ID: 952946225

View in Genome Browser
Species Human (GRCh38)
Location 3:38479348-38479370
Sequence GGTGGACACCTCCACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952946225_952946229 -4 Left 952946225 3:38479348-38479370 CCTTCCCTGTGGAGGTGTCCACC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 952946229 3:38479367-38479389 CACCATGAAGTACTCTGCCCCGG 0: 1
1: 0
2: 0
3: 7
4: 117
952946225_952946235 15 Left 952946225 3:38479348-38479370 CCTTCCCTGTGGAGGTGTCCACC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 952946235 3:38479386-38479408 CCGGTAGCACTATCCACTATGGG 0: 1
1: 0
2: 0
3: 2
4: 17
952946225_952946233 14 Left 952946225 3:38479348-38479370 CCTTCCCTGTGGAGGTGTCCACC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 952946233 3:38479385-38479407 CCCGGTAGCACTATCCACTATGG 0: 1
1: 0
2: 0
3: 1
4: 30
952946225_952946236 16 Left 952946225 3:38479348-38479370 CCTTCCCTGTGGAGGTGTCCACC 0: 1
1: 0
2: 1
3: 20
4: 212
Right 952946236 3:38479387-38479409 CGGTAGCACTATCCACTATGGGG 0: 1
1: 0
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952946225 Original CRISPR GGTGGACACCTCCACAGGGA AGG (reversed) Intronic
900290944 1:1923345-1923367 GGTGAGCCCCTCCCCAGGGAGGG - Exonic
900505522 1:3028317-3028339 GGTGGGCAGCACCCCAGGGAAGG + Intergenic
900983612 1:6060384-6060406 GGTGGACTCCTCCTCCAGGAAGG + Intronic
901627739 1:10633332-10633354 GGTGGTCACCTGGAGAGGGAGGG - Intergenic
904256700 1:29259194-29259216 AGTGGGCACCTCCCCAGGCAAGG + Intronic
904312233 1:29636238-29636260 GCTGGGCAGCTGCACAGGGATGG + Intergenic
905292329 1:36930674-36930696 GGTGGACACCAGGCCAGGGATGG + Intronic
905941380 1:41866199-41866221 GATGGACACATCTGCAGGGAGGG + Intronic
906561823 1:46763842-46763864 GGTGGAAAATTACACAGGGAAGG - Intronic
906637246 1:47417437-47417459 GGTGGGAGCCTCCCCAGGGATGG - Exonic
908777042 1:67650317-67650339 GGAGGACAGCTTCACAGAGAAGG - Intergenic
909531953 1:76691925-76691947 GGAGAACACCACCAAAGGGATGG + Intergenic
911642416 1:100303330-100303352 GACTGACACCTCCACAGGGCAGG - Intergenic
914386033 1:147171631-147171653 GGTGGACAACTTCAGAGGGTAGG - Intronic
914936513 1:151985993-151986015 AGTGGTGACCTCCACAGGGAAGG + Intronic
915431265 1:155868731-155868753 GGTGGACCCCAGCACAGGCAAGG + Exonic
915601220 1:156924317-156924339 GGAGGACACCGCCAGAGGGGAGG - Intronic
916563015 1:165949493-165949515 GTTGGAAACCTCCAAAGGGAGGG + Intergenic
919134374 1:193489655-193489677 GGTGAACACATCCACATGGCTGG + Intergenic
920230812 1:204468674-204468696 GGTGGACACCAGTAGAGGGAGGG - Intronic
921257657 1:213356997-213357019 TGTGGGCACCAGCACAGGGAGGG + Intergenic
923076193 1:230610789-230610811 GGTGGGAACTTGCACAGGGAGGG + Intergenic
923148450 1:231213977-231213999 GGTACACACCTCCCCAGGGCCGG + Exonic
924708820 1:246518358-246518380 GGTGGACTCCTGGACCGGGATGG - Intergenic
1064937641 10:20696224-20696246 GGTGTGCACCTCCAAAGGCATGG + Intergenic
1065783404 10:29191314-29191336 GGTAGACACCTCCATATGGTAGG - Intergenic
1067175779 10:43944376-43944398 GGTGGCCTCCTCCACAGGAATGG + Intergenic
1067480762 10:46596035-46596057 AATGGACACAGCCACAGGGAGGG + Intergenic
1067613977 10:47745766-47745788 AATGGACACAGCCACAGGGAGGG - Intergenic
1067788535 10:49270775-49270797 GGTGCACAGCAGCACAGGGAAGG + Intergenic
1070113567 10:73507867-73507889 GGTGCACACCTGCACTCGGAAGG + Intronic
1070751574 10:78967042-78967064 GGTGGGCACTTCCCCAGGGCAGG + Intergenic
1070900813 10:80027392-80027414 GGTGGACAGCATCACATGGAGGG + Intergenic
1070901520 10:80033908-80033930 GGTGGACAGCATCACATGGAGGG + Intergenic
1070902551 10:80043151-80043173 GGTGGACAGCATCACATGGAGGG + Intergenic
1071501954 10:86210597-86210619 AGTGCTCACCTCCACGGGGAGGG - Intronic
1071629385 10:87205741-87205763 AATGGACACAGCCACAGGGAGGG - Intergenic
1073459792 10:103660064-103660086 GGTGGATACTTCCAGAGGGGAGG - Intronic
1075608337 10:123832321-123832343 TGTAGACACCTCCACAGGCCTGG - Intronic
1075732065 10:124642316-124642338 TGTGAACACGTCCACAGTGACGG + Intronic
1075762109 10:124864762-124864784 GGTGGTCTCCTCCCCTGGGAGGG - Intergenic
1076276662 10:129205225-129205247 GGTGGACACCTAAACATGGCTGG + Intergenic
1076485205 10:130811266-130811288 GGGGGACACGTCCTCAGGGAAGG - Intergenic
1076798823 10:132811390-132811412 GGTGGAGCCCTCCCCAAGGACGG + Intronic
1076902764 10:133347925-133347947 GGAGGGCACCTCCACAGGAGCGG - Intronic
1077824354 11:5788480-5788502 TGTGCACACCTTCACAGGGATGG - Exonic
1078055859 11:8008451-8008473 GGTGGACAGCCCCACACGCAGGG - Intergenic
1083333099 11:61908179-61908201 GGTGGAGACCTCTGCAGGGGAGG - Exonic
1083615772 11:64025512-64025534 AGTGGACACCTCTGCAGGGAGGG - Intronic
1083896306 11:65621629-65621651 GGCGGCCGCCTCCAGAGGGAAGG + Intronic
1083996546 11:66275914-66275936 GGTGGACAACACCACAGCCAAGG + Exonic
1085947681 11:81291603-81291625 GGTGGATAGGACCACAGGGAAGG + Intergenic
1088783291 11:113156878-113156900 GGTAGGCATCTCCACATGGAAGG + Intronic
1089454178 11:118616217-118616239 GCTGGACACCTCCAGATGGAGGG + Intronic
1090224443 11:125061721-125061743 GGTGGACATCACCAGAGGAATGG - Intergenic
1090676792 11:129006640-129006662 TGTGGCCACCACCACTGGGACGG + Intronic
1091700774 12:2660135-2660157 GGTGGACACAACCACAGGTCAGG - Intronic
1093181482 12:15972177-15972199 TGTGGACACCTCAACAACGATGG - Intronic
1093957448 12:25237186-25237208 AGTGGACAAATCCACAGAGATGG + Intronic
1097435537 12:59549082-59549104 GGTGGAGCCCACCACAGGGCAGG - Intergenic
1099030951 12:77524781-77524803 GGTAGACACATCCACAAAGATGG + Intergenic
1101346744 12:103892876-103892898 GGTAGATTCCTGCACAGGGAAGG - Intergenic
1102074764 12:110050988-110051010 GGTGTTCACCTGCAAAGGGAAGG + Intronic
1103467687 12:121154940-121154962 GGTGCTCACCTGCAAAGGGAAGG - Exonic
1104152598 12:126097895-126097917 CATGGGCACCTCCACAAGGAAGG - Intergenic
1104971063 12:132530902-132530924 GGTGCACACCTGCACATGGCAGG - Intronic
1105213672 13:18272414-18272436 GGTGGCCACCTCCCCAGGCTTGG + Intergenic
1105928445 13:25029958-25029980 GGTGGACGCATCCACAGCAAGGG + Intergenic
1109179681 13:59199191-59199213 AGTGGACACCTCCACAATGAAGG - Intergenic
1116561456 14:46384716-46384738 GAAGCACAGCTCCACAGGGAGGG + Intergenic
1116999778 14:51360784-51360806 GGTGGACACATCCGCTGGGCAGG - Intergenic
1118093009 14:62503500-62503522 AGTCCACACATCCACAGGGAAGG + Intergenic
1122741182 14:103872321-103872343 GGTGGGCACCCACCCAGGGAGGG - Intergenic
1122930825 14:104932434-104932456 CGTGGACACCTCAGGAGGGAGGG + Intronic
1123069657 14:105636257-105636279 GCTGAGCCCCTCCACAGGGAAGG - Intergenic
1123088750 14:105732040-105732062 GCTGAGCCCCTCCACAGGGAAGG - Intergenic
1123701704 15:22918863-22918885 GGGGGACACAGCAACAGGGACGG + Intronic
1124250554 15:28104228-28104250 GGAGGCCAGCTCCACAGGGTGGG - Intergenic
1125679905 15:41524042-41524064 GGAGGGCTCCTCCACAGGGCTGG - Intronic
1125904294 15:43376246-43376268 GGTGTACACCTCTAGAGGGCAGG + Intronic
1127261459 15:57329718-57329740 GGTAGGCAGCTGCACAGGGAAGG - Intergenic
1130108967 15:80949469-80949491 GGTGGACACGGCCAGAGGCAGGG - Exonic
1131598726 15:93825922-93825944 CAGGGACACCACCACAGGGAAGG + Intergenic
1132692263 16:1186918-1186940 GGTGGACACGGACACAGGGCTGG + Intronic
1133110621 16:3545974-3545996 GGTGGAGGCTACCACAGGGATGG + Intronic
1134189668 16:12111482-12111504 AGTGGACTCCTGCGCAGGGAGGG - Intronic
1134192096 16:12129687-12129709 GGTGGACACCTTGAAAAGGAAGG + Exonic
1134319241 16:13147835-13147857 TTTGGACACCTCCACCGGGTGGG + Intronic
1135740692 16:24972870-24972892 ACTGAACTCCTCCACAGGGAGGG + Intronic
1137885535 16:52099000-52099022 AGTGGACGCTTCCACAAGGATGG - Intergenic
1138583263 16:57955243-57955265 AGTGGCCACCTCCCCCGGGAAGG + Intronic
1141764016 16:86046909-86046931 GGAGGACACCCCGACAGGAATGG + Intergenic
1142535003 17:608495-608517 TGTGGATACCTCCAGGGGGAGGG + Intronic
1143097141 17:4484194-4484216 GAGGAAAACCTCCACAGGGAGGG - Intronic
1144449719 17:15366142-15366164 GTGGCACACCTCCAGAGGGAAGG + Intergenic
1144850725 17:18242637-18242659 GGTGGGCAGGTCCACAGGGGGGG + Intronic
1144948761 17:18982968-18982990 GCTGGACACCTTCCCTGGGAGGG - Intronic
1145961174 17:28887325-28887347 GGGGGACGCCTCCACAGGCTGGG - Intronic
1147758658 17:42783882-42783904 GGGGGACACGTCCTCCGGGAAGG - Intronic
1149659475 17:58326848-58326870 GGTGGATGCTTCCACAGGGAAGG - Intronic
1150808039 17:68334689-68334711 GGCGGACATCTCCACGGGGAAGG + Intronic
1152282777 17:79395294-79395316 GGAGGACCCCTCCTAAGGGATGG + Intronic
1152477753 17:80529209-80529231 GGTGGCCACCTTCCCAGGGGTGG + Intergenic
1152938589 17:83154201-83154223 GATGGACAGCTCGACTGGGAAGG - Intergenic
1153756997 18:8294315-8294337 GATGCACAGCTCCACAGGGCTGG + Intronic
1155214448 18:23630683-23630705 GGTGGAAACCTACAAAGAGATGG - Intronic
1158481170 18:57823314-57823336 TGTGGCCACCACCACTGGGACGG + Intergenic
1160662587 19:308085-308107 GGTGGAGACCCACACGGGGAGGG - Intronic
1160707123 19:534908-534930 GGTGGAAGCCTGGACAGGGAGGG - Intronic
1160864545 19:1251032-1251054 GATGGGCCCCTCCACTGGGATGG - Intronic
1162461607 19:10817113-10817135 GGTGGCCTCCTCCTCAGGGGTGG - Intronic
1163242232 19:16071316-16071338 GGTGTGCACCTCCACTGGGGAGG - Intronic
1164708752 19:30339626-30339648 GATGGACACCTCCACCTCGAGGG + Intronic
1165852785 19:38859981-38860003 GGAGCACAGCACCACAGGGAGGG + Intergenic
1167247670 19:48383419-48383441 GATGGGCAGATCCACAGGGAGGG + Intronic
1167293363 19:48636195-48636217 GGTGGACAGATTCACAGAGATGG + Intronic
1168137118 19:54359430-54359452 GGAGGAGGGCTCCACAGGGAGGG - Intronic
1168160958 19:54509655-54509677 GGAGGAGGGCTCCACAGGGAGGG + Intronic
1168347726 19:55659093-55659115 GGAGGCCACCCCCAAAGGGAAGG - Intronic
1168649764 19:58085655-58085677 GGTGGAGACCTCCAAAGGCGCGG - Intronic
926241671 2:11093633-11093655 GCTGGACACCTCCACATCTATGG + Intergenic
932759497 2:74430115-74430137 GCAGGACAGCTCCACAGAGAAGG + Intronic
932780041 2:74554097-74554119 AGTGGCCAGCTCCACGGGGAGGG - Exonic
934300656 2:91774332-91774354 GGTGGTCACCTCCCCAGGCTTGG - Intergenic
935377729 2:102417270-102417292 TGTGGACAACACCAAAGGGATGG - Intergenic
935543393 2:104375803-104375825 GGAGAACATCTCCAAAGGGATGG + Intergenic
936159982 2:110077601-110077623 GATGAACACCTCCAAAGTGATGG - Intergenic
936184682 2:110293752-110293774 GATGAACACCTCCAAAGTGATGG + Intergenic
937234530 2:120422676-120422698 GGTGGACACAGCCTCAGGGTAGG + Intergenic
937428016 2:121815912-121815934 GGCAGACTCCTCGACAGGGAAGG + Intergenic
937702668 2:124881648-124881670 TGTGGACATCGCCACAGTGAAGG - Intronic
938080997 2:128370105-128370127 CTTGGCCTCCTCCACAGGGACGG - Intergenic
939997369 2:148932477-148932499 GGTGGACACCACCACACAGAAGG + Intronic
940795503 2:158072562-158072584 TGTGGCCACCACCACTGGGACGG - Intronic
941417318 2:165237296-165237318 GGTGGACGCCTCCTAAGGAATGG + Intergenic
942171104 2:173290452-173290474 TGTGGTCACCTCCAGAGAGAGGG + Intergenic
943933682 2:193886590-193886612 TGTGGCCACCACCACTGGGACGG - Intergenic
946240907 2:218355057-218355079 GGAGCACAGCACCACAGGGAGGG - Intergenic
946405573 2:219490343-219490365 GGGGGACACTTCCATAGTGAGGG - Intronic
947178143 2:227388070-227388092 GGTGGAGACCTCCTCTGTGAAGG - Intergenic
948699382 2:239750693-239750715 CCTGGACACCTCCACTTGGAGGG + Intergenic
1175216798 20:57395545-57395567 GGTGGAGACCCAAACAGGGACGG + Intronic
1175833612 20:61980106-61980128 GGTGGGGACCTGCAAAGGGAGGG - Intronic
1176244961 20:64093120-64093142 GGTGCTCCCCTCCACAGGGAGGG + Intronic
1177397320 21:20554012-20554034 GGTGGATTCCTACAGAGGGAAGG - Intergenic
1179714844 21:43281356-43281378 GGGGGACATCTCCACAGTGCAGG + Intergenic
1180716175 22:17873843-17873865 TGTGGCCATCTCCACATGGAAGG - Intronic
1180816504 22:18792805-18792827 GGTGGCCACCTCCCCAGGCTTGG + Intergenic
1181063022 22:20290972-20290994 GGTGGAGCTCTCCTCAGGGAGGG - Intergenic
1181202691 22:21227137-21227159 GGTGGCCACCTCCCCAGGCTTGG + Intronic
1181699011 22:24609468-24609490 GGTGGCCACCTCCCCAGGCTTGG - Intronic
1182419798 22:30243445-30243467 AGTGGAAACTTCCATAGGGAGGG - Exonic
1182466562 22:30520455-30520477 GGTGGCCCCCACCAAAGGGAGGG - Intergenic
1184133439 22:42531630-42531652 GAAGGACAGCACCACAGGGAGGG - Intergenic
1184821403 22:46911444-46911466 AGTGGAGACTTCCTCAGGGAGGG - Intronic
1185122672 22:48981881-48981903 GGTTGAGGCCTCCACAGAGATGG + Intergenic
1203224222 22_KI270731v1_random:68276-68298 GGTGGCCACCTCCCCAGGCTTGG - Intergenic
1203266604 22_KI270734v1_random:18516-18538 GGTGGCCACCTCCCCAGGCTTGG + Intergenic
949504549 3:4714618-4714640 GGTGGACACCACCTCAGGAGAGG - Intronic
952236508 3:31486075-31486097 GGGTGACACAGCCACAGGGATGG - Intergenic
952946225 3:38479348-38479370 GGTGGACACCTCCACAGGGAAGG - Intronic
955465931 3:59237270-59237292 CCTGGACACCTCCACAGAAATGG - Intergenic
956724521 3:72146017-72146039 GGTGAAAACCTCCACAAGCAAGG - Intergenic
959082934 3:101821623-101821645 GATGTACACTTCCAAAGGGAAGG - Exonic
961630515 3:128295219-128295241 GTTGGACACCACCAAAGGCAGGG - Intronic
961781977 3:129325635-129325657 GCTGGCCTCCTCCACAGAGAGGG + Intergenic
962389952 3:134962875-134962897 GGTAGACACCTGGTCAGGGAAGG - Intronic
966714301 3:183000398-183000420 GGTGGAGAGCTCCAGAGGGGTGG - Intergenic
967885703 3:194332132-194332154 GGTGGGCACCTCCCCAGGGTGGG - Intergenic
968005131 3:195237416-195237438 TGTGGCCACCGCCACAGGGATGG + Intronic
968441454 4:626543-626565 GGTGCAGACGCCCACAGGGAGGG + Intronic
968500994 4:950039-950061 TGTGGACTCCGCCTCAGGGATGG - Intronic
970899243 4:21139516-21139538 TGTGGCCAGCTCCTCAGGGATGG + Intronic
972583419 4:40415363-40415385 GGTGGACACTCCTAGAGGGAAGG + Intergenic
974468707 4:62291720-62291742 GGAGGACAGCACCAAAGGGATGG - Intergenic
978343129 4:107738461-107738483 GGTGGACACCTTCTCAGGCTGGG + Intergenic
980526749 4:133998970-133998992 GGTGGACACCTCTAAAATGAGGG - Intergenic
984290979 4:177793871-177793893 GGTGGCCACCTACACAGGAAGGG - Intronic
985663972 5:1172267-1172289 GGGTGACCCCACCACAGGGACGG + Intergenic
985757967 5:1730469-1730491 TGTGGTCACCTCCCCTGGGAGGG - Intergenic
985865606 5:2511737-2511759 TGAGCACTCCTCCACAGGGAGGG - Intergenic
986285408 5:6354976-6354998 TGTGGACAAGGCCACAGGGAGGG + Intergenic
990828032 5:59923441-59923463 TGTGGCCACCACCACTGGGATGG - Intronic
992180494 5:74192677-74192699 GGTGGCCACCTCCCTAGAGAGGG - Intergenic
996123086 5:119692954-119692976 GGTGCACACATCCCCATGGATGG - Intergenic
997821666 5:137071408-137071430 AGGGGTCACCTCCCCAGGGAAGG + Intronic
998521352 5:142803767-142803789 GCTGGACTCCTCCACAGATAAGG - Intronic
1001700559 5:173703759-173703781 GGTGGAGTCTTCCACAAGGAAGG - Intergenic
1004016248 6:11734567-11734589 GGTAGACACCACAAAAGGGAAGG + Intronic
1007270886 6:40636153-40636175 GGTGCACATCCCTACAGGGAGGG + Intergenic
1007735356 6:43978917-43978939 TGTGGACACCGCCACAGACAGGG - Intergenic
1007785911 6:44279226-44279248 GGTGGACAGCTACAGAGTGATGG + Exonic
1007908987 6:45494233-45494255 TGTGGCCACCTCCACAGGCCTGG + Intronic
1011626333 6:89286663-89286685 GATGGTCACCTCCACACAGATGG + Intronic
1013084059 6:106840673-106840695 GGTAGACAAGTCCACAGGGATGG - Intergenic
1017824572 6:158071874-158071896 TGGGGACACAACCACAGGGAGGG + Intronic
1018734273 6:166675561-166675583 GGTGGTCCCCTCCACAGCCATGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019256599 7:56478-56500 CGGGGACACCGACACAGGGAGGG - Intergenic
1020271525 7:6599445-6599467 GGAGGACACGTACTCAGGGAAGG + Intronic
1023986602 7:45100776-45100798 GGTGGTCACCTTCCCTGGGAAGG - Intronic
1029590534 7:101504032-101504054 GGGGGACACCTGCAGATGGAGGG - Intronic
1031098584 7:117449482-117449504 TGTGGCCACCACCACTGGGACGG - Intergenic
1031950304 7:127885017-127885039 GGTGCAAACATCCACATGGAAGG - Intronic
1032790739 7:135240739-135240761 AGGGGACATCTCCACGGGGAAGG + Intronic
1033604229 7:142913950-142913972 GGTGGAAACAGCCAGAGGGAAGG - Intronic
1035185173 7:157120805-157120827 GGTAGACACCTTCACTAGGAAGG - Intergenic
1035611475 8:968397-968419 TGTGAACACCTCCACACTGATGG - Intergenic
1036619136 8:10411910-10411932 TGTGGACACCGCCCCTGGGAAGG + Intronic
1036822044 8:11948803-11948825 GGTGGTCACCTCTAAAAGGAAGG - Intergenic
1038741534 8:30221096-30221118 GGTGGATGCCTCCATAGGGTTGG + Intergenic
1039531816 8:38269232-38269254 CGTGGCCACCTCCGCGGGGAGGG + Intronic
1039924739 8:41919213-41919235 GGTAAACACCACCACAGGGATGG - Intergenic
1044479455 8:92668296-92668318 AGTGGGCAGCTCCACAGGCAGGG - Intergenic
1048352485 8:133627293-133627315 GGTGCACAGCGGCACAGGGATGG + Intergenic
1048473768 8:134725083-134725105 GGAGGTAACCTCCACAGAGAAGG + Intergenic
1048912887 8:139153056-139153078 GTAAGACACCTCCATAGGGATGG - Intergenic
1048970976 8:139644861-139644883 GGTGGACAGCTCCGCGGGGGAGG - Intronic
1049437644 8:142595109-142595131 GGTGGACAGACCCACAGGGGTGG - Intergenic
1049675293 8:143886443-143886465 GGTGGACGCCTCTCCCGGGAGGG + Intergenic
1049790385 8:144469722-144469744 GGTGGACACCCAGACTGGGAAGG - Intronic
1053379522 9:37636882-37636904 GGTGGACAACACCACAGCCAAGG - Intronic
1055682602 9:78732755-78732777 GGTGGACCCCTCCATAGGTAGGG - Intergenic
1056098160 9:83275119-83275141 ATTGGACACCTCCACCTGGAGGG - Intronic
1057294946 9:93829461-93829483 GGTGGAGGCCTGCAGAGGGAGGG - Intergenic
1057304152 9:93902811-93902833 GGTGTACACTTCCCCAGGGTTGG + Intergenic
1058492464 9:105516691-105516713 GGTAGACACATCCACAAAGATGG + Intronic
1058962703 9:110006870-110006892 GGTGGCCACATCCTCAGGGAAGG + Intronic
1061434583 9:130553128-130553150 TGTGGAGACCTCCAGAGAGAAGG + Intergenic
1061996984 9:134191114-134191136 GGGGGACACCTCCAGAGGGAAGG - Intergenic
1187450597 X:19392916-19392938 GGTGGACAGGTCCACAGTGAGGG + Intronic
1190278651 X:48915131-48915153 GATGGACAACTCCACGGGAATGG + Exonic
1197623493 X:128778799-128778821 GGTGGTGATGTCCACAGGGAGGG - Intergenic
1202115066 Y:21464643-21464665 GGTGGACATCCGCACAGAGAGGG + Intergenic