAGTGACAGATGTGGCCGGG - Intergenic
1105923349 13:24984982-24985004 CTCCAGAGACAGAAAGGGCCTGG + Intergenic
1106878690 13:34105264-34105286 TTGAAGAGAAGGATGTGGCCGGG + Intergenic
1107391690 13:39971669-39971691 TTGAAGAGACCGATGGCACCTGG + Intergenic
1107466278 13:40653522-40653544 CTGAAGAGTTAGCTGAGGCCGGG - Intronic
1108396353 13:49995692-49995714 CTCAGGAGACGGATGTGGCCAGG + Intergenic
1109167256 13:59051633-59051655 AAGAAGAAACAAATGGGGCCAGG + Intergenic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1114083731 14:19221563-19221585 CTGAGGTGCCTGATGGGGCCAGG - Intergenic
1114555766 14:23561436-23561458 CAGAAGGGACAGAAGGGGCAGGG + Intronic
1115099496 14:29681318-29681340 ATGAAGTGACAGAAAGGGCCAGG - Intronic
1115326867 14:32149472-32149494 CTGAAAAGAAAAGTGGGGCCAGG + Intronic
1115437373 14:33390567-33390589 CTGTAGAGAGAGATGAGGGCAGG + Intronic
1116213673 14:41981682-41981704 CTGAAGACACAGATAGGTCATGG - Intergenic
1116387639 14:44351078-44351100 CTTAAGAGACAGGTGGGGAATGG - Intergenic
1116992188 14:51288150-51288172 CTGAAGATGCATCTGGGGCCAGG + Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1118191554 14:63585237-63585259 CTAAACATACAGAAGGGGCCGGG - Intergenic
1118904246 14:70011953-70011975 CTGAAGAGGCAGATGACCCCTGG + Intronic
1119037998 14:71246726-71246748 CTGAAGAGAAAGATAAGGGCAGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119514034 14:75233947-75233969 ATGGAAAGAGAGATGGGGCCGGG + Intergenic
1119642796 14:76327593-76327615 CAGAGGAGAAAGATGGGCCCTGG + Intronic
1119643514 14:76331321-76331343 GTGAATTCACAGATGGGGCCAGG - Intronic
1121155063 14:91675438-91675460 CAGAAGAGACAGAGGAGACCTGG - Intronic
1121304824 14:92899529-92899551 GGGAAGAGAAAGATGGAGCCGGG + Intergenic
1121485756 14:94313197-94313219 CTCATGAGACAGAAGAGGCCTGG + Intronic
1121493759 14:94378160-94378182 CTCCAGAAACAGATGGGCCCAGG + Exonic
1121560784 14:94873771-94873793 CTGAAGAGCCAGAGTGGTCCAGG + Intergenic
1121742736 14:96265504-96265526 CTTAAAATACAAATGGGGCCAGG - Intronic
1121952262 14:98181878-98181900 CTGGATTGACAGAGGGGGCCTGG - Intergenic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1122297086 14:100711801-100711823 CTGAGGAGAAAGAGGTGGCCTGG + Intergenic
1122809827 14:104282388-104282410 CAGAAGAGAAAGACGGGGACAGG - Intergenic
1122814351 14:104304990-104305012 CAGAGGAGACAGAGGAGGCCAGG + Intergenic
1202829218 14_GL000009v2_random:8170-8192 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1202847331 14_GL000009v2_random:191771-191793 TAGAAGAGACACATAGGGCCAGG + Intergenic
1202895348 14_GL000194v1_random:3332-3354 CTGAGGTGCCTGATGGGGCCAGG - Intergenic
1202900930 14_GL000194v1_random:38022-38044 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1202916796 14_GL000194v1_random:182329-182351 TAGAAGAGACACATAGGGCCAGG + Intergenic
1202875994 14_KI270722v1_random:867-889 TAGAAGAGACACATAGGGCCAGG - Intergenic
1123424183 15:20155867-20155889 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1123533403 15:21162396-21162418 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1125827593 15:42689489-42689511 CTGCAGACAGAGATGTGGCCTGG - Exonic
1126165876 15:45653442-45653464 TGGAAGAGACATATGGGGCAAGG + Intronic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1127485856 15:59417025-59417047 CTGAAGAGGATGATGGGGGCTGG + Intronic
1127806788 15:62528553-62528575 CTCAAGAGACAGAAGGTGCCAGG + Intronic
1128499286 15:68216206-68216228 CTAGAGAGAGAGATGAGGCCAGG - Intronic
1128667370 15:69548262-69548284 CAGAAGAGCCAGCTTGGGCCAGG + Intergenic
1128701953 15:69811146-69811168 GAGAAGAGACTGAAGGGGCCTGG - Intergenic
1129025239 15:72565798-72565820 CTGAAAAGAAAGATGGGGAATGG - Intronic
1129327427 15:74808317-74808339 CTGAAGCGAAAGCAGGGGCCTGG + Intergenic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1130447092 15:84013504-84013526 CTTAAGAGCCAGATGAGGTCAGG + Intronic
1130662465 15:85841430-85841452 CTGAAAAATAAGATGGGGCCAGG - Intergenic
1130783130 15:87066132-87066154 CTGAAGGGATAGATGGGGGCTGG + Intergenic
1131281413 15:91024355-91024377 TTTAAGAGACAGATCGGGCCAGG - Intergenic
1131453106 15:92562639-92562661 CTGGAGAGGGAGATGGCGCCAGG + Intergenic
1131614583 15:94001725-94001747 CTGAAGTGACAGAGATGGCCAGG + Intergenic
1131768975 15:95714254-95714276 CTGGAGAAAAAGATGGGTCCTGG + Intergenic
1132294653 15:100726332-100726354 CTGAAAACACCCATGGGGCCTGG - Intergenic
1132309518 15:100847020-100847042 CTGAAGAGAGAGCTGGTCCCTGG + Intergenic
1132693935 16:1193839-1193861 CTGGAGTGACAGGTGGGGGCAGG + Intronic
1132771633 16:1566886-1566908 CTGAGAACCCAGATGGGGCCTGG - Intronic
1133026230 16:2990064-2990086 CTGGAGAGACAGATGAGGTGAGG - Intergenic
1133027587 16:2995435-2995457 CAGGTGAGACAGATGGGGTCTGG + Intergenic
1133282680 16:4676153-4676175 GTGAAGAGGCTGCTGGGGCCTGG + Intronic
1133387941 16:5385887-5385909 CTGGAGAGACAAGTGGGGGCAGG + Intergenic
1133639646 16:7704526-7704548 GTAAAGAGAGAAATGGGGCCTGG - Intronic
1134108418 16:11499727-11499749 GTGAAGACACAGCTGGTGCCAGG - Intronic
1134234025 16:12451566-12451588 TTCAAGAAACGGATGGGGCCGGG + Intronic
1134759971 16:16705639-16705661 GTGAAGAGACACGTGAGGCCAGG + Intergenic
1134817463 16:17217766-17217788 GGGAGGAGAGAGATGGGGCCAGG + Intronic
1134986100 16:18653566-18653588 GTGAAGAGACACGTGAGGCCAGG - Intergenic
1135322898 16:21508680-21508702 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1135820847 16:25684582-25684604 CTGTAAAGACACATGCGGCCAGG + Intergenic
1135956254 16:26958903-26958925 CTGCAGAGTCAGAAGGGTCCGGG + Intergenic
1136334382 16:29601865-29601887 CTGAGCAGACAGGTGGGGCCAGG - Intergenic
1136469901 16:30473134-30473156 TTAAAAAGACAGATAGGGCCAGG + Intronic
1136473096 16:30494839-30494861 CAGAGAAGACAGGTGGGGCCAGG + Exonic
1136498043 16:30655797-30655819 CTGAAGGGACAGGTAAGGCCTGG - Intronic
1136860686 16:33700019-33700041 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1137032266 16:35534309-35534331 CTGATGTTACAGGTGGGGCCTGG - Intergenic
1137553428 16:49455625-49455647 CAGCAGAGCCAGATGGGTCCTGG - Intergenic
1138505217 16:57475089-57475111 GTGAACAGACAGGTGAGGCCGGG - Exonic
1139714822 16:68804406-68804428 CTTAAAAGGCAGATAGGGCCGGG - Intronic
1139831243 16:69800040-69800062 CTTAAGAGAGAGGTGGGGGCGGG + Intronic
1139922743 16:70470223-70470245 CAGCAGAGACACATGGGGGCAGG - Intronic
1140076825 16:71707718-71707740 CTGAAGAGACACATAGGGTGAGG - Intronic
1140088635 16:71818890-71818912 TTGAAAAGAAAAATGGGGCCGGG + Intergenic
1140212426 16:72981122-72981144 CTTTAGAGATAGCTGGGGCCCGG - Intronic
1140741798 16:77948053-77948075 TTTAAGAGGGAGATGGGGCCGGG - Intronic
1140808484 16:78554849-78554871 CTGAAGACAGAGGTGGGACCTGG + Intronic
1140860014 16:79010323-79010345 CTCAGGCGACAGATGGGACCAGG + Intronic
1141156128 16:81598311-81598333 GTAAAGAGCCAGATGTGGCCAGG - Intronic
1141172471 16:81700160-81700182 CTCATCAGTCAGATGGGGCCAGG + Intronic
1141251381 16:82362084-82362106 CAGAAGGCAGAGATGGGGCCAGG - Intergenic
1141421171 16:83917511-83917533 CAGAAGACAGAGAAGGGGCCTGG - Exonic
1141461382 16:84180407-84180429 CTGGAGAGCCACATGGGGCCTGG - Intronic
1141597432 16:85106053-85106075 GGGAAGAGACAGCTGGGGGCTGG + Intronic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1141650935 16:85392826-85392848 CTGGAGAGGCGGCTGGGGCCAGG + Intergenic
1141725339 16:85784291-85784313 GTTAAAAGAAAGATGGGGCCAGG - Intronic
1141726914 16:85795656-85795678 ATGAAGAGACACATAGGGCGAGG - Intronic
1141796769 16:86280249-86280271 CTGAAGAGTCAACTTGGGCCTGG - Intergenic
1141805682 16:86340058-86340080 CTGGAGAGGGAGGTGGGGCCAGG - Intergenic
1141946115 16:87311097-87311119 CTGAAGAGTGAGGTGGGGGCCGG - Intronic
1142035092 16:87857700-87857722 CTGAGCAGACAGGTGGGGCCAGG - Intronic
1203122185 16_KI270728v1_random:1548202-1548224 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1142474581 17:181388-181410 TTGATGGGACGGATGGGGCCGGG + Exonic
1143121100 17:4607422-4607444 GTGAAGACACACATGGGGTCCGG - Exonic
1143324967 17:6092719-6092741 CTGAGCAGGCAGATGGGGCTGGG - Intronic
1143718407 17:8792834-8792856 CTGGAAAGACAGATGGGACCAGG - Intergenic
1144780137 17:17803934-17803956 CTGAAGAGTGAGATGGGGCCTGG - Intronic
1144939937 17:18931929-18931951 CTCTAAAGACAGATGAGGCCGGG - Intergenic
1145914251 17:28561850-28561872 CTGAAGAGTTAGATGCTGCCTGG - Intronic
1146370250 17:32261686-32261708 CTGCAGAGAGAGAAGGGGCTCGG + Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1148435704 17:47682837-47682859 CTGAGGAGAAAGATGGAGCCTGG + Exonic
1148590503 17:48813258-48813280 CTTAAGAGTCAGTTGGGGACAGG + Intronic
1148798511 17:50209154-50209176 ATGAACAAACAAATGGGGCCGGG + Intergenic
1150630870 17:66879641-66879663 ATGAAGAGACACATAGGGCAAGG + Intronic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1151520752 17:74627770-74627792 CAAATGAGGCAGATGGGGCCAGG - Intergenic
1151717013 17:75836110-75836132 CTGCAGAGACAGAGGTGGGCTGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1152043495 17:77920418-77920440 CTAAAAATACAGATGTGGCCAGG + Intergenic
1153028226 18:690082-690104 CTGAAGAGACACACAGGGCAAGG - Intronic
1153378188 18:4405721-4405743 CTCAAGACAAAGATGGGTCCAGG + Intronic
1153832077 18:8932659-8932681 CTGAACAACCAGATGAGGCCAGG - Intergenic
1155250029 18:23945442-23945464 GAGAAGAGGCAGATGTGGCCAGG + Intronic
1156345218 18:36251011-36251033 CTGAAGTGACAGATGCTGCAAGG - Intronic
1157703409 18:49780023-49780045 ATTAAGAGATGGATGGGGCCGGG - Intergenic
1157873576 18:51251696-51251718 TGCAAGAGCCAGATGGGGCCAGG - Intergenic
1160438715 18:78871987-78872009 CTGCAGAGAAAGGTGGGGGCTGG - Intergenic
1160614184 18:80111366-80111388 CAGAAGAGCCAGCTGAGGCCTGG + Intronic
1160694787 19:478232-478254 CTAAAGAGACAGAGGGGACAAGG + Intergenic
1160837556 19:1131921-1131943 CAGAAGAGACGGACGGGGCGGGG + Intronic
1161419195 19:4166689-4166711 CAATAGAAACAGATGGGGCCAGG - Intronic
1161449717 19:4338405-4338427 CGGGAGAGACAGACGGGGCCAGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161740969 19:6021067-6021089 CTTAGGAGACAAAGGGGGCCAGG - Intronic
1162018882 19:7859814-7859836 CAGAGGAGCCACATGGGGCCTGG + Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162419505 19:10558072-10558094 GAGAACAGACAGGTGGGGCCAGG + Intronic
1163662904 19:18589183-18589205 CTGCAGAGTCAGATGGGGCGGGG + Intronic
1164454453 19:28395646-28395668 TAGAAGAGTGAGATGGGGCCAGG + Intergenic
1165570523 19:36771537-36771559 CTGAAGTGAAAGTTTGGGCCGGG + Intronic
1165778366 19:38418027-38418049 CCGAAGCGACCGCTGGGGCCTGG + Intronic
1165903109 19:39177946-39177968 CTGCACAGACACATGAGGCCCGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166390922 19:42408354-42408376 CTCAAGAGAGGGATGGGGACAGG + Intronic
1166423146 19:42653704-42653726 GGGAAGAGACAGATGGGGATGGG + Intronic
1166996887 19:46723667-46723689 CTGAAAAGACTGCTCGGGCCAGG - Intronic
1168368393 19:55809801-55809823 CTGAAGAGAAAAATGGCTCCAGG - Exonic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
1202643478 1_KI270706v1_random:119619-119641 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1202674667 1_KI270710v1_random:31943-31965 TAGAAGAGACACATAGGGCCCGG + Intergenic
927640303 2:24841526-24841548 CTGGAGAGCCAGGCGGGGCCAGG + Intronic
927879722 2:26681949-26681971 CTCTTGAGGCAGATGGGGCCAGG + Intergenic
928424546 2:31167203-31167225 CACAAAAGACAGATGGTGCCTGG + Intergenic
929251054 2:39756082-39756104 CTGAAGGGACAGATGGGTTCAGG + Intronic
930988498 2:57620301-57620323 CCGAAGGGACAGAGGGGGCCTGG - Intergenic
932211714 2:69937045-69937067 CTGAAGAGTCAGACGAAGCCAGG + Intronic
932291316 2:70582456-70582478 ATTAAGAGAGAGATGGGGGCAGG + Intergenic
932467345 2:71932400-71932422 CTGAAGAGAATCCTGGGGCCTGG - Intergenic
932571328 2:72940015-72940037 CTGGTGAGGAAGATGGGGCCTGG - Intergenic
933296670 2:80498699-80498721 TTTAAGAGAGAGATGGGGCATGG - Intronic
933652906 2:84863525-84863547 CTTAAGATTCACATGGGGCCAGG - Intronic
934043798 2:88154042-88154064 ATAAAAAGACACATGGGGCCGGG + Intergenic
934459066 2:94201172-94201194 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
934505860 2:94893078-94893100 ATGTAGAGATAGATGTGGCCTGG - Intergenic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934553730 2:95276875-95276897 CTGCAGAGCCCGGTGGGGCCTGG + Intronic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
936658816 2:114519300-114519322 CTGTAGTGACAGATGGGGTGAGG - Intronic
938338187 2:130517446-130517468 TTTAAGAGAGAGATGGGGGCCGG - Intergenic
938351651 2:130603305-130603327 TTTAAGAGAGAGATGGGGGCCGG + Intergenic
938492851 2:131775071-131775093 CTGAGGTGCCTGATGGGGCCAGG + Intergenic
939429847 2:142089153-142089175 TTGAAGGGACATATGGAGCCAGG + Intronic
940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG + Exonic
941628339 2:167855388-167855410 CAGAAGAGAAAGCTGAGGCCTGG - Intergenic
941870941 2:170385086-170385108 TAGAAGAGACACATGGGGCAGGG + Intronic
942030484 2:171954388-171954410 GTAAAGAGAGAGATGAGGCCGGG + Intronic
943321556 2:186450410-186450432 TTGAAGAAGAAGATGGGGCCAGG + Intergenic
943371563 2:187022981-187023003 CTGAGGTGACAGATGGGACAAGG - Intergenic
943797652 2:192017209-192017231 CTGGAGAGGCAGGTGGGGCCAGG + Intronic
944992448 2:205253557-205253579 CTGAAGAGGCAGAGGAGGCAGGG - Intronic
946180780 2:217947705-217947727 GTCAAGAGAAAGATGGGGCAAGG + Intronic
946885019 2:224214488-224214510 TTAAAGAGATAGATGGGGCTGGG - Intergenic
947208491 2:227684092-227684114 CTAAAAAGACAAATGAGGCCTGG - Intergenic
947794563 2:232885791-232885813 CTGCAGTGACACATGGGGCCCGG + Intronic
948088179 2:235267783-235267805 TTAAAGGGACAGATGAGGCCTGG - Intergenic
948601612 2:239110902-239110924 CTGAGGAGGCAGGAGGGGCCGGG - Intronic
1169077229 20:2768604-2768626 CTACAGAGTCAGGTGGGGCCAGG + Intergenic
1169901758 20:10560235-10560257 CTGTAGACAGGGATGGGGCCAGG - Intronic
1171339655 20:24417474-24417496 CTGAAGACACAGGTGCGGGCGGG + Intergenic
1171500485 20:25589153-25589175 GTGAAGAGACACATAGGGCAAGG + Intergenic
1171869304 20:30513121-30513143 AACAGGAGACAGATGGGGCCGGG + Intergenic
1171971745 20:31569248-31569270 CAGACCAGACAGATGGGGGCTGG + Exonic
1172590165 20:36112225-36112247 CTGAAGCGGCAGCAGGGGCCAGG - Intronic
1172595498 20:36148510-36148532 CTGAAGAGCCAGGTGAGACCAGG + Intronic
1174067078 20:47873327-47873349 AAGAGGAGACAGCTGGGGCCTGG + Intergenic
1174416552 20:50371245-50371267 TTTAAATGACAGATGGGGCCAGG + Intergenic
1174513185 20:51071386-51071408 CAGAAGGAACCGATGGGGCCCGG + Intergenic
1175217103 20:57397095-57397117 CTGCAGAGACAGGCTGGGCCTGG - Intronic
1175385154 20:58590078-58590100 CTGGAGAGACACGTGAGGCCTGG + Intergenic
1175459749 20:59143535-59143557 CTGAAGAGCCAGGTAGGGCCAGG - Intergenic
1175517948 20:59580757-59580779 CTGAAGACCCAGATTGGGTCTGG + Intronic
1175644168 20:60657321-60657343 CAGAAGAGAGAAATGGGACCAGG + Intergenic
1176046832 20:63097186-63097208 CTTAAGGGACAGCTGAGGCCAGG + Intergenic
1176056528 20:63151834-63151856 CTGGAGAGCCAGAGGGAGCCGGG + Intergenic
1176368025 21:6045408-6045430 CTGATGAGTCAGCTGGTGCCAGG - Intergenic
1176608402 21:8853010-8853032 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1176615046 21:9019319-9019341 CTGAGGTGCCTGATGGGGCCAGG - Intergenic
1176620304 21:9052800-9052822 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1176637270 21:9258237-9258259 TAGAAGAGACACATAGGGCCAGG - Intergenic
1176710154 21:10144551-10144573 CTGAGGTGCCTGATGGGGCCAGG + Intergenic
1178170504 21:30034795-30034817 CTGTACAGTAAGATGGGGCCTGG - Intergenic
1178402318 21:32297518-32297540 TGGAAGAGACACATGGGGCAGGG - Intronic
1178416091 21:32406364-32406386 CTGAAGAGCCAGTCGGGACCAGG - Intergenic
1178442518 21:32610498-32610520 CAGAAGACAAGGATGGGGCCGGG - Intronic
1179124881 21:38581746-38581768 CTAAAGGGACAGAGGCGGCCAGG + Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179397061 21:41050369-41050391 CTGAAGAGCAAGGTAGGGCCAGG + Intergenic
1179658189 21:42858605-42858627 CATGAGGGACAGATGGGGCCTGG + Intronic
1179755494 21:43493134-43493156 CTGATGAGTCAGCTGGTGCCAGG + Intergenic
1180007986 21:45032098-45032120 CTGCAGTGACAGACGGGGGCTGG + Intergenic
1180247497 21:46557914-46557936 CTGCAGAGACAGGTGGGCCGTGG - Intronic
1180294244 22:10871704-10871726 CTGAGGTGCCTGATGGGGCCAGG + Intergenic
1180358485 22:11862814-11862836 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1180379777 22:12129516-12129538 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1180497050 22:15901118-15901140 CTGAGGTGCCTGATGGGGCCAGG + Intergenic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1181034793 22:20164738-20164760 CTGCTGAGACAGAAGGGGGCCGG - Intergenic
1181357150 22:22305297-22305319 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1181534566 22:23534784-23534806 CTCAAGAGGGAGATGGGGCTGGG + Intergenic
1182121166 22:27787820-27787842 ATGAAGACCCAGATGGGCCCTGG - Intronic
1182907729 22:33952534-33952556 CTGAACAGTCAGATGGGAACCGG - Intergenic
1182910621 22:33981231-33981253 CAGGAGAGGCAGATGGGGCAGGG - Intergenic
1183069057 22:35383524-35383546 CTGACGAGAAAGATGAGGACTGG + Intronic
1183902707 22:41018556-41018578 CTGAAGAGGCAGATGGGTAGTGG + Intergenic
1184385417 22:44171564-44171586 CTGATGACACAGAATGGGCCAGG - Intronic
1184960406 22:47924423-47924445 GTGAAGGGACTCATGGGGCCAGG - Intergenic
1185081156 22:48710097-48710119 CTGAAGACCCCGATGGTGCCTGG - Intronic
1185291487 22:50029954-50029976 CGGAAGAGCCCGATGGGGGCCGG + Intronic
949458378 3:4263486-4263508 CTAGAGAGACAGATTGGGGCTGG - Intronic
950091838 3:10301242-10301264 GTGACAAGACAGGTGGGGCCTGG - Exonic
950351919 3:12363596-12363618 GGGAAAAGACAGATGGGGTCAGG - Intronic
951214910 3:20014703-20014725 TTGAAGAGAGAGATGTGGCTGGG - Intergenic
952376002 3:32767934-32767956 TGGGAGAGACAGATGGGGTCAGG + Intronic
952507993 3:34024931-34024953 CTGATGGGTCAGCTGGGGCCTGG + Intergenic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953031718 3:39184176-39184198 CTGGAGCTACAGACGGGGCCAGG - Exonic
953649705 3:44790974-44790996 ATTAAGAAACAGAAGGGGCCGGG - Intronic
953998271 3:47536893-47536915 CTGCTGAGACTGACGGGGCCTGG + Intergenic
954032276 3:47828161-47828183 TTAAAGATAAAGATGGGGCCTGG + Intronic
954710341 3:52502300-52502322 CTGAAGGGACAGGTGGGAGCTGG - Intronic
954814024 3:53266350-53266372 ATGAAGAGACAGATAGGGTGAGG + Intergenic
955275831 3:57546040-57546062 CTGAAGAGAAAGTTTGGCCCTGG - Intergenic
955707927 3:61747736-61747758 TTGAAGACAAAGATGGGACCAGG - Intronic
956781746 3:72608737-72608759 CTGAAGAGACTGATGGAGAGGGG + Intergenic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
958161338 3:89819232-89819254 CTGTGGAGTCAGAGGGGGCCTGG - Intergenic
959585315 3:108020246-108020268 CTGAACAAACACATGGGGGCAGG + Intergenic
960265667 3:115618383-115618405 AGAAAGAGAAAGATGGGGCCAGG + Intergenic
960967175 3:123113423-123113445 CAGAAGAGAAAGCTGGGGCAGGG + Intronic
961017502 3:123479202-123479224 CTCAAGAGACGGCTGGGGACTGG + Intergenic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961514805 3:127425844-127425866 CTCAAGATGCAGAAGGGGCCGGG + Intergenic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
962479997 3:135789660-135789682 TTGAAGTGAAAGATGGGGTCAGG - Intergenic
962492377 3:135907079-135907101 TAGAAGAGACAGAAGTGGCCAGG + Intergenic
962615314 3:137120553-137120575 TTAAAGATACAGATTGGGCCGGG - Intergenic
962877940 3:139550189-139550211 TTGGAGAGACAGGCGGGGCCAGG + Intergenic
962904613 3:139790427-139790449 CATAAGAGTCAGATAGGGCCAGG + Intergenic
965286184 3:166823578-166823600 CTGAAGAGTCAACTTGGGCCTGG + Intergenic
965587320 3:170330487-170330509 GTGATGAGTCAGAGGGGGCCTGG - Intergenic
965625766 3:170682820-170682842 CTAAAGAGTCAAATTGGGCCTGG + Intronic
967310203 3:188098864-188098886 CTAAAGAAACAGATGAGGCCGGG + Intergenic
1202749624 3_GL000221v1_random:146782-146804 TAGAAGAGACACATAGGGCCAGG + Intergenic
968673629 4:1865361-1865383 CTCAAGAGCAAGAAGGGGCCGGG - Intergenic
970928653 4:21483377-21483399 CTGATGCTACAGGTGGGGCCTGG + Intronic
971368839 4:25999087-25999109 CTAATAAGACTGATGGGGCCTGG - Intergenic
972600398 4:40566941-40566963 ATGAAGACACAGAATGGGCCGGG - Intronic
972918690 4:43910460-43910482 CTGAAGTGGCAGATGGTCCCAGG + Intergenic
973267334 4:48224009-48224031 GGGAAAAGACACATGGGGCCAGG - Intronic
974091505 4:57316026-57316048 CTGTAGAGGTAGATGGGGCCAGG + Intergenic
974456393 4:62133982-62134004 ATGAAGAGACACATGGGGTGAGG - Intergenic
974782789 4:66575139-66575161 CTGAAGAGAAAGCTTGGCCCGGG - Intergenic
974932850 4:68379333-68379355 CTGAAGAGGCATATTGGGCATGG - Intergenic
975224054 4:71849045-71849067 CTGAAGAGACAGAAGGGAGTGGG - Intergenic
976180548 4:82394889-82394911 ATGAAGAGACACATGGGGAGAGG + Intergenic
977136496 4:93311198-93311220 CTGAAGAGACAGCTGGAGTCAGG + Intronic
978729889 4:112013354-112013376 CAGAAAAGATACATGGGGCCAGG + Intergenic
979077066 4:116285123-116285145 ATGAAGAGACACATGAGGCATGG - Intergenic
979232159 4:118358273-118358295 TTAAAGAAATAGATGGGGCCGGG - Intergenic
979398989 4:120224497-120224519 CTGGACAAACAGATGGGGCGGGG - Intergenic
980394579 4:132193198-132193220 CTTAAGAAAAAGATGGGGACGGG - Intergenic
982130250 4:152222866-152222888 CTGATTTGACAGGTGGGGCCTGG + Intergenic
982219655 4:153113694-153113716 GTGAAGAGAGAGATGCTGCCGGG - Intergenic
983559144 4:169083922-169083944 CTGAAGAGAGTGTTGGGGGCTGG + Intergenic
984656009 4:182319814-182319836 TTGAAGATCCAAATGGGGCCGGG + Intronic
985197077 4:187443068-187443090 TTGAAAAGATAGTTGGGGCCGGG + Intergenic
1202752162 4_GL000008v2_random:16664-16686 TAGAAGAGACACATAGGGCCAGG - Intergenic
1202770848 4_GL000008v2_random:205533-205555 ATGCAGAGATAGATGTGGCCTGG - Intergenic
988311295 5:29561364-29561386 CTCAATAGACAGATGGGTCTTGG + Intergenic
990885316 5:60584999-60585021 CTGAAAAGAGAGGTGGGGTCTGG + Intergenic
993764296 5:91836084-91836106 ATAAAGAGACAGAGGGGGGCTGG - Intergenic
994111282 5:96007608-96007630 AAGAAGAGGAAGATGGGGCCGGG + Intergenic
995006738 5:107206103-107206125 CTAAGGAGAAGGATGGGGCCAGG - Intergenic
995500068 5:112794906-112794928 ATGAAGAGACATATGGGGCAAGG + Intronic
996823630 5:127657212-127657234 CAGAAGAGCCACCTGGGGCCAGG - Intronic
997296900 5:132774195-132774217 CGGAAGTGACAGATGGTGCTGGG + Intronic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
997893963 5:137699353-137699375 CTGGAGAGGTAGATGGGGCCAGG + Intronic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
998591974 5:143487915-143487937 ATAAAGAGAGAGATGGGGCCAGG - Intergenic
998690706 5:144584461-144584483 CTGAAGTGACAGATGCTGCTGGG - Intergenic
998742701 5:145223014-145223036 CTGAAGAGGTAGGTGGGGACTGG + Intergenic
998840536 5:146249276-146249298 TTAAAGAGAAAAATGGGGCCAGG - Intronic
999374210 5:151075687-151075709 CTGCAGAGACAGAAGTGGGCTGG + Intronic
999521253 5:152352806-152352828 CCCAAGGGACAGCTGGGGCCTGG - Intergenic
1001704615 5:173732912-173732934 ATGAAAAGACAGACGGGACCTGG - Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1003497062 6:6673422-6673444 CTAGACAGACAGATGGGGCAGGG - Intergenic
1003861523 6:10326598-10326620 TAGAAAAGTCAGATGGGGCCGGG + Intergenic
1004536922 6:16511984-16512006 TTGAGGAGAAAGATGGGGGCTGG - Intronic
1004628592 6:17399877-17399899 CTGAAGAGGAAGATGGTTCCTGG + Intronic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1004861982 6:19813729-19813751 CTGAAGAGACTGAGGTGGACTGG + Intergenic
1005785174 6:29237563-29237585 CTGTAAAGACACATGTGGCCAGG - Intergenic
1006302710 6:33202129-33202151 AGGAAGAGACAGATGGGGATGGG + Intronic
1006678039 6:35777649-35777671 GTGAAAAAACAGGTGGGGCCAGG - Intronic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1007091211 6:39185934-39185956 CTGAAGAGAGAGGTGGGGCGGGG + Intergenic
1007386118 6:41521263-41521285 ATGAAAAGAGATATGGGGCCAGG + Intergenic
1008902701 6:56640340-56640362 CTGGAGTGACAGATGGAGTCAGG + Exonic
1010211182 6:73363736-73363758 CTGGAGAGACTGCTGGGTCCCGG - Exonic
1010968480 6:82239030-82239052 CTAAAGAAACTGATGAGGCCAGG - Intronic
1011861821 6:91767564-91767586 CTGAAAACACAGATTGGGGCAGG + Intergenic
1012849502 6:104429868-104429890 GAAAAGAGAGAGATGGGGCCAGG + Intergenic
1014150644 6:118050711-118050733 CTGAAGAGGAAGGTGGGACCAGG + Intronic
1015102670 6:129499923-129499945 TTGGAGAGACAGAGGGGGGCAGG + Intronic
1015680979 6:135808138-135808160 CTGGAGAGACAGAGGGTGACTGG - Intergenic
1018910230 6:168097468-168097490 CTGACGGGACAGGTGGGGCCAGG + Intergenic
1019566955 7:1688166-1688188 CTCAATAGAAAAATGGGGCCAGG - Intronic
1021568185 7:22035326-22035348 CAGAAAAGACAGATGAGGCCAGG - Intergenic
1022444855 7:30461596-30461618 CTCAAGAGCCACATGCGGCCAGG + Intronic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023851012 7:44150402-44150424 CTACAGAGACAGAGAGGGCCAGG - Intronic
1023909186 7:44541587-44541609 CTGGAGGCACAGATGGGACCAGG + Intergenic
1024445275 7:49470506-49470528 ATGAAGAGATACATGGGGCAAGG - Intergenic
1025694358 7:63767165-63767187 CGGAAGGGAAAAATGGGGCCTGG - Intergenic
1025959797 7:66209961-66209983 CTGAAAATACACCTGGGGCCAGG - Intronic
1026392154 7:69912410-69912432 CTGAGGAGCCGGCTGGGGCCAGG - Intronic
1026861879 7:73795842-73795864 CCAAAGAGACACATGTGGCCGGG - Intergenic
1026921961 7:74162345-74162367 CTGCAGAGACAGAGGGGCACTGG + Intergenic
1026952393 7:74356330-74356352 CTGAAGAGGCAGAGGAGGCAGGG + Intronic
1028404287 7:90459476-90459498 TTTAAGAGACAGTTGGGGCCAGG + Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1029067782 7:97869479-97869501 ATGCAGAGACAGATGTGGCATGG - Intronic
1029067963 7:97871768-97871790 CTACAGAGACAGGTGGGGACTGG + Exonic
1029586328 7:101474156-101474178 CAGATGAGAAAGATGGGGTCAGG + Intronic
1029858725 7:103545929-103545951 TTAAATAGACAGAAGGGGCCGGG - Intronic
1030669431 7:112318981-112319003 ATGAAGAGACAAATTGGGCAGGG + Intronic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1032625124 7:133583689-133583711 CTGAAGGGAGAGATGGGGAAAGG + Intronic
1032774264 7:135094332-135094354 CTGAAGAGACAGACGAATCCAGG + Intronic
1032952039 7:136925671-136925693 CTGCAGAGACAGGAGGTGCCAGG - Intronic
1033524056 7:142192732-142192754 CTGAAGAGAAAGATGGCGATGGG - Intronic
1033618381 7:143039151-143039173 CTGAACAGAAACTTGGGGCCTGG - Intergenic
1034206582 7:149321339-149321361 CTGAGGAGAAAGATGGAGCCTGG - Intergenic
1034532315 7:151703659-151703681 CTGAGGAGGCAGGTGGTGCCTGG - Intronic
1034995627 7:155575491-155575513 ATGAAGAGACACATGGGGTGAGG - Intergenic
1035317816 7:158007616-158007638 ATGAAGACACAGAAGGGGACAGG + Intronic
1035773134 8:2165902-2165924 CTGAAGTGAAAGGTGGTGCCAGG - Intergenic
1036172983 8:6508152-6508174 TTAAAAAGACAGCTGGGGCCGGG + Intronic
1036505009 8:9347305-9347327 CTGCAGAGAAATATGGGGGCGGG + Intergenic
1037337865 8:17809205-17809227 CAGAAGAGACAGAGAGGGCAGGG + Intergenic
1037843547 8:22262868-22262890 TTGAAGAGGCAAATGGGGCCGGG - Intergenic
1038074619 8:24057703-24057725 ATGAGAAGACAGCTGGGGCCTGG - Intergenic
1038276789 8:26127966-26127988 ATGAAGACACAGCTGTGGCCAGG + Intergenic
1039045124 8:33442577-33442599 AAGAAGTGACAGATGAGGCCAGG - Intronic
1039380443 8:37079941-37079963 CTGAAGAGTCAGAATGGGGCGGG + Intergenic
1039419152 8:37421186-37421208 CTGCAGAGCCAGATGGGGAGGGG - Intergenic
1039652570 8:39358252-39358274 ATGAAGAGATAGATGGTGGCCGG + Intergenic
1039900250 8:41746719-41746741 CTGCAGAGGCTGATGGGCCCTGG + Intronic
1040355571 8:46614835-46614857 ATGCAGAGACAGATGTGGCCTGG - Intergenic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1041178382 8:55221648-55221670 CTGAAGAGAGCGATGGGGGTGGG - Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044714330 8:95086897-95086919 CTCAAGAGACAAGAGGGGCCGGG - Intronic
1045015901 8:98001771-98001793 CTGAAAAGACAAAGGTGGCCAGG - Intronic
1047297868 8:123587373-123587395 GAGAAGAGACAGGTGGGCCCAGG + Intergenic
1047382348 8:124374892-124374914 CTCAACAGACTGAAGGGGCCTGG - Intergenic
1047501315 8:125443930-125443952 GTGATGAGGCTGATGGGGCCAGG + Intergenic
1048049321 8:130802584-130802606 CTGAAGAGATAGGTGGAGGCAGG - Intronic
1048256583 8:132909464-132909486 CTGAAGACAGAGATAGGGTCAGG + Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049773989 8:144396337-144396359 TTCAACAGACAGGTGGGGCCCGG - Exonic
1050020516 9:1279747-1279769 ATAAAGAGAGACATGGGGCCGGG - Intergenic
1050510165 9:6385924-6385946 CTAAAGAGACAGATAGACCCAGG + Intergenic
1051057215 9:13001774-13001796 TTGAAGACACAGAGGGAGCCAGG - Intergenic
1051351909 9:16205155-16205177 CTCAAAGGCCAGATGGGGCCTGG + Intronic
1051877282 9:21805912-21805934 CTGAGGAGAGAGATGGGGGTAGG + Intronic
1053156173 9:35781258-35781280 CTGGAGAGGAAGATGGAGCCAGG + Intergenic
1053647133 9:40130249-40130271 CTGAGGTGCCTGATGGGGCCAGG + Intergenic
1053689559 9:40576961-40576983 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1053758592 9:41333594-41333616 CTGAGGTGCCTGATGGGGCCAGG - Intergenic
1054274471 9:63054096-63054118 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1054300805 9:63377900-63377922 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054328139 9:63728206-63728228 CTGAGGTGCCTGATGGGGCCAGG + Intergenic
1054355191 9:64054154-64054176 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1054400353 9:64710833-64710855 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054433944 9:65195091-65195113 CTGGAGAGACAGGTCTGGCCAGG - Intergenic
1054496443 9:65826579-65826601 CTGGAGAGACAGGTCTGGCCAGG + Intergenic
1054537446 9:66245921-66245943 CTGAGGTGCCTGATGGGGCCAGG - Intergenic
1055662405 9:78518304-78518326 CAGAAGAGACAGAATGGGACTGG + Intergenic
1056235939 9:84594443-84594465 ATGAAGAAAGGGATGGGGCCTGG + Intergenic
1056635298 9:88326589-88326611 ATGAAGAGATACATAGGGCCAGG - Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059809552 9:117840566-117840588 CTGAAGTGAAAGATGGGACCCGG - Intergenic
1060491465 9:124088293-124088315 CAGAAGGCACAGATGAGGCCAGG - Intergenic
1061161543 9:128898405-128898427 GTAAAGAGACAGGCGGGGCCTGG - Intronic
1061325143 9:129859145-129859167 CTGAGGACACACCTGGGGCCGGG - Intronic
1061391662 9:130320372-130320394 CTTCACAGACATATGGGGCCTGG - Intronic
1061427752 9:130510852-130510874 CTGAGAAGACAGATGGGGTTTGG - Intergenic
1061451434 9:130669001-130669023 CAGAGGAGACAGACAGGGCCAGG + Intronic
1061888635 9:133606071-133606093 CTGGAGAGTCAGGTGGGGTCCGG - Intergenic
1062035891 9:134382372-134382394 CTGGGGAGACAGTGGGGGCCAGG + Intronic
1062052412 9:134454452-134454474 TGGAGGAGACAAATGGGGCCTGG - Intergenic
1062477360 9:136735334-136735356 CAGCAGAGACAGCTGCGGCCGGG - Intergenic
1062588420 9:137261775-137261797 ATGAAAAGACAGCTGGGCCCGGG + Intronic
1202794918 9_KI270719v1_random:113546-113568 CTGAGGTGCCTGATGGGGCCAGG + Intergenic
1203703801 Un_KI270742v1:18220-18242 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1203718267 Un_KI270742v1:176870-176892 TAGAAGAGACACATAGGGCCAGG + Intergenic
1203532948 Un_KI270743v1:1352-1374 TAGAAGAGACACATAGGGCCAGG - Intergenic
1203566594 Un_KI270744v1:96260-96282 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1203652485 Un_KI270751v1:140563-140585 TAGAAGAGACACATAGGGCCAGG + Intergenic
1185586611 X:1245949-1245971 TCTAAGAGACAGAAGGGGCCGGG + Intergenic
1186898752 X:14031461-14031483 CAGATAAGTCAGATGGGGCCTGG + Intergenic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189256345 X:39642600-39642622 CAGAGGAGAAAGATGGGGGCAGG + Intergenic
1190054674 X:47174731-47174753 GGGAAGAGAGAGATGGGGCTCGG - Intronic
1195111765 X:101657223-101657245 CCCAAGAGGCAGATGGAGCCGGG - Exonic
1195316030 X:103679208-103679230 TTAAAGAGACAGATAAGGCCGGG + Intronic
1198530365 X:137546144-137546166 TTGAAGATATAGATGGGGCAGGG + Intergenic
1201172422 Y:11281720-11281742 TAGAAGAGACACATAGGGCCAGG + Intergenic
1202579589 Y:26365858-26365880 CAGTAGAGATAGATGGGGCCTGG + Intergenic