ID: 952946148

View in Genome Browser
Species Human (GRCh38)
Location 3:38478970-38478992
Sequence CCCTTACAAATGCTGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952946140_952946148 21 Left 952946140 3:38478926-38478948 CCTCATGCTCTGGGGCCTAGCTT 0: 1
1: 0
2: 2
3: 15
4: 182
Right 952946148 3:38478970-38478992 CCCTTACAAATGCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 189
952946142_952946148 6 Left 952946142 3:38478941-38478963 CCTAGCTTAATACAGGTCTTCTC 0: 1
1: 0
2: 1
3: 13
4: 120
Right 952946148 3:38478970-38478992 CCCTTACAAATGCTGAAGCTGGG 0: 1
1: 0
2: 1
3: 19
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952946148 Original CRISPR CCCTTACAAATGCTGAAGCT GGG Intronic
901206923 1:7502854-7502876 CCCCTACAAGGGCTGAAGCGAGG + Intronic
901232084 1:7646944-7646966 GCCTTACAGATGCTGAAGGCTGG - Intronic
901431527 1:9218223-9218245 CCCATACAAATGCAGAAGGATGG + Intergenic
903466617 1:23556437-23556459 CCTTTACAGATGCAGAAACTGGG + Intergenic
904226872 1:29028564-29028586 CACTTACAAGTACTGAAGCCTGG + Intronic
904804517 1:33121265-33121287 CCCTTTTAAATGCAGAAGCCTGG + Intergenic
906087064 1:43144989-43145011 CACTTACCAAGGCTGAAGGTGGG - Intergenic
906895537 1:49766278-49766300 CTCTTAAAAATGCTGAAAATAGG - Intronic
908552043 1:65218432-65218454 GTCTTCCAAATGCAGAAGCTAGG + Intronic
908607100 1:65810122-65810144 CCCTTTCAAATGCAGAAACAGGG + Intronic
908825238 1:68126717-68126739 GCCTTACAGATGAGGAAGCTGGG + Intronic
909371908 1:74893438-74893460 TCTTTACAAATGCTGAATATAGG - Intergenic
909718824 1:78741589-78741611 CCTTTACATATGCTGAAGTGAGG + Intergenic
909950060 1:81708323-81708345 CCCTGACAAATGCTTAAATTTGG - Intronic
910610459 1:89135537-89135559 TCTTTACAAATGCTGAATATAGG - Intronic
913281600 1:117190272-117190294 GCCTGAAAAATGCTGAAGGTAGG - Intronic
914727330 1:150338813-150338835 CACTTACAAATGCAGGAGCTTGG - Intronic
914859046 1:151371787-151371809 CCCTAAGAAATGCTGGGGCTGGG - Intronic
918275354 1:182949007-182949029 CCCTCACAAATTCTAAAGCAAGG + Intronic
918601044 1:186362146-186362168 TCCTTCCATATGCTGTAGCTAGG - Intronic
919865967 1:201783114-201783136 CCCATACAAGTGCTGAAGACAGG - Intronic
924287870 1:242506882-242506904 CACTTGCAGATGCTGAATCTGGG - Intronic
924550271 1:245069739-245069761 CACTTAAAAATGGTGAAGATGGG + Intronic
1063935128 10:11069899-11069921 ACCTTACAAATGCTAACTCTAGG - Intronic
1067134313 10:43594718-43594740 CCTCTGCAAATGCTGAAGCTGGG + Intergenic
1069579460 10:69555539-69555561 CCCTCACAAGTGCTGAGGCTGGG + Intergenic
1071560072 10:86639068-86639090 CCCTTACCAATACTGATGTTTGG - Intergenic
1073262789 10:102203234-102203256 CTCTTACAAGTACTGAAGTTAGG - Intergenic
1076324957 10:129613966-129613988 CTCTTAAAAATGGTGAAGGTGGG - Intronic
1077596439 11:3536112-3536134 CCTTCACAAATGATGAAGATTGG + Intergenic
1078766243 11:14301178-14301200 CCCTGAAAAATACTGAATCTGGG + Intronic
1080635959 11:34123425-34123447 CGCTTTCAAATGGTGAAGCTGGG - Intronic
1082798598 11:57396637-57396659 CCAGTACAAATGCTTTAGCTTGG - Intronic
1082885615 11:58078925-58078947 ACCTTACAAGTGATGAAGCAAGG + Intronic
1083775856 11:64894080-64894102 CCCCTCCAAGTGCTGGAGCTGGG + Intergenic
1087515310 11:99152945-99152967 TCTTTATAAATGCTGAATCTAGG + Intronic
1091695038 12:2622698-2622720 CCCAGCCCAATGCTGAAGCTAGG + Intronic
1092156247 12:6283541-6283563 CCCTTAAAAATGGTTAAGATGGG + Intergenic
1095669245 12:44838962-44838984 CCTTCTCAGATGCTGAAGCTAGG - Intronic
1097661366 12:62435058-62435080 GGCTTACACATGGTGAAGCTTGG + Intergenic
1098423656 12:70333756-70333778 CACTTACAAATGCTAAAATTTGG - Intronic
1101572064 12:105962808-105962830 CTGTTACAAATGCAGAATCTTGG - Intergenic
1102901968 12:116646026-116646048 CCCTTGCTGATGCTGGAGCTGGG + Intergenic
1103305975 12:119964246-119964268 CGCTTACAAATGGTTAAGATGGG - Intergenic
1106922065 13:34574411-34574433 ACCTTTCACCTGCTGAAGCTGGG - Intergenic
1109107459 13:58273686-58273708 CCCTGACAAATACTGAACCCAGG + Intergenic
1109350224 13:61170583-61170605 CCCTTACTAATGATAAAACTGGG - Intergenic
1110081731 13:71322050-71322072 ATCTTACAAATGCTGTAGCTTGG + Intergenic
1112366841 13:98762495-98762517 CCTCTGCAAACGCTGAAGCTGGG - Intergenic
1112593613 13:100787711-100787733 CCCATAACAATGCTGAACCTAGG - Intergenic
1113241339 13:108341021-108341043 CCCCAACAAAGGCTAAAGCTTGG + Intergenic
1113253301 13:108478552-108478574 ACTTTACAAATGTTGAACCTTGG + Intergenic
1113416188 13:110130510-110130532 CCCATACAGGTGCTGAAGGTGGG - Intergenic
1116760340 14:49005372-49005394 CAGATACAGATGCTGAAGCTGGG + Intergenic
1118471410 14:66078240-66078262 CTCTTACAGATCCTGAAGCCCGG - Intergenic
1120948379 14:90019403-90019425 AACTTACAAATGCTGAAGGGAGG - Exonic
1123667134 15:22616949-22616971 CCCTTACAGATGTTGACGGTGGG - Intergenic
1124320976 15:28711516-28711538 CCCTTACAGATGTTGACGGTGGG - Intronic
1124363444 15:29054902-29054924 GCCTTGCAGATGCTGAAGCGAGG + Intronic
1124481521 15:30083839-30083861 CCCTTACAGATGTTGACGGTGGG + Intronic
1124487976 15:30135935-30135957 CCCTTACAGATGTTGACGGTGGG + Intronic
1124522072 15:30413355-30413377 CCCTTACAGATGTTGACGGTGGG - Intronic
1124536593 15:30552863-30552885 CCCTTACAGATGTTGACGGTGGG + Intronic
1124543065 15:30604912-30604934 CCCTTACAGATGTTGACGGTGGG + Intronic
1124755551 15:32402386-32402408 CCCTTACAGATGTTGACGGTGGG - Intronic
1124762060 15:32454729-32454751 CCCTTACAGATGTTGACGGTGGG - Intronic
1124776570 15:32594339-32594361 CCCTTACAGATGTTGACGGTGGG + Intronic
1126361514 15:47851277-47851299 TCTTTCCAAATGCTGATGCTGGG - Intergenic
1128579431 15:68798497-68798519 CCCTAGCAATTGATGAAGCTGGG + Intronic
1129787099 15:78316694-78316716 CCCCTATAAAAGCTGATGCTTGG + Intergenic
1132390967 15:101437820-101437842 CCCTAACAATAGGTGAAGCTGGG - Intronic
1135305240 16:21362180-21362202 CCCTGACAAACCCTCAAGCTAGG - Intergenic
1136301985 16:29341345-29341367 CCCTGACAAACCCTCAAGCTAGG - Intergenic
1137019848 16:35414556-35414578 GCCTTACAAATGTTCCAGCTGGG + Intergenic
1137518812 16:49174111-49174133 CACTTACAAATGGTTAAGGTGGG - Intergenic
1138126504 16:54443176-54443198 CCCTTAAATCTGGTGAAGCTAGG + Intergenic
1141128725 16:81419868-81419890 TCCTTAGAAATGCAGAATCTTGG - Intergenic
1141935080 16:87233056-87233078 CCCATGCAAAAGCTGAGGCTGGG - Intronic
1143096361 17:4480582-4480604 TTCTTACAAATGCAGACGCTGGG - Intronic
1144136735 17:12302311-12302333 CCCTTAAAAATGATGAAAATGGG - Intergenic
1144702315 17:17347711-17347733 CACTTACAAGACCTGAAGCTGGG - Intergenic
1146522883 17:33539946-33539968 CTCTTACAAATGCTGTTTCTTGG - Intronic
1148853959 17:50568635-50568657 CCTTTACAGATGAGGAAGCTGGG + Intronic
1149343856 17:55714808-55714830 GCTTGATAAATGCTGAAGCTGGG + Intergenic
1151212519 17:72555153-72555175 ACTTTACAGATGATGAAGCTGGG + Intergenic
1151766255 17:76134971-76134993 ACCTTACAAATGCTGATGCCTGG + Intergenic
1151907967 17:77061500-77061522 CTCTTAAAAATCCTGAAGCCTGG - Intergenic
1153710945 18:7798228-7798250 CCCTTAAAAATGGTTAAGATGGG + Intronic
1159617075 18:70593546-70593568 CCATGAAAAATGTTGAAGCTGGG + Intergenic
1160967102 19:1751567-1751589 CCCGTGCAGATGCTGAATCTCGG - Intergenic
1161160524 19:2759250-2759272 CACTTACAGCTGCTGAATCTGGG + Exonic
1162615609 19:11798385-11798407 GCCTTAGAAAGGCTGTAGCTAGG + Intronic
1162858593 19:13488693-13488715 GCTTTAAAAATGCTGAGGCTGGG - Intronic
931994454 2:67826541-67826563 CACTTTGAAATGCTGAAGCCAGG + Intergenic
933704919 2:85282584-85282606 GCCTTACAGATGCTGAAACTGGG + Intronic
935209842 2:100929748-100929770 GCCTTAAAAATGCTGATGCCTGG - Intronic
935583734 2:104782578-104782600 CCTTAACAAATACTGAAGCCTGG - Intergenic
936616526 2:114053534-114053556 CCCCTACAATTGCTGAAAGTGGG - Intergenic
937365533 2:121258235-121258257 GCCTCACACATGCTGGAGCTGGG + Intronic
937405026 2:121619855-121619877 CACTGAGAACTGCTGAAGCTTGG + Intronic
940029500 2:149246516-149246538 ACCTTAGAAATGTTGAAGCTGGG + Intergenic
944169237 2:196756928-196756950 TCTTTACAAATGCTGAATATTGG + Intronic
945252466 2:207776069-207776091 CTTTTAGAAATACTGAAGCTTGG + Intergenic
946300046 2:218817476-218817498 TCCTTGCAAATGCTGGGGCTGGG + Intergenic
947858567 2:233341821-233341843 CACTTTAAAATGATGAAGCTGGG + Intronic
1173841049 20:46157585-46157607 CCCTGACAAATGCGGGAGATGGG - Intergenic
1177225575 21:18249732-18249754 AGCTCACAAGTGCTGAAGCTGGG - Intronic
1182743032 22:32582680-32582702 CCCTTAAAAATGCAGAACATAGG - Intronic
949471127 3:4398003-4398025 CACTTACAGATGAGGAAGCTGGG + Intronic
949788111 3:7763859-7763881 CCCTTATAAATGAAGAAACTAGG + Intergenic
949885472 3:8689770-8689792 AGCTTACAAATGCTGAGGCCTGG + Intronic
952510351 3:34047219-34047241 CGTTTACAAATGTTGAACCTTGG + Intergenic
952946148 3:38478970-38478992 CCCTTACAAATGCTGAAGCTGGG + Intronic
957926296 3:86817191-86817213 CCATTATAAATGTTGAAGTTGGG - Intergenic
959981565 3:112523554-112523576 CACTTACAAATGATGAGGCCTGG - Intergenic
961430581 3:126879878-126879900 CCCTAACAAGTGATGAATCTAGG + Intronic
962228701 3:133640328-133640350 CCCTTACAAATGCTTACTCTAGG + Intronic
963518270 3:146335082-146335104 CTCTTACAAGTACTGAAGTTAGG + Intergenic
969178351 4:5417433-5417455 CACTGACAAATGCTGAAGATTGG - Intronic
973051097 4:45597823-45597845 CTCTGACAAAATCTGAAGCTTGG - Intergenic
974341280 4:60617435-60617457 CACTAAAAAATGCTGAATCTAGG + Intergenic
976318091 4:83681002-83681024 CAATTACAAATGCTGTAGCAAGG + Intergenic
977374421 4:96183345-96183367 TTCTTACAAATGCAGAAGCTTGG - Intergenic
978079041 4:104569167-104569189 CCATTACAAATGAAGAAGTTTGG + Intergenic
978635936 4:110807319-110807341 CTCTTACAAATGCTGGATTTGGG + Intergenic
979743033 4:124175236-124175258 CCTCTTCAAAAGCTGAAGCTAGG - Intergenic
981228295 4:142322879-142322901 ACCTTAAAAATACTGATGCTTGG - Intronic
982283768 4:153713621-153713643 CCCTAACAAATGGAGGAGCTTGG + Intronic
983269215 4:165541835-165541857 CCCATAAAAATTTTGAAGCTTGG + Intergenic
983281521 4:165686811-165686833 ACTTTACAAATGCTCAACCTGGG - Intergenic
984415682 4:179456275-179456297 TCCTTTCAATTTCTGAAGCTGGG - Intergenic
985765963 5:1779748-1779770 GGCTTAGAAATCCTGAAGCTTGG - Intergenic
987583070 5:19820670-19820692 CCCTTCCAAATACTGGTGCTAGG - Intronic
987917548 5:24234469-24234491 CCCTTGAAAATTCTTAAGCTGGG + Intergenic
989272314 5:39547880-39547902 CCCTAAGATATGCTGAAGCCAGG - Intergenic
990063345 5:51680238-51680260 ACTTTATAGATGCTGAAGCTGGG - Intergenic
991027868 5:62050652-62050674 TCCTGACAAATGCTGAATATAGG + Intergenic
991262246 5:64679650-64679672 CCTGTCCAATTGCTGAAGCTTGG - Intergenic
992912803 5:81415051-81415073 CCTTTACACATGCTTAAGATTGG + Exonic
993296979 5:86153280-86153302 CCCTTACAGATGCTGTAGCAGGG - Intergenic
994944920 5:106375276-106375298 CCCTTAGAATTGTTGAAGCAAGG - Intergenic
996653991 5:125916142-125916164 CTCTTACAAGTACTGAAGTTAGG + Intergenic
997458931 5:134039244-134039266 CCCTAATAAATACTGATGCTAGG + Intergenic
998436540 5:142114530-142114552 CATTCACAATTGCTGAAGCTGGG - Intronic
998593105 5:143498976-143498998 CCCTTACAGATGAGGAAACTAGG + Intergenic
1002334531 5:178468775-178468797 CCCGTAAAAATGGTGAAGATGGG - Intronic
1003427264 6:6006170-6006192 CCCGTGCAAACGCTGCAGCTAGG + Intronic
1004871401 6:19908167-19908189 CTCTTACAAATGAAGATGCTTGG - Intergenic
1006972020 6:38055462-38055484 CCTTAACAAATGCTAGAGCTAGG - Intronic
1008318537 6:50077936-50077958 CCCTTATGAATTCTGAATCTAGG + Intergenic
1009267752 6:61577249-61577271 ACTTTACAAATGCTGCAGGTTGG + Intergenic
1009455315 6:63849255-63849277 CCTTTAAGTATGCTGAAGCTGGG - Intronic
1010711500 6:79180530-79180552 CCCTTCCAAATGCTGAAACCAGG - Intergenic
1010878635 6:81139989-81140011 TCCTTAAAAATGCTGAATATAGG - Intergenic
1011071516 6:83390770-83390792 TGCTTACAAATGTTGAATCTAGG - Intronic
1012568077 6:100685258-100685280 CTCTTGCAAAAGCTGAGGCTTGG + Intronic
1013193128 6:107820809-107820831 CTCTTGCAAATGCAGAAGTTTGG + Intronic
1013770767 6:113625462-113625484 CCCTAATTAATCCTGAAGCTAGG + Intergenic
1014413735 6:121157806-121157828 ACCTTAAAAATGCTGAAAATAGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1021155450 7:17204183-17204205 CACTTACACATATTGAAGCTAGG + Intergenic
1021513341 7:21457297-21457319 CCATTACAAAAGCTGAAAGTTGG - Intronic
1021522907 7:21554739-21554761 CTCTTACAAGTACTGAAGTTAGG - Intronic
1022281395 7:28913875-28913897 CCCTTAGAAATGGTTAATCTTGG + Intergenic
1022596140 7:31714909-31714931 ACCTCACAGATGCTGAAGTTGGG + Intergenic
1023215116 7:37854020-37854042 CCCTTACCAATGCTGGAGTTAGG + Intronic
1023361848 7:39425190-39425212 CAATTACAAATGATGAAGCAGGG - Intronic
1024087799 7:45911157-45911179 CCCTCACAGATGCTGTACCTGGG + Intergenic
1024387360 7:48768046-48768068 ACCTTATAAATGGTGATGCTTGG + Intergenic
1028337260 7:89673244-89673266 CCCTTAAGAATGTTGAGGCTGGG + Intergenic
1029955234 7:104631824-104631846 CACTTACAAAGGTTGTAGCTAGG - Intronic
1030017539 7:105239535-105239557 CCCTTACAAATGCTGGAAGCAGG + Intronic
1030815777 7:114035183-114035205 CCCTCACAAATGCTGGAGCTGGG + Intronic
1031738770 7:125400663-125400685 TTCTTACAAATGCTTATGCTTGG + Intergenic
1033359970 7:140632082-140632104 CCCTTACAAATGCCTCTGCTTGG + Intronic
1033363966 7:140657393-140657415 CCTCTGCAAATGCTGAAGCTGGG - Intronic
1035086933 7:156268101-156268123 CCCAGACAAATGTTGAACCTAGG - Intergenic
1036673656 8:10811165-10811187 CATTTACAAATGAAGAAGCTGGG + Intronic
1036941285 8:13055129-13055151 CCCTTAAAAATGATTAAGATGGG + Intergenic
1038698245 8:29825501-29825523 CACACACAAAAGCTGAAGCTGGG + Intergenic
1039173183 8:34772556-34772578 CATTTATAAATGCAGAAGCTTGG - Intergenic
1039868128 8:41523541-41523563 CCCTTACAAATGGAAAATCTGGG - Intergenic
1041829296 8:62134738-62134760 ACGTAACAAATGGTGAAGCTTGG - Intergenic
1043844587 8:85149879-85149901 TCTTTACAAATGCTGAATATAGG - Intergenic
1047575634 8:126151171-126151193 CCCTTAAGAATGCTGAAAATAGG - Intergenic
1048266379 8:132991046-132991068 CCTTTAGGGATGCTGAAGCTGGG + Intronic
1048826782 8:138435382-138435404 CCCTAACCAATGGTGAAGCTTGG + Intronic
1049790968 8:144472568-144472590 GCCTTCCAGATGCTGAAACTGGG + Exonic
1050788868 9:9440901-9440923 CCCCTTCAAATGCTGATCCTAGG - Intronic
1051556055 9:18383939-18383961 CTGTTACAAATGCAGAATCTGGG - Intergenic
1052624203 9:30953787-30953809 TCCTTTCAAATGATGAACCTCGG - Intergenic
1054872041 9:70056363-70056385 CCATTACAAATCCTGAAAATTGG + Intronic
1054872325 9:70059335-70059357 CCCTTACAAATGAAGAAACTAGG + Intronic
1055420303 9:76133569-76133591 TCCTTAAAAATGCTGAAAATTGG + Intronic
1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG + Intronic
1061911497 9:133727569-133727591 CCCTTCCAGAGGCTGCAGCTAGG - Intronic
1186686670 X:11931895-11931917 CCCTTAGAAATGCTGAAACACGG - Intergenic
1188408062 X:29836861-29836883 CTCTTACAAATTTTGAATCTTGG - Intronic
1189910703 X:45807833-45807855 CACTTAAAAATGCTTAAGGTGGG + Intergenic
1190339388 X:49284929-49284951 CCCTTTCAAAAGATGGAGCTAGG + Intronic
1194639936 X:96391715-96391737 CCCTGATAGGTGCTGAAGCTAGG + Intergenic
1195573527 X:106423610-106423632 AAGGTACAAATGCTGAAGCTGGG - Intergenic
1196515323 X:116604520-116604542 CCCTTAAACATGCTGAATATAGG + Intergenic
1196724822 X:118886457-118886479 CTCTTACAAGTTCTGAAGTTAGG + Intergenic
1197331369 X:125157081-125157103 GCCTTAAAAATGCTGATGCCTGG + Intergenic
1199431904 X:147771219-147771241 CTCTTACAAATACTGATGTTTGG + Intergenic
1199982575 X:152929024-152929046 CCCTGCCAATTGCTGAAGATGGG + Intronic
1201642554 Y:16194953-16194975 TCCTTACATATGTTGAAGATAGG - Intergenic
1201660260 Y:16390367-16390389 TCCTTACATATGTTGAAGATAGG + Intergenic
1201899338 Y:19032246-19032268 TCCTTACTTATGCTGAAACTTGG - Intergenic