ID: 952945332

View in Genome Browser
Species Human (GRCh38)
Location 3:38475084-38475106
Sequence CACCCTGCCCAGAGGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 403}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952945332_952945340 20 Left 952945332 3:38475084-38475106 CCCTGTGGCCTCTGGGCAGGGTG 0: 1
1: 0
2: 3
3: 58
4: 403
Right 952945340 3:38475127-38475149 GGGTGCTGCTGCAGGCAGACAGG 0: 1
1: 0
2: 0
3: 42
4: 440
952945332_952945339 12 Left 952945332 3:38475084-38475106 CCCTGTGGCCTCTGGGCAGGGTG 0: 1
1: 0
2: 3
3: 58
4: 403
Right 952945339 3:38475119-38475141 CAGTAATTGGGTGCTGCTGCAGG 0: 1
1: 0
2: 1
3: 13
4: 136
952945332_952945335 -1 Left 952945332 3:38475084-38475106 CCCTGTGGCCTCTGGGCAGGGTG 0: 1
1: 0
2: 3
3: 58
4: 403
Right 952945335 3:38475106-38475128 GCTTCGAATAACCCAGTAATTGG 0: 1
1: 0
2: 0
3: 0
4: 26
952945332_952945336 0 Left 952945332 3:38475084-38475106 CCCTGTGGCCTCTGGGCAGGGTG 0: 1
1: 0
2: 3
3: 58
4: 403
Right 952945336 3:38475107-38475129 CTTCGAATAACCCAGTAATTGGG 0: 1
1: 0
2: 0
3: 5
4: 60
952945332_952945341 21 Left 952945332 3:38475084-38475106 CCCTGTGGCCTCTGGGCAGGGTG 0: 1
1: 0
2: 3
3: 58
4: 403
Right 952945341 3:38475128-38475150 GGTGCTGCTGCAGGCAGACAGGG 0: 1
1: 0
2: 2
3: 44
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952945332 Original CRISPR CACCCTGCCCAGAGGCCACA GGG (reversed) Intronic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
901764403 1:11490727-11490749 CACCGTGCCCTGATGCCAAAAGG - Intronic
902348261 1:15835114-15835136 CGCCCCGCCCAGGGGCAACAGGG + Intergenic
902362076 1:15947377-15947399 CACCCTGCACAGAGGACAGGAGG + Intronic
902513014 1:16976380-16976402 CACACTGCCAAGAGCCCACATGG + Intronic
902925209 1:19691395-19691417 GTCCCTGCCCAGAGGTCACCTGG - Intronic
903070460 1:20724531-20724553 AGCCCTGCCCAGGGCCCACAGGG - Exonic
903263262 1:22142617-22142639 CTCCCTGCCCAGAGGCGTCAGGG - Intronic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904160519 1:28519069-28519091 CACCCTGCCCAGGAGGCTCAGGG + Intronic
904267589 1:29326497-29326519 CAGCCTGACCAGGAGCCACAGGG - Intronic
904363936 1:29998795-29998817 CATTCTGTGCAGAGGCCACAGGG + Intergenic
905294097 1:36943181-36943203 CACCCTGTGCAGAGGCTACCAGG - Intronic
905872529 1:41413232-41413254 CACCCACACCTGAGGCCACAGGG - Intergenic
905970259 1:42136584-42136606 GACACAGACCAGAGGCCACATGG - Intergenic
906669394 1:47643640-47643662 CACACTCCCCAGAGGACTCAAGG - Intergenic
907554804 1:55334541-55334563 CTCCCTGCCCAGGAGCCACTGGG - Intergenic
907679171 1:56547690-56547712 CACCCTGCCCAGCTGCCCAAGGG + Intronic
908182376 1:61618810-61618832 CACCCTTCCCAGAAACCAAAAGG - Intergenic
911042640 1:93603242-93603264 GACCCAGCCCAGTGGGCACATGG + Intronic
912546925 1:110457560-110457582 CCACCTGCCCAGAGCCCACGAGG - Intergenic
912583230 1:110738370-110738392 CATCCTGCCCAGAGGGCACCTGG + Intergenic
913200280 1:116490637-116490659 CACCCTGCCCAAAGCTCAGAAGG + Intergenic
913411963 1:118561995-118562017 CACCCTGTCCAGAGGCTGTAGGG - Intergenic
913662845 1:121020041-121020063 CGCACTGCCGAGAGGCCAGAAGG + Intergenic
914014229 1:143803303-143803325 CGCACTGCCGAGAGGCCAGAAGG + Intergenic
914163593 1:145157893-145157915 CGCACTGCCGAGAGGCCAGAAGG - Intergenic
914652849 1:149711861-149711883 CGCACTGCCGAGAGGCCAGAAGG + Intergenic
915178611 1:154038631-154038653 CACCATGCCCAGCAGACACAGGG + Intronic
915457964 1:156053357-156053379 CACCACGCCCCCAGGCCACAAGG + Intronic
915528673 1:156490995-156491017 GAGCCAGCCCAGAGGCCATAAGG - Intronic
917291715 1:173477642-173477664 GACGCTGAGCAGAGGCCACACGG - Intronic
918259466 1:182782494-182782516 CCCCCTGCCACGAGGCCACTGGG - Intergenic
921936620 1:220802012-220802034 CACCCCGCTCTGAGGACACATGG + Intronic
922479172 1:225927022-225927044 CACCCTCCCCATAGTCCACCAGG + Intergenic
922541614 1:226424477-226424499 CACTCTGCCAATAGGCCAGAGGG - Intergenic
922967613 1:229704240-229704262 CACCCTTCCCTGAGGCTCCATGG + Intergenic
922980108 1:229818530-229818552 CAGCCTTCCCAGAGGTCAGAAGG + Intergenic
924038227 1:239957402-239957424 CACCCAGCCCTCAGGGCACATGG - Intergenic
924268990 1:242312773-242312795 CACCCTGCCCCAAGGCAGCATGG - Intronic
1064937530 10:20694930-20694952 AACCCTGCACAGAGGCCAGTTGG - Intergenic
1066351628 10:34642020-34642042 GACACTGCCCAGAGCCCACCGGG + Intronic
1066651611 10:37661339-37661361 CAACCTGTGCAGAGTCCACATGG - Intergenic
1067032060 10:42884746-42884768 CACCCTCCGCAGAGTCCCCAGGG - Intergenic
1067035393 10:42911769-42911791 CAACCTGTGCAGAGTCCACATGG - Intergenic
1067169438 10:43894402-43894424 CACCCTACCCAGCTGCCACAGGG + Intergenic
1067578115 10:47420459-47420481 CACCCAGCCCAGTGAACACAGGG + Intergenic
1069064546 10:63928758-63928780 CCCCATGCCTAGAGTCCACATGG - Intergenic
1071471494 10:85987150-85987172 CACCCAGCCCAGTAGCCTCAGGG + Intronic
1072948902 10:99835478-99835500 CCCCTTGCCCTCAGGCCACAGGG + Intronic
1073860488 10:107732635-107732657 CAGCCTGTGCAGAGCCCACAGGG - Intergenic
1075024568 10:118975118-118975140 CCCCCAGCCAAGAGCCCACAAGG - Intergenic
1075083629 10:119399911-119399933 CAGCCTGAACAAAGGCCACAAGG - Intronic
1075475217 10:122728396-122728418 CTCCCTTCCCAGTGGCCACAGGG - Intergenic
1075693651 10:124418444-124418466 CACCCGGCCCAGAGACCCCGAGG - Intronic
1076345363 10:129775414-129775436 GACCATGCCCAGAAGCCAGAGGG + Intergenic
1076543121 10:131226981-131227003 CTCCCTGCCCAGAGCCCACCTGG - Intronic
1076821388 10:132941770-132941792 CTCCCTGCCCAGAAGCACCACGG + Intronic
1077024484 11:433179-433201 GCCCCTGCCCTGAGACCACACGG + Intronic
1077228254 11:1447613-1447635 CACCCTGCCCAGCAGTCACACGG + Intronic
1077412990 11:2412094-2412116 CAAGCCGCCCTGAGGCCACACGG + Intronic
1077454372 11:2669579-2669601 CATCCTGCCCACAGGACACTGGG + Intronic
1077496822 11:2890635-2890657 CATCCAGCCCAGAGGCCCCAGGG + Intronic
1078734220 11:14005238-14005260 CAACCATCCCAGAGGACACAGGG - Intronic
1079245876 11:18751942-18751964 CACCATGCCCAGTGACTACATGG - Intronic
1080590551 11:33719757-33719779 GGCCCTGCCCACAGGCCCCAGGG - Intronic
1080921492 11:36713773-36713795 CACACAGCCCAGTGTCCACAGGG - Intergenic
1081968603 11:47184121-47184143 GACCCTGCCCAGAGGCAGGAGGG - Intronic
1082004386 11:47411749-47411771 CACCCTGCCAAATGCCCACAGGG - Intronic
1083407140 11:62465324-62465346 CACCATGCCCAGCGACCGCACGG - Intronic
1083681637 11:64354293-64354315 CCCCCTGCCCTGATGCCACCAGG + Intronic
1083684937 11:64370254-64370276 CGCCCTGGCCAGAGGCCCCCTGG - Exonic
1083961260 11:66016206-66016228 CCCCTTGCCCTGAGGCCAGAAGG + Intergenic
1084410165 11:69002269-69002291 CACCCTTCCCACATACCACATGG + Intergenic
1084422506 11:69067366-69067388 CAGCCTGCTGGGAGGCCACAGGG + Intronic
1084651202 11:70490444-70490466 CACAGGGCCCAGAGACCACAAGG + Intronic
1084734187 11:71093927-71093949 CACCCTGTCCAGAGGCGCCGTGG + Intronic
1084769852 11:71335505-71335527 CACACAGCCCAGAGGCCAGCTGG - Intergenic
1085388548 11:76170769-76170791 CAGCCTCACCACAGGCCACAGGG - Intergenic
1085399666 11:76228268-76228290 AACGCTGCCCAGAGGCCTCGGGG - Intergenic
1085521953 11:77144323-77144345 TAACCTGCCCAGAGCCCCCAGGG + Intronic
1085523893 11:77153441-77153463 CACTCTGCCCACAGCCCAGAGGG - Intronic
1085731297 11:79001549-79001571 CAGCCTGCGCAGAGCCCAAAGGG + Intronic
1086169138 11:83815760-83815782 CTCCCTGCACACAGGCCTCATGG + Intronic
1086437035 11:86791752-86791774 CACCTTGAACAGAGGTCACAGGG - Intronic
1086663924 11:89456764-89456786 CAGCCTGTGCAGAGCCCACAGGG + Intronic
1087936244 11:104037180-104037202 CCCGCTGCCCAGCGGTCACAGGG + Exonic
1089353035 11:117832138-117832160 TTCCCTGCCCAGTGGCCATACGG - Intronic
1089603464 11:119628530-119628552 GGCCCTGCCCAGAGGGCCCAGGG - Intronic
1089613142 11:119680843-119680865 CTCCCTGGGCAGAGGCCCCATGG + Intronic
1089622991 11:119733096-119733118 CACCCTGCTCTGAGGCTTCAAGG + Intergenic
1089655432 11:119943745-119943767 GAATCTGCCCAGAGGCCACAGGG - Intergenic
1090269820 11:125378311-125378333 CCCACTGCTCAGAGGACACAAGG - Intronic
1090736349 11:129614846-129614868 CAGCCTGTCTAGAGTCCACAAGG + Intergenic
1092165867 12:6341842-6341864 CACACTGCCCTGAGCCCAAATGG - Exonic
1092280139 12:7092146-7092168 CTCCCTGCCAAGAGCCCAGAGGG + Intronic
1092514309 12:9192586-9192608 TACCCTGCCCTGTGGCCACACGG - Exonic
1092804970 12:12212926-12212948 CACTTTGCCCAGATGCCGCAGGG + Intronic
1092992141 12:13913115-13913137 CTCAATGCCCAGAGTCCACATGG + Intronic
1093084413 12:14851087-14851109 CACCCTCCCCCCAGGGCACATGG - Intronic
1095530192 12:43177997-43178019 CAGCCTGTGCAGAGGTCACATGG - Intergenic
1095982280 12:47980398-47980420 CACACAGCCCACATGCCACATGG + Intronic
1096239865 12:49954046-49954068 CTCCCAGCCCAGAGGCCCCCTGG + Intronic
1097788703 12:63790446-63790468 TACACTGCCCAGAGGTGACAGGG - Intronic
1101880411 12:108622347-108622369 CACCCTGGAAAGTGGCCACAGGG + Intronic
1102876858 12:116455660-116455682 AACCTTGTCCAGAGGCTACAGGG + Intergenic
1103218561 12:119223764-119223786 CTCCCTGCCCTGAGTCCCCAAGG + Intergenic
1103735018 12:123055462-123055484 CAGCCTGCCCAGCGTGCACACGG + Intronic
1104963264 12:132498084-132498106 CACCCTCCCCAGAGGCCCTGTGG - Intronic
1104990160 12:132620144-132620166 TCCCCTGACCAGAGGCCAAACGG + Intronic
1105841649 13:24259072-24259094 CACCCAGCTCAGAGTGCACAAGG - Intronic
1106371306 13:29136492-29136514 TCCCCTGCCCAGAGGCTGCAGGG - Intronic
1107112939 13:36717101-36717123 CTTCTTGCCCTGAGGCCACAGGG + Intergenic
1108035991 13:46291114-46291136 CACATTGCCTAGGGGCCACACGG - Intergenic
1108394099 13:49976425-49976447 TGCCCTGCCCAGAAGCAACACGG - Intergenic
1108409769 13:50133979-50134001 ACCCCTGCTCAGAGGCCACTGGG - Intronic
1110369471 13:74724271-74724293 CAGCATGTCAAGAGGCCACATGG - Intergenic
1113104707 13:106759529-106759551 CACTCAGCTCAGAGGCCTCATGG + Intergenic
1113526387 13:110981141-110981163 CTCCCTGCCCAGCTGCCACTGGG + Intergenic
1114112824 14:19488615-19488637 CACTTTTCCCAGAGGCCACTAGG + Intergenic
1114219568 14:20684428-20684450 CACCCGCCCCAGGGGCCGCAGGG - Exonic
1115907860 14:38221342-38221364 CACCTAGACCAGAGGCTACAAGG - Intergenic
1117100214 14:52338253-52338275 CAACCTGCACAGATGCAACAAGG + Intergenic
1117261776 14:54042384-54042406 AACCCATCCCACAGGCCACACGG - Intergenic
1118827215 14:69394869-69394891 CAGCCTACCAAGAGGCCAGAAGG - Exonic
1118839120 14:69497830-69497852 AACCCTGAGCAGGGGCCACAGGG + Intronic
1118964081 14:70563190-70563212 CACCCTTCCCTGAAGCCAGAAGG + Intergenic
1119176107 14:72568640-72568662 CGCCCTCCCCAGACCCCACATGG + Intergenic
1119666990 14:76491782-76491804 AGCCCTGCCCACAGGCCCCAGGG - Intronic
1119720304 14:76885492-76885514 CACCCAGCCCAGAGGGCTCTGGG - Intergenic
1119895726 14:78218479-78218501 AAACCTGGCCAGATGCCACAGGG + Intergenic
1121005376 14:90487323-90487345 GACCCTGCCCAGTGGGCAGAGGG + Intergenic
1121016824 14:90554015-90554037 CAGCCTGGCCAGAAGCCAAAGGG + Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121868217 14:97382395-97382417 GACCCAGCACACAGGCCACATGG - Intergenic
1122190864 14:100042548-100042570 CACCCTGGCCAGAGGTCGCTGGG - Intronic
1122617758 14:103032081-103032103 GCCGCTGCCCTGAGGCCACAAGG - Intronic
1122768932 14:104088608-104088630 CTCCCTGCCCGGTGACCACACGG + Intronic
1123017139 14:105380870-105380892 CACCCGAGCCAGAGGCCACAGGG + Intronic
1123049324 14:105533018-105533040 CTCCCTGCCCTGCGGCCACCAGG + Intergenic
1124254312 15:28128767-28128789 CTCCCTTCCCAGAGGCCCCAGGG + Intronic
1124667447 15:31605444-31605466 CACCCACCCCAGAGGGCCCAGGG - Intronic
1124892841 15:33748661-33748683 CACCTTGTGCAGAGGCCACAGGG + Intronic
1125381726 15:39092998-39093020 CTCCTGGCCCAGAGACCACAGGG + Intergenic
1125608691 15:40956802-40956824 CATCCTGCCCAGCTGCCCCAAGG + Intergenic
1125734918 15:41918147-41918169 CACCCTTCCCAGAGCACTCATGG + Intronic
1127368141 15:58310398-58310420 CACCCTGCACAAGGGCCGCAGGG - Intronic
1129064290 15:72888415-72888437 CATCCTGCCCAGAGGCAACAGGG - Intergenic
1130881377 15:88058709-88058731 TAACCTGCCCACAAGCCACATGG + Intronic
1130913970 15:88290562-88290584 CACCCTGCCCAGATCCTTCACGG + Intergenic
1131034079 15:89209813-89209835 CAGCCTGCCTAGAGGCCACCAGG + Intergenic
1131134149 15:89920537-89920559 CAGGCAGCCCAGAGGCAACAAGG + Intergenic
1131153081 15:90059216-90059238 CAGCCTGTGCAGAGGCCCCAAGG + Intronic
1132062864 15:98707104-98707126 CACCCTGCCTGAAGGACACAGGG - Intronic
1132075150 15:98813554-98813576 CACCATGCCAAGGGGCCACACGG - Intronic
1132147125 15:99435606-99435628 CACCCTGCCATGAAGCCCCAGGG - Intergenic
1132586098 16:706242-706264 GACCCGGCCCAGAGGAGACAGGG + Intronic
1132620584 16:866330-866352 CACCCTACCCAGAAACAACAAGG - Intronic
1132799413 16:1744283-1744305 AACCCAGCCCACAGGCCCCAAGG - Intronic
1132937472 16:2488389-2488411 CACCGTGCCCTCTGGCCACAGGG - Intronic
1133117280 16:3584657-3584679 CACCAGACCCAGAGACCACACGG + Intronic
1133241403 16:4416380-4416402 CCCCCTGCCCGGACCCCACAGGG - Intronic
1134063439 16:11212381-11212403 CGCACTGCCCAGAGGGCAGAAGG + Intergenic
1134185862 16:12084584-12084606 CTCCCGGCCCTGAGGGCACATGG - Intronic
1134464904 16:14466911-14466933 GACCCTGCCCAGATGCCATTAGG - Intronic
1134913497 16:18050199-18050221 CACCCTGACCAGTGGACAAAGGG - Intergenic
1136576942 16:31130685-31130707 CATCCTGGCCAGATCCCACAAGG + Intronic
1136654986 16:31704175-31704197 CAGCCCGGTCAGAGGCCACATGG - Intergenic
1137608704 16:49804561-49804583 CAGCCTGACCACAGGCTACAAGG + Intronic
1138210500 16:55159188-55159210 CATCCTAATCAGAGGCCACATGG - Intergenic
1138446369 16:57066693-57066715 CACCCTGCCCAGAGACCTTAGGG + Intronic
1139633528 16:68244842-68244864 CACCCTGCCCCGAGGGCACCTGG - Intergenic
1141712013 16:85705188-85705210 CTGCCTCCCCAGAGGCCCCATGG + Intronic
1142342614 16:89533602-89533624 CACCCTCTCCAGGGGGCACAGGG - Intronic
1142359962 16:89621293-89621315 CACCCTGCCCAGGCCCCCCACGG - Intronic
1142428195 16:90011774-90011796 CTCTCCGCCCAGAGGGCACAGGG + Intronic
1142804937 17:2366518-2366540 CACCAGGCTCAGAGGGCACACGG + Intronic
1143003934 17:3814573-3814595 ACCCCTGCCCCGAGGACACAGGG + Intronic
1143367033 17:6415143-6415165 CTCCCTGGCCAGAGGGCACTAGG + Intronic
1145206585 17:20987685-20987707 CCCCCTTCCCAGAGGGCACTGGG + Intergenic
1145246724 17:21274573-21274595 CACCCTCCTTGGAGGCCACATGG - Intergenic
1146054807 17:29575749-29575771 CACACTGCCCCTAGCCCACACGG + Intronic
1146937478 17:36821266-36821288 CAATGTGTCCAGAGGCCACAGGG - Intergenic
1146937922 17:36824097-36824119 CACCTTCCCCAGAGGCACCATGG + Intergenic
1146949088 17:36893365-36893387 CACCCAGCCCAGAGCTCCCAGGG + Intergenic
1146949849 17:36898328-36898350 CACCCAGCCCAGAGCTCCCAGGG - Intergenic
1147886517 17:43687965-43687987 CCTCCTCTCCAGAGGCCACAAGG - Intergenic
1148079038 17:44957442-44957464 CACCTTTCCCAGAGGCCACTGGG - Intergenic
1148134527 17:45283805-45283827 CACCCTGCCCAGAGGGCCAAGGG + Intronic
1148700159 17:49582278-49582300 CACTCTGCCCAGACCCCAAAGGG + Intronic
1148769477 17:50058577-50058599 CAGCCTGCCAAGAGCCCAGAAGG + Intronic
1149009890 17:51845365-51845387 CAGCCTGCAGAGAGGCCCCATGG + Intronic
1149906288 17:60529168-60529190 CACCATCACCACAGGCCACAGGG - Intergenic
1149993049 17:61393395-61393417 CACACTTCCCAGAGACCCCAGGG + Intergenic
1150008192 17:61482680-61482702 GACCCTACTCAGAGGCCACGGGG - Intronic
1150069698 17:62140290-62140312 CTCTTTGCCCAGCGGCCACAGGG + Intergenic
1150656950 17:67045428-67045450 CTCCAGGCCCAGAGCCCACAAGG - Intronic
1150934304 17:69618490-69618512 CATCTTGTCCAGAGGCCTCATGG - Intergenic
1151598869 17:75094235-75094257 CATCCTGCCCAGCTCCCACATGG + Intronic
1151635212 17:75342702-75342724 CACCCTGCCTAAAGGCCATGTGG + Intronic
1151765643 17:76132043-76132065 CACCCCGCCCACAGCCCCCAGGG - Intergenic
1151917390 17:77128300-77128322 GCGCCTGACCAGAGGCCACAGGG + Intronic
1151935409 17:77258017-77258039 CACCCTGCCCAGGGGCCTCTGGG - Intergenic
1151935422 17:77258051-77258073 CACCCTGCCCAGGGGCCTCTGGG - Intergenic
1151968406 17:77444389-77444411 CTTCCTGCCCAGACCCCACAAGG - Intronic
1152079801 17:78179650-78179672 TACCCTGCCCGGACGTCACAGGG - Intronic
1152290952 17:79440042-79440064 CACCCGGGCCAGAGGGCACTTGG + Intronic
1152330930 17:79672654-79672676 CACCATGCTCAGAGGCAGCAAGG - Intergenic
1152730669 17:81968056-81968078 CTGCCTCCCCAGAGGCCACGTGG - Intergenic
1153043794 18:837698-837720 CACAGTCACCAGAGGCCACATGG + Intergenic
1153840622 18:9004833-9004855 CACCTTCCCCAGAATCCACAAGG - Intergenic
1155181506 18:23352219-23352241 CACACTGCCCTGGGGCCAGAAGG + Exonic
1155347814 18:24875988-24876010 CACCCTTCCCTCAGGCCACTGGG + Intergenic
1157157250 18:45280285-45280307 CACCATGCCCAGACTCCTCAGGG - Intronic
1157293862 18:46427876-46427898 CACCCTGCCCACCAGCCCCAGGG - Intronic
1157453048 18:47802119-47802141 CTTCCTGCCCAGAGGCTAGAAGG - Intergenic
1157520528 18:48342279-48342301 CCCCCTGCCCAGAGCCCAAGTGG + Intronic
1157616608 18:48991149-48991171 CACCCTGCCCTGAGGCTGGATGG + Intergenic
1157972256 18:52284060-52284082 CAGCCTGTCCAGAAGACACATGG + Intergenic
1158587731 18:58756097-58756119 CTTCCTGACCAGATGCCACAGGG + Intergenic
1159603690 18:70452785-70452807 GATGCTGCCCAGAGACCACAGGG - Intergenic
1160062355 18:75544105-75544127 AACTCTGCCCAGAGGCAGCACGG + Intergenic
1160617026 18:80138110-80138132 CATCATGCCCACAGTCCACACGG + Exonic
1161349245 19:3783287-3783309 CACCCCACCCAGAGGCCACCCGG - Intronic
1162033422 19:7926889-7926911 CACAGTGCCAAGAGGCCCCAGGG - Exonic
1162412889 19:10517249-10517271 CCCCCTCCCCAGAGGCCTCCAGG + Intronic
1162496999 19:11028995-11029017 CAACCTGCCCAGGTGCCACCCGG + Intronic
1162532045 19:11241742-11241764 CTCCCTGCACAGGGGCCTCACGG - Exonic
1162753538 19:12843494-12843516 CAAGGTGCTCAGAGGCCACAAGG - Intronic
1162958816 19:14114296-14114318 AACCCAACCCAGAGGCCACTGGG + Intronic
1163612449 19:18308507-18308529 CACCCAGCACATGGGCCACAGGG - Intronic
1163686979 19:18717333-18717355 CACCAAGGACAGAGGCCACAAGG - Intronic
1166079329 19:40433989-40434011 CTCCCTCCCCAGAGGCCGGACGG - Intergenic
1167476826 19:49706181-49706203 CATCCTGCCCAGCCGCCACCTGG - Intronic
1168013492 19:53553838-53553860 CACCCCACTCAGAGGCCAGACGG + Intronic
1168643942 19:58047828-58047850 CACCCCACCCAGAGGGCACAGGG - Intronic
925145007 2:1575494-1575516 CAGCCTGCACAGAGACCCCAGGG - Intergenic
925189895 2:1874503-1874525 CATCATGCCCTGAGCCCACATGG - Intronic
925241907 2:2338804-2338826 CTCTCTGCCCAGAGGACATAAGG + Intergenic
925574801 2:5349609-5349631 CACCCTCCCCAGGCTCCACAGGG - Intergenic
926195909 2:10763427-10763449 CCCCCTGCCCAAGGTCCACAGGG - Intronic
927127255 2:20023065-20023087 CACCAAGCCCAGAGGCCTCTTGG + Intergenic
927476057 2:23414978-23415000 AACCAGGCTCAGAGGCCACATGG + Intronic
927865456 2:26584799-26584821 CACCCACCCCAGAGTCCCCAGGG - Intronic
928215021 2:29354256-29354278 CACGCAGCGCAGAGACCACAGGG - Intronic
929545939 2:42855327-42855349 CTCCCTGCCCACAGGCCAACTGG + Intergenic
929967282 2:46544531-46544553 AACCCTGGCCAGAGGCTGCAGGG - Intronic
930021054 2:47002551-47002573 CTCACTGCCCTCAGGCCACATGG - Intronic
932406555 2:71516537-71516559 GACCCTGACCTGAGGCCCCAGGG - Intronic
934078919 2:88451731-88451753 CACCCAACCCAGAGGACAAAGGG - Intronic
934522064 2:95025822-95025844 CACCCTGCCCAGTGGCTTCTCGG + Exonic
934721142 2:96577670-96577692 CACAGTGCCCAGAGACCACGTGG - Intergenic
935105646 2:100040859-100040881 CACCCTCCAAGGAGGCCACAGGG + Intronic
936027902 2:109047293-109047315 CACTCTTCCTAGAGGTCACAGGG + Intergenic
936283352 2:111161717-111161739 TACCCTGGCCAGAAGCCACTGGG + Intronic
937232215 2:120404837-120404859 CCCCCTGTCCAGTGTCCACATGG + Intergenic
937397188 2:121547227-121547249 CTCCCTGGACAGAGACCACATGG + Intronic
937968977 2:127535512-127535534 CATGCTGCCCGGAGGCCACCAGG - Intergenic
938427443 2:131203129-131203151 CACCCGGCCCAGAGGGGGCAGGG - Intronic
938468387 2:131537177-131537199 CACCCGGCCCAGAGGGGGCAGGG - Intergenic
938689767 2:133776881-133776903 CACCAGGCCCAGAGGACGCAGGG + Intergenic
938734607 2:134175028-134175050 CACCCTGCCCATGGGCCAGGAGG - Intronic
942885603 2:180919714-180919736 CACCCTACCCAGAGGCACCAAGG + Intergenic
942901910 2:181129966-181129988 CACCCTGCCCAGATCCCACTAGG - Intergenic
945739222 2:213640932-213640954 CACCTTGCCCTGAGGCCACCAGG + Intronic
945851335 2:215011519-215011541 CCCTCTTCCCAGAGGCCAAAAGG - Exonic
946434213 2:219641262-219641284 CACCCGGCTGAGAGGCTACAGGG + Intronic
947137887 2:226993293-226993315 CACCCTGACTCCAGGCCACAGGG - Intronic
947263658 2:228252428-228252450 CAGCCTGTGCAGAGCCCACAGGG - Intergenic
948183539 2:236001455-236001477 CACTCTGCCCAGCCGCCAGAGGG - Intronic
948389406 2:237601270-237601292 CACCCTGCACAGAGGTCACCAGG + Intronic
948403641 2:237701976-237701998 CACCCAGCCCACAGGCCAGCTGG - Intronic
948785990 2:240353255-240353277 CACCCTGCCCAGGGTCCATCTGG + Intergenic
948825130 2:240570318-240570340 CTCCCTGCCCAGAGTACCCAAGG - Intronic
948858827 2:240743158-240743180 CTCCCACCCCAGAGGCCACAGGG + Intronic
948903758 2:240968327-240968349 CACCCTGCAGGGAGGCCACAGGG + Intronic
948941551 2:241199514-241199536 CTCCCTGCTCAGAGGCCTCAGGG + Intronic
948947489 2:241228469-241228491 CACCCCGCCCACAGGCCATCCGG - Exonic
949050164 2:241893495-241893517 CACACTGCCCAGAGGCCAGACGG - Intergenic
1168813640 20:722112-722134 CAGCCTGCAGAAAGGCCACATGG + Intergenic
1170042505 20:12053235-12053257 TAGGCTGCACAGAGGCCACATGG - Intergenic
1172285984 20:33740794-33740816 CACCGTACCCAGCCGCCACAGGG + Intronic
1173222347 20:41140356-41140378 CAACCTCCTCAGAGGCCGCAGGG - Intronic
1173503802 20:43571722-43571744 CTTCCTGCCCAGCTGCCACAAGG + Intronic
1173575879 20:44112784-44112806 CACCCTGCCCCCTGGCCACCTGG + Exonic
1174242612 20:49149877-49149899 CACCCTGCCCAAGGTCCACTCGG + Intronic
1174384767 20:50180687-50180709 CAGCATGTGCAGAGGCCACATGG + Intergenic
1175171760 20:57085950-57085972 CTCCCTCCCCAGAGGCCTCAGGG + Intergenic
1175929019 20:62484857-62484879 AACCCTGCCCACAAGCAACAGGG - Intergenic
1176377165 21:6092420-6092442 CACCCGGCCAAGAGCCCACATGG - Intergenic
1178115484 21:29412371-29412393 CACCCTGTGCAGAGCCCACGTGG - Intronic
1179218963 21:39389712-39389734 CACCCTGGCAAGAGGCATCAGGG - Intronic
1179448971 21:41454826-41454848 CACCCAGCACAGAGGCCTCCTGG + Intronic
1179720623 21:43314209-43314231 CCCCGTGCCCTGAGGCCACCAGG - Intergenic
1179728788 21:43355799-43355821 CACCCTCTCCAGCGGCCTCAGGG - Intergenic
1179746310 21:43445824-43445846 CACCCGGCCAAGAGCCCACATGG + Intergenic
1179908772 21:44437270-44437292 CTCCCTGCCCAGGGGCTGCAGGG - Intronic
1179971257 21:44837611-44837633 CACCCTGTGCCGTGGCCACAGGG - Intergenic
1180786436 22:18550254-18550276 CACCATGCCCAGAGTCCACGAGG - Intergenic
1180875949 22:19175339-19175361 GATCTTGCCCAGAGGCCACAGGG + Intergenic
1180952065 22:19724923-19724945 CACACTCCCAAAAGGCCACATGG + Intergenic
1181131718 22:20735973-20735995 CACCATGCCCAGAGTCCACGAGG - Intronic
1181243357 22:21489807-21489829 CACCATGCCCAGAGTCCACGAGG - Intergenic
1181522716 22:23458761-23458783 AACCCTCCCCAGGAGCCACAGGG - Intergenic
1181538949 22:23562908-23562930 CACCATGCCCAGAGACCAGATGG + Intergenic
1181661277 22:24350983-24351005 CACTCTCCTCAGAGGCCACCTGG - Intronic
1182078531 22:27512084-27512106 AAGCCTTCCCAGATGCCACAGGG - Intergenic
1182752293 22:32651401-32651423 AACCCTACCCAGAGGCCAGCTGG - Intronic
1183028412 22:35083901-35083923 CAGCCGGCCAAGAGGCCCCAGGG + Intronic
1183058264 22:35320037-35320059 CAGCCTGGCCAGTGGCCACTGGG - Intronic
1183949210 22:41343401-41343423 CACCCTGCCCATAGGCCCCCGGG + Exonic
1184305902 22:43601807-43601829 CACCCTTCCCAAAGGCCATGTGG + Intronic
1184548806 22:45192815-45192837 AACCCAGCCCTGAGGCCACTCGG + Intronic
1185009285 22:48304291-48304313 CACCAGGCCCAGAGTGCACAGGG + Intergenic
1185078093 22:48694033-48694055 GTCCCTGCCCACAGGCCACGCGG + Intronic
1185084732 22:48734522-48734544 CACACTGCCCAGAGCCCAGACGG - Intronic
1185234556 22:49704553-49704575 CTGGCTGCCCAGAGGCCACAGGG - Intergenic
950473006 3:13198009-13198031 AGCCCTGCCCCGGGGCCACAGGG - Intergenic
950625948 3:14246915-14246937 AAGGCTGCCCAGGGGCCACATGG + Intergenic
952238513 3:31505842-31505864 GACCCTTCACTGAGGCCACAGGG + Intergenic
952945332 3:38475084-38475106 CACCCTGCCCAGAGGCCACAGGG - Intronic
954157407 3:48694155-48694177 CACACTTCCCTGTGGCCACAGGG + Intronic
954234382 3:49244978-49245000 CTACCTGCCCTGAGGCAACATGG - Intronic
954433333 3:50482947-50482969 CTCACTCCCCAGAGGCCACCTGG + Intronic
954584531 3:51721638-51721660 CCCCCTGGCAAGAGGCCTCAGGG - Intergenic
954752705 3:52822779-52822801 CACGCTGCCCTCATGCCACAGGG + Intronic
955019929 3:55110066-55110088 CCCCCTGACCACAGTCCACAGGG - Intergenic
957228272 3:77476803-77476825 CACACTGCCCAGATGTCACTCGG + Intronic
960081000 3:113540115-113540137 CAACCTGCACAGAGATCACATGG + Intronic
961021577 3:123511956-123511978 CAGCCTGTGCAGAGGTCACATGG - Intronic
961330827 3:126136965-126136987 CACACTGCCCAGGGGCCTCCTGG + Intronic
961440038 3:126947309-126947331 CTCCCAGCCCAGGAGCCACAGGG - Intronic
961630609 3:128295847-128295869 CCTCCTGCCCAGAGTCCCCATGG + Intronic
962462215 3:135624872-135624894 CACCTGTGCCAGAGGCCACATGG + Intergenic
962652192 3:137507890-137507912 CACTCTGCCCAGAGGTGATAAGG - Intergenic
962835410 3:139184905-139184927 CTCCCTGCCCAGGGGCCCCGTGG - Intronic
963264962 3:143230887-143230909 CACCTTTACCAGAGGCCACGTGG - Intergenic
963919480 3:150892119-150892141 CACCTTGCCCAGAAGTCACTGGG + Intronic
966878422 3:184336373-184336395 CACCCTGAGCAGTGGGCACACGG - Intronic
967015639 3:185479240-185479262 CACCATGCCCAGTGGACACTGGG + Intronic
968233370 3:197017029-197017051 CACCCTGCTGAGCGACCACAAGG + Intronic
968359656 3:198138163-198138185 CCCCCTGCCTAGAGTCGACAAGG + Intergenic
968664449 4:1813439-1813461 CACCCCACCCAGAGGGCACAGGG + Exonic
968752210 4:2396104-2396126 CATCCTGCAGAGGGGCCACAAGG + Intronic
968752236 4:2396205-2396227 CATCCTGCAGAGGGGCCACAAGG + Intronic
968752249 4:2396255-2396277 CATCCTGCAGAGGGGCCACAAGG + Intronic
968752327 4:2396557-2396579 CATCCTGCAGAGGGGCCACAAGG + Intronic
968752353 4:2396658-2396680 CATCCTGCAGAGGGGCCACAAGG + Intronic
968752366 4:2396708-2396730 CATCCTGCAGAGGGGCCACAAGG + Intronic
968869940 4:3236662-3236684 CACCCTGCTCACAGGCACCACGG - Intronic
968873338 4:3252439-3252461 CAACCTGCCCAGAGGCCCTGGGG - Intronic
968986809 4:3880125-3880147 CAGCCTGGGCAGAGGCCAGAGGG - Intergenic
969295750 4:6269957-6269979 CTGCCGGCCCAGAGGCCCCAGGG + Exonic
969703118 4:8778581-8778603 CTCTCTGACCAGGGGCCACAGGG + Intergenic
969844698 4:9911235-9911257 CCCGCTGCCCAGGGGCTACAGGG + Intronic
974942888 4:68489940-68489962 TAGCCTGCACAGAGTCCACAGGG - Intronic
978208236 4:106105029-106105051 CTCCCTGCCCAGAGCCTACAGGG + Intronic
978317222 4:107451811-107451833 CACCCTGCCCAGTGGGAATATGG - Intergenic
980745471 4:137007364-137007386 CACCCTCCCCAGAGGCCAGGAGG - Intergenic
981725701 4:147844958-147844980 AACCTTTCCCAGAGCCCACAAGG + Intronic
985164024 4:187073962-187073984 CAGCCTGCACAGAGGCCATCTGG - Intergenic
985477983 5:90675-90697 CACCCTGACCAGGCGCCACTGGG + Intergenic
985624479 5:977781-977803 CATCCTTCCCAGAGGACCCAAGG + Intergenic
985635286 5:1032911-1032933 CATCCTGCCCAGAGGCTGCGGGG + Intronic
985649940 5:1102757-1102779 CACCCTCCCCTGGAGCCACAGGG + Intronic
985657202 5:1138483-1138505 CACCCTACCCAGAGGCCCAGCGG + Intergenic
985891169 5:2716069-2716091 CACCCTGCCCAGGAGGCCCAGGG + Intergenic
986223551 5:5792211-5792233 CTCTCTGCCCTGTGGCCACAGGG - Intergenic
992208689 5:74456060-74456082 CTCCATGCTCAGATGCCACAAGG + Intergenic
995651630 5:114376304-114376326 CTTCCTGCACAGAGACCACACGG + Intronic
996848796 5:127930441-127930463 CAGCCTGGCCAGAAGCCACAAGG - Intergenic
997352928 5:133243961-133243983 CAGCCTGCACAGCGGCCACTCGG - Intronic
997646435 5:135485039-135485061 CAGTCTGCCCAGAGGCCACCTGG - Intergenic
998132475 5:139658415-139658437 CAGGCTGCCCTGAGGTCACAGGG + Intronic
999343286 5:150792287-150792309 TTCCCTGCCCAGAGGGCACAAGG - Intronic
1001421313 5:171589376-171589398 CACCCTAACCAGATTCCACAGGG - Intergenic
1001438508 5:171719758-171719780 AACCCTGTCCAGTGGCCACAGGG + Intergenic
1001794246 5:174488928-174488950 CAGCCTGCCGAGAGGCGAGACGG - Intergenic
1001921966 5:175607830-175607852 CACCGTGCCCAGCCTCCACATGG - Intergenic
1002071388 5:176680570-176680592 CACCCTCCCTGGGGGCCACACGG - Intergenic
1002074503 5:176700072-176700094 CACTCTGCCCAGAGGTGACGAGG - Intergenic
1002417218 5:179126869-179126891 AAGCCTGCGCAGAGGCCCCAAGG + Intronic
1002484464 5:179524697-179524719 CACCCTTCACACAAGCCACATGG + Intergenic
1002572870 5:180153962-180153984 CATGCTGACCAGGGGCCACATGG - Intronic
1002713000 5:181206085-181206107 CAGCCAGCGCAGAGGCCACGGGG - Intergenic
1003031437 6:2604545-2604567 CACAGTGCACACAGGCCACATGG - Intergenic
1004250625 6:14020368-14020390 CAGCCTGTGAAGAGGCCACATGG - Intergenic
1006140759 6:31928173-31928195 CACCCTGAGCAAAGCCCACAGGG - Intronic
1006717967 6:36132129-36132151 CACCCTGGCTGGAGGCCATAGGG - Intronic
1006795128 6:36727308-36727330 CCCCCTCCCCAGAGGCAACCAGG - Intronic
1006945308 6:37780491-37780513 CCCCCAGGCCAGAGGCCAAATGG + Intergenic
1007547817 6:42707821-42707843 CACACTGCCCAGAGACCACATGG + Intronic
1007644541 6:43369800-43369822 CACCCCGCGCGGAGGCCACAGGG - Intergenic
1008917345 6:56802741-56802763 TTCCCTTCCAAGAGGCCACATGG - Intronic
1010252887 6:73726891-73726913 CTCCTTGACCAGAGGGCACAGGG - Intronic
1010750359 6:79610729-79610751 CAGCCTGCCCTGAGGCAAGAGGG - Intergenic
1013389265 6:109666776-109666798 CAGCCTGGCCAGAGGTCAGATGG - Intronic
1013661306 6:112299525-112299547 AATCCTGCCCAGAGCCCAAAGGG - Intergenic
1015149135 6:130019395-130019417 CGCCCGGCACAAAGGCCACACGG - Intronic
1015203862 6:130613338-130613360 CACTATGCCCAGAAGACACAGGG + Intergenic
1016359211 6:143250044-143250066 CACCATGCTTAGAGGCCCCATGG - Intronic
1016811394 6:148264587-148264609 CAACATGACAAGAGGCCACAAGG - Intergenic
1017082379 6:150682120-150682142 CACCATGCACAGAGGCTGCATGG - Intronic
1017745134 6:157439994-157440016 CACCCCACCAAGAGGCCCCAGGG - Intronic
1018517040 6:164594624-164594646 CAGGCTGCCCACAGGACACAAGG + Intergenic
1019260335 7:78487-78509 CCCCCTGCCTAGAGTCGACAAGG - Intergenic
1019588609 7:1817776-1817798 AACCCTCCCCAGGAGCCACAGGG + Intronic
1021719378 7:23490966-23490988 CACCGTGCGCAGAGGCTACTGGG + Intergenic
1021988581 7:26120706-26120728 CTCACTGCCCAGAGGCTTCAGGG - Intergenic
1023148906 7:37181219-37181241 CAGCATGCCCAGTGGCCACAAGG + Intronic
1023882480 7:44328123-44328145 CACCCTCCCCAGCTGCCACCTGG - Intronic
1024134344 7:46391312-46391334 CACTGTGCTCACAGGCCACAGGG - Intergenic
1024526736 7:50355507-50355529 CACGCAGCCCAGTGGGCACAGGG - Intronic
1026848194 7:73709226-73709248 GTCCCTGCCCAGAGGCCCCCAGG - Intronic
1026896010 7:74010457-74010479 CACCAAGCCCAGCAGCCACAAGG + Intergenic
1026898456 7:74023923-74023945 CTCTCTTCCCAGAGGCCACCAGG - Intergenic
1027531333 7:79337811-79337833 CATCCTGCCTAGCTGCCACATGG + Intronic
1032487273 7:132297264-132297286 CATCCTCCACAGAGGCCACAGGG + Intronic
1032970382 7:137156311-137156333 CAGCCTAGGCAGAGGCCACAGGG - Intergenic
1033190447 7:139274044-139274066 CATCCAGCCCTTAGGCCACAGGG - Exonic
1033591208 7:142809826-142809848 CAAGCTGTCCAGAGGCCCCAGGG + Intergenic
1034646571 7:152652970-152652992 CCTGCTGCCCAGAGACCACAGGG + Intronic
1038016322 8:23518573-23518595 CACACTTCCCTGCGGCCACAAGG + Intergenic
1038415942 8:27396078-27396100 CACCAAGCTCAGAGTCCACAAGG - Intronic
1040284284 8:46092085-46092107 CTCCCTTCCCAGAAGCCCCAAGG + Intergenic
1040285551 8:46098768-46098790 CTCCCTTCCCCGAGGCCCCAAGG + Intergenic
1040302869 8:46197026-46197048 CTCCCTTCCCAGAAGCCCCAAGG + Intergenic
1040656720 8:49519112-49519134 CACCCTGCGCAGAGGCCCAGAGG - Intergenic
1041028088 8:53707381-53707403 CACCCTGCCCAGAGGTGACCGGG - Intergenic
1044378526 8:91504369-91504391 CATCTTGCCCAGAAACCACAAGG - Intergenic
1047055755 8:121163264-121163286 CAACATGCCAAGAGGTCACATGG - Intergenic
1047292329 8:123541292-123541314 CCCCCGGCCCGGAGGCCACGTGG + Intergenic
1047921210 8:129636242-129636264 CTGCCTCCCCAGAGACCACATGG - Intergenic
1049238444 8:141524536-141524558 CACACTGAGCAGAGGCCCCAGGG + Intergenic
1049680205 8:143914786-143914808 CACCCTCCCCGGAGGCCAAGGGG + Intergenic
1050152917 9:2635009-2635031 CAGATTGCCCAGAGACCACAAGG - Intronic
1052766996 9:32651164-32651186 CTCCCTGGGCAGAGCCCACAGGG + Intergenic
1053285538 9:36847604-36847626 CCCCCTCCCCAGTGGCCAGAAGG - Intronic
1055360817 9:75488567-75488589 CTCTCTGACCAGAGGCCAAAGGG - Intergenic
1057266639 9:93621866-93621888 TGCCCTGTCCAAAGGCCACATGG - Intronic
1058887016 9:109329484-109329506 GGCCCTACCCAGCGGCCACACGG + Intergenic
1058942152 9:109823278-109823300 GACCCTGCCCTGAACCCACATGG + Intronic
1059451072 9:114371807-114371829 CACTCTGCTCAGAGCCCACGGGG - Intronic
1060398236 9:123331460-123331482 AACCCTGCTCAGAGGTCAGACGG + Intergenic
1060720381 9:125972585-125972607 CAGCTTGCACAGATGCCACATGG + Intergenic
1060943705 9:127557789-127557811 CACCCTGACCCGAGGCCAACTGG - Intronic
1060962071 9:127688110-127688132 CTCCCCTCCCAGGGGCCACAGGG + Intronic
1061395643 9:130342165-130342187 CACCCTGCAGGGAGGCCCCATGG - Intronic
1061411598 9:130424972-130424994 CACCCAGCCCAGAGTCACCACGG - Intronic
1061917431 9:133762710-133762732 CATACAGCCCAGAGGCCACAAGG + Exonic
1062141037 9:134959347-134959369 CACTCTACCCAGAGGCCCCAGGG - Intergenic
1062289387 9:135787692-135787714 CACCTTCCCCAGCGCCCACAGGG - Intronic
1062349140 9:136130678-136130700 CACCCTGTCCCGAGGACACCAGG + Intergenic
1062501280 9:136853061-136853083 CACCCTGCCCCCAGGCCACCTGG + Intronic
1062539382 9:137034856-137034878 CACCCTGCCCAGGGTCCTCAAGG - Exonic
1185593800 X:1295172-1295194 CACCCTGCCCCAAGGCCAGTGGG + Intronic
1185857124 X:3546206-3546228 AAGCATGCCCAGAGGGCACATGG + Intergenic
1189064913 X:37797094-37797116 CACTCTGCCCAGAGCCCAGTTGG + Intronic
1189414921 X:40805022-40805044 GGCCATGCCCAGTGGCCACAAGG - Intergenic
1190066857 X:47247448-47247470 CCCCCTGCCCAGAACCCCCAGGG - Intronic
1192044238 X:67655200-67655222 CACCCAGCCAAGAGCCCTCAGGG + Intronic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1196626684 X:117885069-117885091 CTCCCTGTCTAGAGGGCACATGG + Intergenic
1197343513 X:125303418-125303440 CTCCCTCCCTAGAGGTCACATGG + Intergenic
1198818029 X:140614119-140614141 CACCATCACCACAGGCCACATGG + Intergenic