ID: 952950882

View in Genome Browser
Species Human (GRCh38)
Location 3:38524063-38524085
Sequence CAGGACCTAGAGAAGTTGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
952950874_952950882 11 Left 952950874 3:38524029-38524051 CCAGCCCCAGTTAACTGAATTCC 0: 1
1: 0
2: 1
3: 6
4: 149
Right 952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
952950872_952950882 30 Left 952950872 3:38524010-38524032 CCAATGAAGCCATCGGCTTCCAG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
952950875_952950882 7 Left 952950875 3:38524033-38524055 CCCCAGTTAACTGAATTCCAAGT 0: 1
1: 0
2: 0
3: 14
4: 196
Right 952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
952950873_952950882 21 Left 952950873 3:38524019-38524041 CCATCGGCTTCCAGCCCCAGTTA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
952950877_952950882 5 Left 952950877 3:38524035-38524057 CCAGTTAACTGAATTCCAAGTGA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
952950876_952950882 6 Left 952950876 3:38524034-38524056 CCCAGTTAACTGAATTCCAAGTG 0: 1
1: 0
2: 2
3: 14
4: 161
Right 952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 137
952950879_952950882 -10 Left 952950879 3:38524050-38524072 CCAAGTGAGCCTCCAGGACCTAG 0: 1
1: 0
2: 2
3: 16
4: 142
Right 952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
952950882 Original CRISPR CAGGACCTAGAGAAGTTGTC AGG Exonic
900884852 1:5407930-5407952 CAGGCCCCAGAGGAGGTGTCAGG - Intergenic
902407306 1:16191788-16191810 CAGGACCTGGAGATGGCGTCTGG - Intergenic
906074006 1:43038524-43038546 CAGGACCAAGAGATGTAATCAGG - Intergenic
907467257 1:54646808-54646830 CAGGACAGAGAGAGGTTGCCAGG - Intronic
910218066 1:84862677-84862699 CAGGACCTAGAGGCATTGTGAGG + Intronic
915722673 1:157995772-157995794 CAGGACCTGGTGAAAGTGTCTGG + Intronic
916122796 1:161543913-161543935 CAGAACCTAGAGATGTTTTGTGG + Intronic
916436687 1:164784228-164784250 CAGGAGCTACAGAAGTTGGTAGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
919606668 1:199692128-199692150 TAGCACCTAGAGAAGTTCCCAGG - Intergenic
921269244 1:213452549-213452571 CTGGACCTAGAGAAAATGTGGGG - Intergenic
921309494 1:213828660-213828682 AAGATCTTAGAGAAGTTGTCTGG + Intergenic
923469614 1:234278997-234279019 CAGGACCTCGTGAGGCTGTCAGG - Intronic
924210164 1:241756674-241756696 CACTACCTAGAGAAGTGGTTTGG + Intronic
1063176896 10:3559018-3559040 CAGCACCTTGAGAAGCTTTCAGG + Intergenic
1065623774 10:27610190-27610212 GAAGAGCTAGAGAAGTTGACTGG - Intergenic
1065853624 10:29812438-29812460 CAGCACCTAGAAAAGTTCCCTGG + Intergenic
1072181059 10:92980349-92980371 TAGTATGTAGAGAAGTTGTCTGG + Intronic
1078258396 11:9681147-9681169 CAAGACCTTGAGAGCTTGTCTGG - Intronic
1078635179 11:13043026-13043048 TAGGCTCTAGAGCAGTTGTCAGG + Intergenic
1082260483 11:50073597-50073619 CTGGACCTAGAGAAGCTGACTGG + Intergenic
1085429488 11:76435227-76435249 CAAGACTTAGAGAAATTGTTGGG - Intergenic
1086045350 11:82525389-82525411 CAGCAGCTAGAGAATTTATCTGG - Intergenic
1086200206 11:84193359-84193381 CAGGACAGAGAGAAGATGCCTGG + Intronic
1089922667 11:122225078-122225100 TAGGATCTAGAGAAGTTATCTGG + Intergenic
1090921928 11:131214474-131214496 CAGGACCCAGAGCAGATGTGAGG + Intergenic
1090965539 11:131594806-131594828 TGAGACCTAGAGAAGTTGACAGG + Intronic
1094279773 12:28723205-28723227 CAGGAGATATAGAAGATGTCAGG - Intergenic
1095595323 12:43951547-43951569 AAGGATCTAGAGAAGCAGTCTGG - Intronic
1095837198 12:46651939-46651961 CAGGACCCAGAAAACATGTCAGG + Intergenic
1095979422 12:47962810-47962832 CAGTACCTAGACCAGTTATCTGG - Intergenic
1103263977 12:119613505-119613527 CAGGACCTACTTAAGATGTCGGG + Intronic
1104035547 12:125094798-125094820 CAGGACCTAGAGATCTTGCTGGG - Intronic
1104324253 12:127781144-127781166 AAGGACCTAGAGCAGTATTCAGG - Intergenic
1111327095 13:86713067-86713089 CAGGACCAAGAGGAGATTTCAGG - Intergenic
1112089190 13:96064722-96064744 CAGGACCTAGACAATGTGACAGG - Intergenic
1112093174 13:96104666-96104688 CAGGCCCTGGGGCAGTTGTCTGG - Intronic
1113604825 13:111597756-111597778 CTGGGCCTCGAGCAGTTGTCTGG + Intronic
1115163355 14:30420363-30420385 CAGGACCTCCAGAAGTAGGCAGG + Intergenic
1127304311 15:57690227-57690249 CAGTTCCTAGAGGAATTGTCTGG + Intronic
1127944394 15:63735640-63735662 CATGACCCAGAGAAGTTATGAGG - Intronic
1128824118 15:70694530-70694552 CAGAACCCAGAGAAGTTCTGAGG - Intronic
1129659558 15:77545459-77545481 CAGGAAGGAGAGAAGCTGTCAGG - Intergenic
1132233536 15:100202029-100202051 CACGCCCTGGAGAAGTTGCCTGG + Intronic
1132461791 16:59059-59081 CGGGACCTGGAGAAGCTGGCAGG - Exonic
1134181200 16:12049145-12049167 CAGGAAAGAGAGGAGTTGTCAGG + Intronic
1135307939 16:21382900-21382922 CAGGAAAGAGAGGAGTTGTCAGG + Intergenic
1136304684 16:29362020-29362042 CAGGAAAGAGAGGAGTTGTCAGG + Intergenic
1138125476 16:54434926-54434948 CAGGACCTAGAGTTTTTGTATGG - Intergenic
1139245003 16:65433129-65433151 GGGGACCTAGACAAATTGTCTGG - Intergenic
1140949694 16:79804966-79804988 CAGGACCAAGACATGCTGTCTGG - Intergenic
1144287682 17:13794086-13794108 CAAGACCTAGAGGATTTGACAGG - Intergenic
1144668130 17:17115898-17115920 CATGAGGTAGAGAAGCTGTCTGG - Intronic
1146935455 17:36810027-36810049 CAGGCCCTAGAGAGGATGGCAGG + Intergenic
1147170014 17:38612848-38612870 TAGGACCTTGAGATGTTTTCTGG + Intergenic
1147997298 17:44367543-44367565 CTGGATCAAGATAAGTTGTCTGG + Intergenic
1151584192 17:74998689-74998711 AAAGATCTAGAGAAGTTGACAGG + Intronic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1152153273 17:78616218-78616240 CTGGACGTGGAGAAGTCGTCTGG - Intergenic
1157843247 18:50978814-50978836 CTGGACCTAGAGAAGAAGTCAGG + Intronic
1163755110 19:19101905-19101927 CAGGTGCTAGAGAAGCTGCCAGG + Intronic
1165713117 19:38026149-38026171 CAGGGCCTGGTGAGGTTGTCAGG + Intronic
926881521 2:17550248-17550270 CAGGACCTAGAGTAGGGGTGGGG - Intronic
927451211 2:23211013-23211035 CAGGACCTAGGGAAGGCATCTGG + Intergenic
927652015 2:24919006-24919028 CTGGCCCTAGAGAAGTGGACTGG + Exonic
927707153 2:25303494-25303516 CAGGACCTGGAGAGGTGGCCTGG - Intronic
928247695 2:29645572-29645594 CTGGCCCTAGAGAAGTTGCATGG + Intronic
930666612 2:54105425-54105447 TAGGGCTTAGAGAGGTTGTCTGG - Intronic
933174944 2:79164504-79164526 AAGGACCTTGAAAAGTGGTCAGG - Intergenic
936097636 2:109544813-109544835 CAGAGCCTAGAGCAGTTGTCTGG - Intronic
940304709 2:152213065-152213087 CAGGACCTAGTGGAGGTGTTTGG - Intergenic
940506998 2:154568515-154568537 CACGACCAAAAGAAGTTTTCAGG - Intergenic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
946245540 2:218385139-218385161 CAGCACCCAGAGAAGCTGTGAGG - Exonic
947123810 2:226845577-226845599 CAGAATATAAAGAAGTTGTCAGG - Intronic
1168741977 20:199900-199922 CAGGGCCTTGAGAAGTAGCCAGG - Intergenic
1174504596 20:51009110-51009132 CAGGACCCAGAAAATGTGTCTGG + Intronic
1177495107 21:21878821-21878843 CAGGAACAGGAGAAGTTTTCTGG - Intergenic
1178033495 21:28555153-28555175 AAGGATCTAGAGAAGCAGTCTGG - Intergenic
1180955119 22:19738029-19738051 CAGGACCGAGAGAGGTGGCCCGG + Intergenic
1181368608 22:22398910-22398932 CAGGTCCCAGCGAAGTTCTCAGG + Intergenic
1181973480 22:26711420-26711442 CAGGACATATAGAAAGTGTCAGG - Intergenic
1183049178 22:35246719-35246741 CAGGACCTGAAGAAGTTCCCTGG - Intergenic
1183071864 22:35401819-35401841 AAGGACTTAGGGAAGTTTTCCGG + Intronic
1184236519 22:43186149-43186171 CAGCACCTGGAGGAGATGTCGGG + Intronic
950679181 3:14573354-14573376 CGGGACCTGGAGAAGCTGGCAGG - Intergenic
952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG + Exonic
954536351 3:51362088-51362110 CAGGAGCTAGAGAATTAGGCAGG - Intronic
955342781 3:58138265-58138287 CAGGACCTGGAGAAGAGTTCAGG - Exonic
955424108 3:58769332-58769354 CAGGGCTGAGAGAAGATGTCCGG + Intronic
955785800 3:62537635-62537657 CAGGAACTAGCGATGCTGTCAGG + Intronic
960628980 3:119709469-119709491 CAGGAACTTGAGAAGTTGTTGGG + Intronic
961172558 3:124808352-124808374 CAGGACCTCCAGAAGATGTGTGG + Intronic
965967813 3:174516508-174516530 CAGGGCCTTTAGAAGTTGACTGG + Intronic
966057266 3:175709665-175709687 AAGTACCTAGTGAAATTGTCTGG + Intronic
966397982 3:179521259-179521281 CAAGAGCTAGAGAAATTGCCTGG - Intergenic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
968982215 4:3856465-3856487 CAGGACCCAGGCAAGTTGTTTGG + Intergenic
969282271 4:6178759-6178781 CATGACCTAGAGAATTTGGTAGG - Intronic
975471689 4:74776316-74776338 CAGGACCTGAAGAATTTCTCAGG + Intronic
978275379 4:106942938-106942960 CAAGACCTGGAGAAGTAGGCAGG - Intronic
979035335 4:115709169-115709191 TAGGAAGTAGAAAAGTTGTCAGG + Intergenic
980901634 4:138910849-138910871 AAGAACCTACAGAAGCTGTCAGG + Intergenic
982937564 4:161502123-161502145 CTGGACTTAAAGTAGTTGTCAGG - Intronic
984142629 4:176022201-176022223 CATGACCTAGAGACTTGGTCAGG + Intergenic
986541168 5:8845039-8845061 CTGGACTGAGAGAAGCTGTCTGG - Intergenic
988255178 5:28810225-28810247 CAGGACAAAGAGAAGGCGTCGGG + Intergenic
992502424 5:77355830-77355852 CAGGACCTAAGGAGGCTGTCTGG + Intronic
993672883 5:90783641-90783663 CATGACCTAGGGCAGTTGTAGGG - Intronic
996423409 5:123286747-123286769 CAAGACCTAGAGAAATTCTAGGG - Intergenic
998316470 5:141187586-141187608 CTGGACCGAGAGAAGCTGTGTGG + Exonic
998317089 5:141192820-141192842 CTGGACCGAGAGAAGCTGTGTGG + Exonic
999953180 5:156672018-156672040 CAGGGCCTAGAGGAGGTGTTTGG - Intronic
1000366945 5:160500551-160500573 CCGGACCTACAGAAATTGTGGGG + Intergenic
1000791205 5:165609654-165609676 AAGGATCTTGAGAAATTGTCTGG - Intergenic
1005813904 6:29535174-29535196 CAGGATATAGTGAGGTTGTCTGG - Intergenic
1005948110 6:30609900-30609922 CAGGCCCTTGAGAAGTTCTTTGG + Exonic
1006572508 6:35017529-35017551 CAGGTCCCAGAGCAGTTCTCAGG + Exonic
1007070046 6:39029729-39029751 CAGGATCTAGAGCTGCTGTCAGG - Intronic
1013036406 6:106388278-106388300 CAGGACCTAGAAAATTTGGGAGG - Intergenic
1013955828 6:115839188-115839210 CAGGTAGTAGAGTAGTTGTCTGG - Intergenic
1021202562 7:17742258-17742280 CAGGCCCTGGGGAAGTGGTCAGG - Intergenic
1023237163 7:38101440-38101462 CAGGGCCTTGAGAAGTAGTATGG + Intergenic
1024369046 7:48559140-48559162 CTGGACCCAGAGAAGCTGTCTGG + Intronic
1026377688 7:69768547-69768569 CTGGACCTATATAAGCTGTCAGG + Intronic
1032234101 7:130104737-130104759 CAGGACCAAGAGGAGTTGAGGGG + Intronic
1032414702 7:131727196-131727218 CTGGCCCTAGAGATGCTGTCAGG - Intergenic
1037448972 8:18997637-18997659 CAGGACCTGGCGACGGTGTCCGG + Intronic
1039527275 8:38228048-38228070 CAGAACCTAAAGAATTTATCTGG + Intronic
1040659436 8:49553026-49553048 CAGGACCTAGACAAATTGCCTGG + Intronic
1046094418 8:109540095-109540117 CAGTACCCAGAGCAGCTGTCGGG - Intronic
1046651079 8:116837267-116837289 CAGGACCTACAGAAGTTGCATGG + Intronic
1047300601 8:123610525-123610547 CAGGACTTAGAGAAGGCTTCAGG + Intergenic
1049287872 8:141786421-141786443 CAGGACCTAGAGAGGGTCTGTGG + Intergenic
1049392028 8:142376673-142376695 CATGGCCTGGAGAAGGTGTCAGG + Intronic
1050986651 9:12091539-12091561 CAGGCCCTGGGGAAGTGGTCAGG + Intergenic
1057831934 9:98413791-98413813 GGGGACCTAGAGAAGATGGCTGG + Intronic
1062425325 9:136503580-136503602 CAGGAGCCAGAGAGGGTGTCAGG - Intronic
1203779962 EBV:95852-95874 CAAGACATAGAGATGGTGTCCGG + Intergenic
1188007544 X:25026345-25026367 AAGGTCCTAGAGAAGCTGTTTGG - Intergenic
1193976273 X:88123279-88123301 CAGAAGCTAGAGAAGTTGGGGGG + Intergenic
1196483877 X:116181741-116181763 CAGGACCCAGGGGTGTTGTCTGG - Intergenic
1198508797 X:137328252-137328274 CTGGAACTAGAGAAGTAGCCAGG + Intergenic
1198790426 X:140339640-140339662 CAGGAGCTAGGGAAGTTCTGTGG + Intergenic
1199194590 X:145013061-145013083 CCAGACCTAGAGATGTTTTCTGG + Intergenic
1200794026 Y:7324352-7324374 ATGGACCTTGAGAACTTGTCTGG + Intergenic