ID: 952946624

View in Genome Browser
Species Human (GRCh38)
Location 3:38482262-38482284
Sequence ATACATGTCAATGCGCAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952946624_952946630 -2 Left 952946624 3:38482262-38482284 CCTTCCTGCGCATTGACATGTAT 0: 1
1: 0
2: 0
3: 3
4: 81
Right 952946630 3:38482283-38482305 ATGCCATGGGGTTGGTGCTGTGG 0: 1
1: 0
2: 2
3: 30
4: 331
952946624_952946634 30 Left 952946624 3:38482262-38482284 CCTTCCTGCGCATTGACATGTAT 0: 1
1: 0
2: 0
3: 3
4: 81
Right 952946634 3:38482315-38482337 TCTCGCTGCAAGGCTGCAGACGG 0: 1
1: 0
2: 1
3: 57
4: 242
952946624_952946633 20 Left 952946624 3:38482262-38482284 CCTTCCTGCGCATTGACATGTAT 0: 1
1: 0
2: 0
3: 3
4: 81
Right 952946633 3:38482305-38482327 GGAGCTTGTGTCTCGCTGCAAGG 0: 1
1: 0
2: 1
3: 9
4: 93
952946624_952946631 -1 Left 952946624 3:38482262-38482284 CCTTCCTGCGCATTGACATGTAT 0: 1
1: 0
2: 0
3: 3
4: 81
Right 952946631 3:38482284-38482306 TGCCATGGGGTTGGTGCTGTGGG 0: 1
1: 0
2: 1
3: 23
4: 268
952946624_952946629 -10 Left 952946624 3:38482262-38482284 CCTTCCTGCGCATTGACATGTAT 0: 1
1: 0
2: 0
3: 3
4: 81
Right 952946629 3:38482275-38482297 TGACATGTATGCCATGGGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952946624 Original CRISPR ATACATGTCAATGCGCAGGA AGG (reversed) Exonic
900813560 1:4826276-4826298 ATAAATGTCAATGCACAGACAGG + Intergenic
900949502 1:5850372-5850394 ACACATGTCACTGGGCAGGCAGG + Intergenic
902786757 1:18737442-18737464 AAACATGTACATGCACAGGAAGG - Intronic
906857346 1:49322325-49322347 ATACATGAAAATGGACAGGAAGG + Intronic
909670400 1:78182200-78182222 ATGCATGTCAATGGCCAGTATGG + Intergenic
910147333 1:84097417-84097439 ATACCTGTCAATACCAAGGATGG - Intronic
915859589 1:159429976-159429998 TTACATATCACTGGGCAGGATGG - Intergenic
917283605 1:173402517-173402539 ATACATGTCAGTGCAGAGCATGG - Intergenic
917434472 1:175005789-175005811 AAACTTGTCAATCCGGAGGATGG + Intronic
918886974 1:190206339-190206361 ATAAATGTCAATGAGCAGTAAGG + Intronic
921624264 1:217360731-217360753 ATATATTTCAAGCCGCAGGATGG - Intergenic
921959175 1:221016323-221016345 CTACATGTTAATGGGCAGAATGG - Intergenic
924076556 1:240344483-240344505 ATACATGTTAGTGTGGAGGAAGG - Intronic
1068411023 10:56654674-56654696 ATAAATATCCATGTGCAGGAAGG + Intergenic
1083107811 11:60375516-60375538 ACACATGACAATGGGCATGATGG - Intronic
1083280136 11:61621872-61621894 ACACATGTCAAAGTTCAGGATGG - Intergenic
1086742442 11:90384213-90384235 ATACATTTCATAGCACAGGATGG + Intergenic
1087652706 11:100887036-100887058 ATGCATGTCAGTACTCAGGATGG + Intronic
1090576083 11:128105519-128105541 ATACTTGTTAAAGCACAGGAAGG + Intergenic
1095078865 12:37971567-37971589 ACACATGTCAATTCACAGAATGG - Intergenic
1097345674 12:58489201-58489223 ATAGCTGTCAATACACAGGATGG - Intergenic
1098690296 12:73479516-73479538 ATACATGTACATGTGCAGAATGG + Intergenic
1100277930 12:93088805-93088827 ATAAATGTTAGTGCGCAGCATGG - Intergenic
1104665254 12:130643182-130643204 CTACATGTCACTGTGCAGGGGGG - Intronic
1108546680 13:51502183-51502205 ATACATATGAAAGCCCAGGAAGG + Intergenic
1110165529 13:72438243-72438265 ATATATGTAAATATGCAGGATGG - Intergenic
1110988185 13:82001508-82001530 ATACATGAAAATGCCCTGGAAGG - Intergenic
1114753937 14:25237302-25237324 ATACATGTATATGTGCATGAGGG + Intergenic
1119459881 14:74792157-74792179 ATACATCACAATGCTAAGGATGG - Intronic
1122129996 14:99599364-99599386 ATGCCTGGCAATGGGCAGGAGGG + Intronic
1131374702 15:91914068-91914090 ATACATGTAAATGCTAGGGAAGG - Intronic
1135728046 16:24872308-24872330 ATACATGACCATGGGCAGGAGGG - Intronic
1140570645 16:76102768-76102790 ATAAATATCCATGGGCAGGAAGG - Intergenic
1141855035 16:86674895-86674917 ATGGATGTTAATGAGCAGGAAGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153867597 18:9287185-9287207 ATGCATGTAAATCAGCAGGACGG - Intergenic
1155995271 18:32324633-32324655 ATCCAAGTCAATGCGCAAGCTGG - Intronic
1156692089 18:39720398-39720420 CTACATGTCACTTCCCAGGAAGG + Intergenic
1157379175 18:47195577-47195599 ATAAATGTCCAGGCACAGGAAGG + Intergenic
1159507502 18:69356142-69356164 ATACTTGTTAATGCACAGTAAGG - Intergenic
1160049278 18:75417062-75417084 ATCCCTGTTAATGGGCAGGAAGG + Intronic
1161558874 19:4959678-4959700 ATACACGTCAATGAGAAGAAAGG - Intronic
925907081 2:8545979-8546001 CTACATGTCAAAGTGCAGCATGG - Intergenic
926356721 2:12047396-12047418 GTACATTTTAATGGGCAGGAGGG + Intergenic
928143095 2:28747874-28747896 ATCCATTTCAGTGAGCAGGATGG + Intergenic
933143331 2:78820882-78820904 ATCCAGGCCAATGCCCAGGAAGG + Intergenic
935061797 2:99615151-99615173 GTACATGTCACTGGGCAGCATGG + Intronic
936754859 2:115695484-115695506 TTACATGGCAGTGGGCAGGAGGG + Intronic
940399554 2:153232029-153232051 ACCCTTGTCAATGCTCAGGAAGG + Intergenic
945389225 2:209243671-209243693 ATACATGTCTTTGCACATGAGGG - Intergenic
947267985 2:228303663-228303685 ATACATTTCAACACTCAGGATGG - Intergenic
1171220562 20:23393234-23393256 ACACACGTCAATGCACAGGGTGG + Intronic
1181512394 22:23394752-23394774 ATCCACCTCAAGGCGCAGGAAGG - Intergenic
952946624 3:38482262-38482284 ATACATGTCAATGCGCAGGAAGG - Exonic
958561488 3:95753137-95753159 ATACATATCCATGTACAGGAAGG + Intergenic
960634014 3:119765704-119765726 ATGCTTGTCAATACACAGGATGG - Exonic
962609376 3:137061158-137061180 ATACTAGTCAATGCTCTGGAGGG + Intergenic
964450991 3:156813180-156813202 ATACATGCCAAAGGGCAGGTAGG + Intergenic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
976530018 4:86140749-86140771 ATACATGTGTATGCACAGGCAGG + Intronic
978531097 4:109714584-109714606 ATACATTTCAGTGCTCACGAGGG - Intronic
981669596 4:147273060-147273082 ATAAATATCCAGGCGCAGGAAGG - Intergenic
985945700 5:3181078-3181100 ATGCATGTTAATGCGCAGTGAGG - Intergenic
986912245 5:12572616-12572638 ATACATGGCAATGTGAAGGTAGG + Intergenic
988514090 5:31890094-31890116 AGCCTTGTCAATGCTCAGGAGGG - Intronic
990128069 5:52543544-52543566 ATACATGTAAATGCAATGGAAGG - Intergenic
992317269 5:75569389-75569411 ATCCATGTCAATGTGCACTATGG - Exonic
996353810 5:122575123-122575145 ATACCTGTAAATGTGCAGAAGGG - Intergenic
996687626 5:126301394-126301416 ATACATTTCAGTGGGCGGGAAGG + Intergenic
997302898 5:132819486-132819508 TTACATGTGAATGCACAGCACGG + Intergenic
997368926 5:133343843-133343865 ATAAATATCAAAGCACAGGATGG + Intronic
1004031449 6:11874102-11874124 ATCCATGTCCATGCTCAGTAGGG + Intergenic
1011975295 6:93288413-93288435 ATACATGTAAATGGGCAGAAGGG + Intronic
1014923121 6:127236662-127236684 ATACATGACAAAGAACAGGAGGG - Intergenic
1020543776 7:9496399-9496421 AGATATGTCAGTGCACAGGATGG - Intergenic
1035242015 7:157538343-157538365 ATATTTGTTAATGCACAGGAAGG - Intergenic
1048112037 8:131478812-131478834 ATTCATGTCTCTGAGCAGGATGG + Intergenic
1049091354 8:140516652-140516674 ATAAATGTCAATGAACAAGAGGG - Exonic
1052020668 9:23522106-23522128 ATACATGTAAATGGTTAGGAAGG + Intergenic
1055975345 9:81949699-81949721 GTACATGTCACTTTGCAGGAGGG - Intergenic
1057535779 9:95904319-95904341 ATACATGTCAATGCTAAGTTCGG - Intronic
1060220162 9:121760282-121760304 GTACATCTCCATGGGCAGGATGG - Exonic
1187096152 X:16150639-16150661 ATACATGTCAAGAAGCAGGTAGG + Exonic
1193908045 X:87266157-87266179 CTTCATATCAATGCGCAGTAAGG - Intergenic
1200411987 Y:2870056-2870078 ACAAATGTCAATGCTCAGGGAGG - Intronic